Team:Bologna/Project

From 2009.igem.org

(Difference between revisions)

Latest revision as of 02:56, 22 October 2009

HOME	TEAM	PROJECT	SOFTWARE	MODELING	WET LAB	PARTS	HUMAN PRACTICE	JUDGING CRITERIA

T-REX Project

(Trans-Repressor of Expression)

The aim of our project is the design of a standard device to control the synthesis of any protein of interest. This "general-purpose" device, implemented in E. coli, acts at the translational level to allow silencing of protein expression faster than using regulated promoters. We named this device T-REX (Trans Repressor of Expression).
T-REX consists of two new BioBricks:

CIS-repressing, to be assembled upstream of the target protein coding sequence. It contains a ribosomal binding site (RBS);

TRANS-repressor, complementary to the CIS-repressing and placed under the control of a different promoter. For a better repressive effectiveness, the TRANS sequence contains also a RBS cover, released in two versions of different length (either 4 or 7 nucleotides).
The longer version covers also 3 nucleotides of the Shine-Dalgarno sequence.

Transcription of the target gene yields a mRNA strand - containing the CIS-repressing sequence at its 5' end - available for translation into protein by ribosomes (see Fig. 1, left panel). When the promoter controlling the TRANS coding sequence is active, it drives the transcription of an oligoribonucleotide complementary to the CIS mRNA sequence. The TRANS/CIS RNA duplex prevents ribosomes from binding to RBS on target mRNA, thus silencing protein synthesis. The amount of the TRANS-repressor regulates the rate of translation of the target mRNA (see Fig. 1, right panel)

Figure 1 - T-REX device

CIS and TRANS Parts Design

To identify CIS-repressing and TRANS-repressor DNA sequences, we developed BASER software. We used it to seek for two complementary 50bp non-coding sequences, whose transcribed RNAs:
a) feature maximal free energy in the secondary structure (i.e. reducing the probability of its intra-molecular annealing);
b) have minimal unwanted interactions with genomic mRNA;
c) present a minimal probability of partial/shifted hybridization with complementary strands.

Here below are the CIS-repressing and TRANS-repressor sequences. More details about BASER and its functioning can be found in the software section.

CIS-repressing
Prefix	non-coding TRANS target	RBS	Suffix
GAATTCGCGGCCGCTTCTAGAG	AACACAAACTATCACTTTAACAACACATTACATATACATTAAAATATTAC	AAAGAGGAGAAA	TACTAGTAGCGGCCGCTGCAG

TRANS-repressor (4)
Prefix	RBS cover	non-coding TRANS	Suffix
GAATTCGCGGCCGCTTCTAGAG	CTTT	GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT	TACTAGTAGCGGCCGCTGCAG

TRANS-repressor (7)
Prefix	RBS cover	non-coding TRANS	Suffix
GAATTCGCGGCCGCTTCTAGAG	CCTCTTT	GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT	TACTAGTAGCGGCCGCTGCAG

Testing Circuit

In order to test our T-REX device, we developed the following genetic circuit (Fig. 2):

Figure 2 - Genetic Circuit to test CIS and TRANS' mRNA functionality

The CIS-repressing sequence is assembled upstream of lac I (BBa_C0012), therefore the synthesis of LacI should be silenced/damped by the constitutively transcribed TRANS-repressor mRNA. To detect silencing of LacI, due to the action of T-REX, we realized a new inverter (BBa_K201001) consisting of a promoter regulated by LacI (BBa_K201008) and a GFP reporter (BBa_J04031).
We expect that a TRANS-repressor oligoribonucleotide with high affinity to CIS-repressing mRNA, inhibits the translation of LacI and then determines a maximally expressed GFP. Otherwise, in case of low TRANS/CIS affinity one should expect partially (or completely) repressed GFP expression.
To maximize the probability to silence the CIS transcript and switch on the GFP, we decided to use a high copy number (HCN) plasmid (pSB1A2) for the TRANS-repressor and a low copy number (LCN) plasmid (pSB3K3) for the LacI generator.
If the GFP inverter is unable to reveal the LacI reduction due to T-REX action, because of a high level of the free LacI concentration, IPTG can be supplied to reduce free LacI. In fact, the sensitivity of the GFP inverter to LacI variations depends on free LacI concentration. Using IPTG is thus possible to set actual LacI value in the region where the inverter has the highest sensitivity.

