Team:KULeuven/Wetlab/Vanillin Production

From 2009.igem.org

(Difference between revisions)
(Steps)
Line 3: Line 3:
{{Team:KULeuven/Common2/EndHeader}}
{{Team:KULeuven/Common2/EndHeader}}
__NOTOC__
__NOTOC__
-
=VANILLIN SYNTHESIS=
+
=Vanillin Production: Planning=
==Goal==
==Goal==

Revision as of 07:33, 12 October 2009

Vanillin Production: Planning

Goal

Making vanillin from tyrosine in a five-step pathway.

Making vanillin from tyrosine



Required

Biobricks:

  • SAM8: : coding sequence without RBS
  • SAM5: : RBS site + PstI restriction site removed
  • COMT: : coding sequence without RBS
    • LVA tag (AANDENYALAA) attached to COMT (nucleotide code: gctgcaaacgacgaaaactacgctttagtagct)
  • FCS:  : RBS + fcs in pSB1A2
  • ECH:  : RBS + ech in pSB1A2

Where from

  • SAM8, SAM5, COMT, FCS, ECH will be sent to us from the French Lab from the university Edinburgh

Steps

  • We will be working in three different stages
  1. Testing the transformation of tyrosine to ferulic acid. The enzymes are put under a constitutive promoter and transcribed. Ferulic acid concentrations are then measured with GC
  2. Testing the transformation of ferulic acid to vanillin. The enzymes are put under a constitutive promoter and transcribed. Ferulic acid concentrations are then measured with GC
  3. If both are tested and ok, they can be combined into one plasmid and again tested.
  4. Then, the locks need to be added.
  • Testing the enzymes by detecting the endproducts through gaschromatography.
  • One problem might be that the tyrosine of E. coli is depleted too fast