"
Team:KULeuven/Primers
From 2009.igem.org
(Difference between revisions)
| Line 11: | Line 11: | ||
! class='top' | Comments | ! class='top' | Comments | ||
|- | |- | ||
| - | |2171||BLR promoter fw||CATCAT GAATTCGCGGCCGCTTCTAGAG TTT GAC AGG TTC GTC GTC||46||52.4||it has a catcat | + | |2171||BLR promoter fw||CATCAT GAATTCGCGGCCGCTTCTAGAG TTT GAC AGG TTC GTC GTC||46||52.4||it has a catcat and prefix (not in Tm included) |
|- | |- | ||
|2172||BLR promoter rv||CTGCAGCGGCCGCTACTAGTA CCT CTG TTA AAA ATG TTA ATC AAT GTT AAG||51||52.1||it has a suffix (not in Tm included) | |2172||BLR promoter rv||CTGCAGCGGCCGCTACTAGTA CCT CTG TTA AAA ATG TTA ATC AAT GTT AAG||51||52.1||it has a suffix (not in Tm included) | ||
|} | |} | ||
Revision as of 11:34, 31 July 2009
| Number | Name | Sequence | Length | Tm (°C) | Comments |
|---|---|---|---|---|---|
| 2171 | BLR promoter fw | CATCAT GAATTCGCGGCCGCTTCTAGAG TTT GAC AGG TTC GTC GTC | 46 | 52.4 | it has a catcat and prefix (not in Tm included) |
| 2172 | BLR promoter rv | CTGCAGCGGCCGCTACTAGTA CCT CTG TTA AAA ATG TTA ATC AAT GTT AAG | 51 | 52.1 | it has a suffix (not in Tm included) |