Mathematical Model

To characterize the T-REX device, we developed a mathematical model of the whole testing circuit considering the interaction between all its parts. Model equations were implemented in Simulink (Fig. 4) to simulate the circuit and it intermediate parts. After the identification of model parameters on the data obtained from experiments with the intermediate parts, the GFP level as a function of the TRANS/CIS affinity was predicted by simulating the whole testing circuit .

Figure 4 - Simulink Model

Characterization of Parts

The Testing Circuit is constituted by intermediate parts that were experimentally characterized to obtain date for the model paramiter identification. Details of this characterization are available in the wet-lab section.

@@ Line 7: / Line 7: @@
 <br><br>
 <font face="Calibri" font size="4" color="#000000">
-The aim of our project is the design of a new device to control the synthesis of any protein of interest. This "general-purpose" standard device, implemented in <i>E. coli</i>, acts at the translational level to allow a switch in protein expression faster than transcriptional promoter regulation. We named this device <b>T-Rex</b> (<b>T</b>rans <b>R</b>epressor of <b>Ex</b>pression). <br>T-rex consists of two new BioBricks:
+The aim of our project is the design of a standard device to control the synthesis of any protein of interest. This "general-purpose" device, implemented in <i>E. coli</i>, acts at the translational level to allow silencing of protein expression faster than using regulated promoters. We named this device <b>T-REX</b> (<b>T</b>rans <b>R</b>epressor of <b>Ex</b>pression). <br>T-REX consists of two new BioBricks:
 <br><br>
 <ul>
@@ Line 13: / Line 13: @@
 </ul>
 <ul>
-<li><font color="#000080"><b>TRANS-repressor</b></font>, complementary to the CIS-repressing and placed under the control of a different promoter.  In order to have a better repression, it contains also a <font color="#228b22"><b>RBS cover</b></font> in two versions of different length (4 and 7 nucleotides). <br>The longer version covers also 3 nucleotides of the Shine-Dalgarno sequence.
+<li><font color="#000080"><b>TRANS-repressor</b></font>, complementary to the CIS-repressing and placed under the control of a different promoter.  For a better repressive effectiveness, the TRANS sequence contains also a <font color="#228b22"><b>RBS cover</b></font>, released in two versions of different length (either 4 or 7 nucleotides). <br>The longer version covers also 3 nucleotides of the Shine-Dalgarno sequence.
 </ul>
 <br>
-Transcription of the target gene produces a mRNA strand, starting with the Cis element, which is translated into proteins by ribosome (<i>see Fig. 1, right panel</i>). Trans’ promoter induction produces a transcript that binds with the Cis part. The <b>RNA duplex</b> prevents ribosome from binding to RBS, <b>repressing protein synthesis</b>. Thus, the TRANS-repressor amount regulates the gene mRNA translation rate (<i>see Fig. 1, left panel</i>)
+Transcription of the target gene yields a mRNA strand - containing the CIS-repressing sequence at its 5' end - available for translation into protein by ribosomes (<i>see Fig. 1, left panel</i>). When the promoter controlling the TRANS coding sequence is active, it drives the transcription of an oligoribonucleotide complementary to the CIS mRNA sequence. The TRANS/CIS <b>RNA duplex</b> prevents ribosomes from binding to RBS on target mRNA, thus <b>silencing protein synthesis</b>. The amount of the TRANS-repressor regulates the rate of translation of the target mRNA (<i>see Fig. 1, right panel</i>)
 </html>
-<br><br><br>
-[[Image:project3b.png|center|950px|thumb|<center>Figure 1 - T-Rex device</center>]]
 <br><br>
+[[Image:project3b.png|center|950px|thumb|<center>Figure 1 - T-REX device</center>]]
+<br><br>
+<font face="Calibri" font size="5" color="#000000"><b>CIS and TRANS Parts Design</b>
+<br><br>
+<font face="Calibri" font size="4" color="#000000">
 <html>
 <font face="Calibri" font size="4" color="#000000">
-To identify CIS-repressing and TRANS-repressor complementary parts, we developed <a href="https://2009.igem.org/Team:Bologna/Software">BASER</a> software. We used it to seek for two complementary 50bp non-coding sequences, whose transcribed RNAs:<br>
