Team:Bologna/Project

From 2009.igem.org

(Difference between revisions)
Line 20: Line 20:
<br><br><br>
<br><br><br>
[[Image:project3b.png|center|950px|thumb|<center>Figure 1 - T-REX device</center>]]
[[Image:project3b.png|center|950px|thumb|<center>Figure 1 - T-REX device</center>]]
-
<br><br>
+
<br>
-
 
+
<html>
<html>
-
 
<font face="Calibri" font size="4" color="#000000">
<font face="Calibri" font size="4" color="#000000">
To identify CIS-repressing and TRANS-repressor complementary parts, we developed <a href="https://2009.igem.org/Team:Bologna/Software">BASER</a> software. We used it to seek for two complementary 50bp non-coding sequences, whose transcribed RNAs:<br>
To identify CIS-repressing and TRANS-repressor complementary parts, we developed <a href="https://2009.igem.org/Team:Bologna/Software">BASER</a> software. We used it to seek for two complementary 50bp non-coding sequences, whose transcribed RNAs:<br>
Line 30: Line 28:
c) present a minimal probability of partial/shifted hybridization with complementary strands. <br><br>
c) present a minimal probability of partial/shifted hybridization with complementary strands. <br><br>
Here below are the CIS-repressing and TRANS-repressor sequences:
Here below are the CIS-repressing and TRANS-repressor sequences:
-
 
<br><br>
<br><br>
</html>
</html>
Line 90: Line 87:
<br><br>
<br><br>
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 2 - Genetic Circuit to test CIS and TRANS' mRNA functionality</center>]]
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 2 - Genetic Circuit to test CIS and TRANS' mRNA functionality</center>]]
-
<br><br>
+
<br>
-
 
+
The CIS-repressing sequence is assembled upstream of LacI (BBa_C0012), therefore the synthesis of LacI should be silenced/damped by the constitutively transcribed TRANS-repressor mRNA. To detect silencing of LacI, due to the action of T-REX, we realized a new inverter (BBa_K201001) consisting of  a promoter regulated by LacI (BBa_K201008) and a GFP reporter (BBa_J04031).<br>
The CIS-repressing sequence is assembled upstream of LacI (BBa_C0012), therefore the synthesis of LacI should be silenced/damped by the constitutively transcribed TRANS-repressor mRNA. To detect silencing of LacI, due to the action of T-REX, we realized a new inverter (BBa_K201001) consisting of  a promoter regulated by LacI (BBa_K201008) and a GFP reporter (BBa_J04031).<br>
We expect that a TRANS-repressor oligoribonucleotide with high affinity to CIS-repressing mRNA, inhibits the translation of LacI and then determines a maximally expressed GFP. Otherwise, in case of low TRANS/CIS affinity one should expect partially (or completely) repressed GFP expression.<br>
We expect that a TRANS-repressor oligoribonucleotide with high affinity to CIS-repressing mRNA, inhibits the translation of LacI and then determines a maximally expressed GFP. Otherwise, in case of low TRANS/CIS affinity one should expect partially (or completely) repressed GFP expression.<br>
To maximize the probability to silence the CIS transcript and switch on the GFP, we decided to use a high copy number (HCN) plasmid (pSB1A2) for the TRANS-repressor and a low copy number (LCN) plasmid (pSB3K3) for the LacI generator. <br>If the GFP inverter is unable to reveal the LacI reduction due to T-REX action, because of a high level of the free LacI concentration, IPTG can be supply to reduce free LacI. In fact, the sensitivity of the GFP inverter to LacI variations depends on free LacI concentration. Using IPTG is thus possible to set actual LacI value in the region where the inverter has the highest sensitivity.
To maximize the probability to silence the CIS transcript and switch on the GFP, we decided to use a high copy number (HCN) plasmid (pSB1A2) for the TRANS-repressor and a low copy number (LCN) plasmid (pSB3K3) for the LacI generator. <br>If the GFP inverter is unable to reveal the LacI reduction due to T-REX action, because of a high level of the free LacI concentration, IPTG can be supply to reduce free LacI. In fact, the sensitivity of the GFP inverter to LacI variations depends on free LacI concentration. Using IPTG is thus possible to set actual LacI value in the region where the inverter has the highest sensitivity.
-
 
