|
|
| (15 intermediate revisions not shown) |
| Line 1: |
Line 1: |
| - | {{EPF-Lausanne09}}
| |
| - | <div CLASS="epfltrick">__TOC__
| |
| - | </div><div CLASS="epfl09">
| |
| | | | |
| - |
| |
| - | =Cloning strategy=
| |
| - | ==July==
| |
| - |
| |
| - | ===06.07.09===
| |
| - | Four forward primers were designed to amplify:
| |
| - | <br> 1.Promoter T7, RBS, CBP and LOVTAP:
| |
| - | :gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg
| |
| - | 2.RBS, CBP and LOVTAP:
| |
| - | :gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag
| |
| - | 3.CBP and LOVTAP:
| |
| - | :gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag
| |
| - | 4.LOVTAP:
| |
| - | :gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac
| |
| - | One reverse primer were designed:
| |
| - | :gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc
| |
| - |
| |
| - |
| |
| - | The '''recipient IGEM part''' have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 13D in the received kit plate 1
| |
| - |
| |
| - | ===07.07.09===
| |
| - | To design plasmids : software Vector NTI
| |
| - |
| |
| - | ===08.07.09===
| |
| - | '''Inducible LOVTAP biobrick strategy'''
| |
| - | :*Problem to overcome:
| |
| - | :PstI sites in LOVTAP sequence.
| |
| - | :*Our goal:
| |
| - | :Biobrick consisted of LacI promoter-RBS-LOVTAP-Term (in this order).
| |
| - | :*Material:
| |
| - | :Biobrick of LacI promoter, RBS, LOVTAP, Term seperatedly ( LOVTAP obtained from previous section and the rest from iGEM Spring 2009 distribution Kit plate).
| |
| - | :*Strategy:
| |
| - | :LacI promoter-RBS ligation with iGEM protocol (LacI promoter digested with ES, RBS digested with XP, plasmid containing an other antibiotic digested with EP).
| |
| - | :LOVTAP is digested with ES and inserted into Term plasmid (which was digested with EX previously).
| |
| - | :Finally, LacI promoter-RBS digested with ES to be inserted into LOVTAP-Term plasmid, digested with EX.
| |
| - |
| |
| - | ===09.07.09===
| |
| - | '''Partial digestion strategy'''
| |
| - | :* Problem to overcome:
| |
| - | :PstI sites in LOPTAP sequence -> Impossible to use iGEM protocol for ligation (where downstream part must be cut with XP)
| |
| - | :* Strategy:
| |
| - | :Cut with X first.
| |
| - | :Divide into several solutions and add different concentrations of P (by dilution series)
| |
| - | :*Results:
| |
| - | :Most concentrated tube: all P sites are recognized and cut, so the number of parts diminishes with the concentration value.
| |
| - | :Run an agarose gel and extract the right piece (recognized by the segment's length).
| |
| - |
| |
| - | ===10.07.09===
| |
| - |
| |
| - | ===13.07.09===
| |
| - | Restriction enzymes on [http://www.neb.com/nebecomm/products/category1.asp?#2 Biolabs website]
| |
| - | and [http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/cleavage_olignucleotides.asp clevage oligonucleotides]
| |
| - |
| |
| - | '''TRP promoter biobrick strategy'''
| |
| - | :* Problem to overcome:
| |
| - | : SpeI sites on Trp promoter sequence and it's an upstream part which has to be cut with ES.
| |
| - | :* Strategy:
| |
| - | : PCR: Forward primer having E and X sites and Reverse primer NheI.
| |
| - | : Digest Trp promoter with E and NheI.
| |
| - | : Digest plasmid with E and X.
| |
| - | : Ligation -> E site is recreated; X and NheI have compatible ends so ligation is possible and the site is destroyed (mixted site).
| |
| - |
| |
| - | ===14.07.09===
| |
| - | Primers designed for LOVTAP read-out and RBphP project:
| |
| - |
| |
| - | 1.Forward primer Trp promoter:
| |
| - | :gtttcttc gaattcgcggccgcttctagagtggcaaatattctgaaatgagctgttgacaattaatcatcgaactagttaactagtacgc
| |
| - |
| |
| - | 2.Reverse primer Trp promoter:
| |
| - | :ctagctagctaggtcgataccctttttacgtgaacttgcgtactagttaactagttcgatgattaattgtca
| |
| - |
| |
| - | 3.1st Forward primer Inverter TetR:
| |
| - | :aatcatcgaactagttaactagtacgcaagttcacgtaaaaagggtatcgacaaagaggagaaatactagatgtcc
| |
| - |
| |
| - | 4.2nd Forward primer Inverter TetR:
| |
| - | :gtttcttcgaattcgcggccgcttctagagtggcaaatattctgaaatgagctgttgacaattaatcatcgaactagttaactagta
| |
| - |
| |
| - | 5.Reverse Primer Inverter TetR:
| |
| - | :ctagctagctag tttctcctctttctctagtagtgc
| |
| - |
| |
| - |
| |
| - | 6.Forward primer ppsR1 R.Palustris CGA009:
| |
| - | :gtttcttcgaattcgcggccgcttctagatgctggaggatatttgccctggtg
| |
| - |
| |
| - | 7.Reverse primer ppsR1 R.Palustris CGA009:
| |
| - | :gtttcttcctgcagcggccgctactagtattactcatcggctccgtctccttc
| |
| - |
| |
| - | 8.Forward primer ppsR2 R.Palustris CGA009:
| |
| - | :gtttcttcgaattcgcggccgcttctagatggcgtcaaagtccgttcatgcc
| |
| - |
| |
| - | 9.Reverse primer ppsR2 R.Palustris CGA009:
| |
| - | :gtttcttcctgcagcggccgctactagtatcaatcctctgcgtcgtctgagg
| |
| - |
| |
| - |
| |
| - | 10.Forward primer BrBphP Bradyrhizobium ORS278:
| |
| - | :gtttcttcgaattcgcggccgcttctagatgcccgttccgctgacgac
| |
| - |
| |
| - | 11.Reverse primer BrBphP Bradyrhizobium ORS278:
| |
| - | :gtttcttcctgcagcggccgctactagtatcactcctcgctctgcgagc
| |
| - |
| |
| - | 12.Forward primer ppsR1 Bradyrhizobium ORS278:
| |
| - | :gtttcttcgaattcgcggccgcttctagatgagggcgttcagagctcc
| |
| - |
| |
| - | 13.Reverse primer ppsR1 Bradyrhizobium ORS278:
| |
| - | :gtttcttcctgcagcggccgctactagtactattccaactgactgtcttcttcgc
| |
| - |
| |
| - | 14.Forward primer ppsR2 Bradyrhizobium ORS278:
| |
| - | :gtttcttcgaattcgcggccgcttctagatggccgagtttcacggtccac
| |
| - |
| |
| - | 15.Reverse primer ppsR2 Bradyrhizobium ORS278:
| |
| - | :gtttcttcctgcagcggccgctactagtactagctccccttttcggtttcctc
| |
| - |
| |
| - | ===15.07.09===
| |
| - |
| |
| - | ===16.07.09===
| |
| - |
| |
| - | ===17.07.09===
| |
| - |
| |
| - | ==August==
| |
| - |
| |
| - | </div><div CLASS="epfl09bouchon"></div>
| |
"