+To identify CIS-repressing and TRANS-repressor DNA sequences, we developed <a href="https://2009.igem.org/Team:Bologna/Software">BASER</a> software. We used it to seek for two complementary 50bp non-coding sequences, whose transcribed RNAs:<br>
 a) feature maximal free energy in the secondary structure (i.e. reducing the probability of its intra-molecular annealing); <br>
 b) have minimal unwanted interactions with genomic mRNA; <br>
 c) present a minimal probability of partial/shifted hybridization with complementary strands. <br><br>
-Here below are the CIS-repressing and TRANS-repressor sequences:
+Here below are the CIS-repressing and TRANS-repressor sequences. More details about BASER and its functioning can be found in the <html><a href="https://2009.igem.org/Team:Bologna/Software">software section</a>.</html>
 <br><br>
-</html>
 {| align="center"
@@ Line 79: / Line 78: @@
 |}
 <br><br>
-More details about BASER and its functioning can be found in the <html><a href="https://2009.igem.org/Team:Bologna/Software">software section</a>.</html>
-<br><br><br><br>
 <html>
-<font face="Calibri" font size="5" color="#000000"><b>The Genetic Circuits</b>
+<font face="Calibri" font size="5" color="#000000"><b>Testing Circuit</b>
 <br><br>
 <font face="Calibri" font size="4" color="#000000">
-In order to test and characterize our T-REX device, we developed the following genetic circuit (Fig 2):
+In order to test our T-REX device, we developed the following genetic circuit (Fig. 2):
 </html>
 <br><br>
-[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 2 - Genetic Circuit</center>]]
+[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 2 - Genetic Circuit to test CIS and TRANS' mRNA functionality</center>]]
-<br><br>
-The circuit above represents the ON configuration of our T-Rex device: TRANS-repressor is constitutively expressed and CIS-repressing is assembled upstream the LacI gene (BBa_C0012), while the reporter protein GFP (BBa_J04031) is assembled under the control of another promoter, regulated by LacI natural operator O2.
 <br>
-CIS-repressing and TRANS-repressor mRNAs bind together, preventing LacI translation and allowing GFP production.
+The CIS-repressing sequence is assembled upstream of <i>lac</i> I (BBa_C0012), therefore the synthesis of LacI should be silenced/damped by the constitutively transcribed TRANS-repressor mRNA. To detect silencing of LacI, due to the action of T-REX, we realized a new inverter (BBa_K201001) consisting of  a promoter regulated by LacI (BBa_K201008) and a GFP reporter (BBa_J04031).<br>
-<br>
+We expect that a TRANS-repressor oligoribonucleotide with high affinity to CIS-repressing mRNA, inhibits the translation of LacI and then determines a maximally expressed GFP. Otherwise, in case of low TRANS/CIS affinity one should expect partially (or completely) repressed GFP expression.<br>
-Using some IPTG, the repression action of T-Rex become easily, because the concentration of free LacI in the cells is reduced.
+To maximize the probability to silence the CIS transcript and switch on the GFP, we decided to use a high copy number (HCN) plasmid (pSB1A2) for the TRANS-repressor and a low copy number (LCN) plasmid (pSB3K3) for the LacI generator. <br>If the GFP inverter is unable to reveal the LacI reduction due to T-REX action, because of a high level of the free LacI concentration, IPTG can be supplied to reduce free LacI. In fact, the sensitivity of the GFP inverter to LacI variations depends on free LacI concentration. Using IPTG is thus possible to set actual LacI value in the region where the inverter has the highest sensitivity.
 <br><br>
-To prove T-Rex repression, GFP production level must be compared with the level produced by the OFF configuration of our T-Rex device, that is the same circuit in absence of TRANS-repressor:
+<font face="Calibri" font size="5" color="#000000"><b>Mathematical Model</b>
-<br><br>
-[[Image:OffCircuit_tag.png|center|900px]]
-<br><br>
-In this second case, LacI is regularly translated and, binding with its O2 natural operator, it blocks GFP production.
-<br>