+
<br><br>
<font face="Calibri" font size="5" color="#000000"><b>Mathematical Model</b>
<font face="Calibri" font size="5" color="#000000"><b>Mathematical Model</b>
<br><br>
<br><br>
Line 102: Line 98:
In order to characterize the T-REX device, we developed a mathematical model of the testing circuit. (LINK)
In order to characterize the T-REX device, we developed a mathematical model of the testing circuit. (LINK)
***é PARTE MODELLO***
***é PARTE MODELLO***
-
 
-
 
<br><br>
<br><br>
<font face="Calibri" font size="5" color="#000000"><b>Testing Circuit's Positive Control</b></font>
<font face="Calibri" font size="5" color="#000000"><b>Testing Circuit's Positive Control</b></font>
Line 111: Line 105:
<br><br>
<br><br>
[[Image:OffCircuit1.png|center|900px|thumb|<center>Figure 3 - Testing Circuit's Positive Control</center>]]
[[Image:OffCircuit1.png|center|900px|thumb|<center>Figure 3 - Testing Circuit's Positive Control</center>]]
-
<br><br>
 
<br>
<br>
<br>
<br>
<font face="Calibri" font size="5" color="#000000"><b>Characterization???</b></font>
<font face="Calibri" font size="5" color="#000000"><b>Characterization???</b></font>
-
<br>
+
<br><br>
Before realizing the whole T-REX device, we decided to analyze the intermediate circuits, in order to assign the model parameters.
Before realizing the whole T-REX device, we decided to analyze the intermediate circuits, in order to assign the model parameters.
<br>
<br>
Line 174: Line 167:
|[[Image:LACi_GFP2_tag.png|center|750 px]]
|[[Image:LACi_GFP2_tag.png|center|750 px]]
|}
|}
-
<br><br>
 
-
 
<br><br>
<br><br>
<center><b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization wet-lab section]</b></center>
<center><b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization wet-lab section]</b></center>
<br>
<br>
</font>
</font>

Revision as of 23:29, 21 October 2009

ProvaBol2.png
HOME TEAM PROJECT SOFTWARE MODELING WET LAB PARTS HUMAN PRACTICE JUDGING CRITERIA


T-REX Project

(Trans-Repressor of Expression)


The aim of our project is the design of a standard device to control the synthesis of any protein of interest. This "general-purpose" device, implemented in E. coli, acts at the translational level to allow silencing of protein expression faster than using regulated promoters. We named this device T-REX (Trans Repressor of Expression).
T-REX consists of two new BioBricks:

  • CIS-repressing, to be assembled upstream of the target protein coding sequence. It contains a ribosomal binding site (RBS);
  • TRANS-repressor, complementary to the CIS-repressing and placed under the control of a different promoter. For a better repressive effectiveness, the TRANS sequence contains also a RBS cover, released in two versions of different length (either 4 or 7 nucleotides).
    The longer version covers also 3 nucleotides of the Shine-Dalgarno sequence.

Transcription of the target gene yields a mRNA strand - containing the CIS-repressing sequence at its 5' end - available for translation into protein by ribosomes (see Fig. 1, left panel). When the promoter controlling the TRANS coding sequence is active, it drives the transcription of an oligoribonucleotide complementary to the CIS mRNA sequence. The TRANS/CIS RNA duplex prevents ribosomes from binding to RBS on target mRNA, thus silencing protein synthesis. The amount of the TRANS-repressor regulates the rate of translation of the target mRNA (see Fig. 1, right panel)


Figure 1 - T-REX device


To identify CIS-repressing and TRANS-repressor complementary parts, we developed BASER software. We used it to seek for two complementary 50bp non-coding sequences, whose transcribed RNAs:
a) feature maximal free energy in the secondary structure (i.e. reducing the probability of its intra-molecular annealing);
b) have minimal unwanted interactions with genomic mRNA;
c) present a minimal probability of partial/shifted hybridization with complementary strands.