-We choose to use a low copy number plasmid and a weak promoter (J23118) for the CIS-repressing/LacI production, and a high copy number plasmid and a strong promoter (J23100) for the TRANS-repressing, to make reporter production's variations easily to be detected.
-<br>
-<br>
-<br>
-<br>
-Before realizing the whole T-Rex device, we decided to perform some preliminary tests, in order to characterize every single BioBrick involved in it.
-<br>
-<br>
-<html>
-<font face="Calibri" font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b>
 <br><br>
 <font face="Calibri" font size="4" color="#000000">
-</html>
+To characterize the T-REX device, we developed a [https://2009.igem.org/Team:Bologna/Modeling mathematical model] of the whole testing circuit considering the interaction between all its parts. Model equations were implemented in Simulink (Fig. 4) to simulate the circuit and it intermediate parts. After the identification of model parameters on the data obtained from experiments with the intermediate parts, the GFP level as a function of the TRANS/CIS affinity  was predicted by simulating the whole testing circuit .
-* In order to characterize the difference between the high copy number pSB1A2 and the low to medium copy number pSB3K3 plasmids, we analyzed production of BBa_I13504 (wild type GFP) under BBa_J23118 promoter (1429):
+[[Image:ModelSandro.png|center|900px|thumb|<center>Figure 4 - Simulink Model</center>]]
-<br>
-{|align="center"
-|[[Image:1429GFP_openloop_hc.png|center|450 px]]
-|[[Image:1429GFP_openloop_lc.png|center|450 px]]
-|}
-<center>
-<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#Plasmid_copy_number_characterization wet-lab section]</b> </center>
-<br>
-<br>
-<html>
-<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b>
 <br><br>
-<font face="Calibri" font size="4" color="#000000">
+<font face="Calibri" font size="5" color="#000000"><b>Characterization of Parts</b></font>
-</html>
-* In order to characterize the ratio between BBa_J23100 (strength 2547) and BBa_J23118 (strength 1429) promoters, we analyzed GFP (BBa_J04031) production on pSB1A2:
-<br>
-{|align="center"
-|[[Image:2547GFP_open_tag.png|center|450 px]]
-|[[Image:1429GFP_openloop_hc_tag.png|center|450 px]]
-|}
-<center>
-<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#Promoter_characterization wet-lab section]</b></center>
-<br>
-<br>
-<html>
-<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI natural operator O2</b>
 <br><br>
-<font face="Calibri" font size="4" color="#000000">
+The Testing Circuit is constituted by intermediate parts that were experimentally characterized to obtain date for the model paramiter identification. Details of this characterization are available in the [https://2009.igem.org/Team:Bologna/Wetlab wet-lab] section.
-</html>
-* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We evaluate this on pSB1A2, using BBa_J04031 under the control of both BBa_J23118 and BBa_J23100, in presence and in absence of BBa_K079019:
-<br>
-{|align="center"
-|[[Image:2547GFP_open_tag.png|center|450 px]]
-|[[Image:2547GFPO2_open_tag.png|center|450 px]]
-|}
 <br><br>
-{|align="center"
-|[[Image:1429GFP_openloop_hc_tag.png|center|450 px]]
-|[[Image:1429GFP_O2_tag.png|center|450 px]]
-|}
-<center>
-<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#GFP_production_in_absence_/_presence_of_operator_Ox wet-lab section]</b></center>
-<br>
-<br>
-<html>
-<font face="Calibri" font size="5" color="#000000"><b>Interaction of <i>LacI repressor</i> with its <i>natural operator O2</i></b>
-<br><br>
-<font face="Calibri" font size="4" color="#000000">
-</html>
-* We studied interactions between LacI repressor and its natural operator O2, analyzing this two genetic circuits:
-{|align="center"
-|[[Image:LACi_GFP2_tag.png|center|750 px]]
-|}
-<br><br>
-{|align="center"
-|[[Image:openLACi_GFP_tag.png|center|750 px]]
-|}
-In the first circuit, we used different IPTG concentration in order to evaluate LacI repression strength. In the latter, we verified that LacI doesn't interfere with GFP production if its natural operator O2 is not present.
-<br><br>
-<center><b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization wet-lab section]</b></center>
-<br>
-</font>