Here below are the CIS-repressing and TRANS-repressor sequences:

CIS-repressing
Prefix non-coding TRANS target RBS Suffix
GAATTCGCGGCCGCTTCTAGAG AACACAAACTATCACTTTAACAACACATTACATATACATTAAAATATTAC AAAGAGGAGAAA TACTAGTAGCGGCCGCTGCAG


TRANS-repressor (4)
Prefix RBS cover non-coding TRANS Suffix
GAATTCGCGGCCGCTTCTAGAG CTTT GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT TACTAGTAGCGGCCGCTGCAG


TRANS-repressor (7)
Prefix RBS cover non-coding TRANS Suffix
GAATTCGCGGCCGCTTCTAGAG CCTCTTT GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT TACTAGTAGCGGCCGCTGCAG



More details about BASER and its functioning can be found in the software section.



Testing Circuit

In order to test our T-REX device, we developed the following genetic circuit (Fig. 2):

Figure 2 - Genetic Circuit to test CIS and TRANS' mRNA functionality


The CIS-repressing sequence is assembled upstream of LacI (BBa_C0012), therefore the synthesis of LacI should be silenced/damped by the constitutively transcribed TRANS-repressor mRNA. To detect silencing of LacI, due to the action of T-REX, we realized a new inverter (BBa_K201001) consisting of a promoter regulated by LacI (BBa_K201008) and a GFP reporter (BBa_J04031).
We expect that a TRANS-repressor oligoribonucleotide with high affinity to CIS-repressing mRNA, inhibits the translation of LacI and then determines a maximally expressed GFP. Otherwise, in case of low TRANS/CIS affinity one should expect partially (or completely) repressed GFP expression.
To maximize the probability to silence the CIS transcript and switch on the GFP, we decided to use a high copy number (HCN) plasmid (pSB1A2) for the TRANS-repressor and a low copy number (LCN) plasmid (pSB3K3) for the LacI generator.
If the GFP inverter is unable to reveal the LacI reduction due to T-REX action, because of a high level of the free LacI concentration, IPTG can be supply to reduce free LacI. In fact, the sensitivity of the GFP inverter to LacI variations depends on free LacI concentration. Using IPTG is thus possible to set actual LacI value in the region where the inverter has the highest sensitivity.

Mathematical Model

In order to characterize the T-REX device, we developed a mathematical model of the testing circuit. (LINK)

      • é PARTE MODELLO***



Testing Circuit's Positive Control

To have a positive control, we designed a circuit (Fig. 3) that simulates the behavior of the testing circuit (Fig. 2) when the T-REX device is idle or for the absence of TRANS-repressor or in case that TRANS-repressor mRNA is unable to silence LacI translation.

Figure 3 - Testing Circuit's Positive Control



Characterization???

Before realizing the whole T-REX device, we decided to analyze the intermediate circuits, in order to assign the model parameters.

pSB1A2 vs pSB3K3

  • In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3:


1429GFP openloop hc.png
1429GFP openloop lc.png
Results can be found in the wet-lab section



BBa_J23100 vs BBa_J23118

  • In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2:


2547GFP open tag.png
1429GFP openloop hc tag.png
Results can be found in the wet-lab section



Presence vs Absence of LacI natural operator O2

  • We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the expression level from BBa_K079032 and BBa_K201001


2547GFP open tag.png
2547GFPO2 open tag.png



Results can be found in the wet-lab section



Interaction of LacI repressor with its natural operator O2

  • We studied interactions between LacI repressor and its natural operator O2, using different IPTG concentration in order to evaluate LacI repression strengthanalyzing this two genetic circuits:
LACi GFP2 tag.png



Results can be found in the wet-lab section