Team:MoWestern Davidson/parts

From 2009.igem.org

(Difference between revisions)
(Parts)
(Characterization of Pre-Existing Part in the Registry)
 
Line 76: Line 76:
==Characterization of Pre-Existing Part in the Registry==
==Characterization of Pre-Existing Part in the Registry==
-
'''pLacIQ1 Promoter''' [http://partsregistry.org/Part:BBa_K091112 BBa_K091112]
+
'''pLacIQ1 Promoter''' [http://partsregistry.org/Part:BBa_K091112 BBa_K091112] is an exceptionally strong promoter that has been documented.
-
The MWSU/Davidson iGEM 2009 team sequenced this promoter after obtaining gel verification results indicating that the part was too large. The team found that there was a 35 bp insertion within this promoter directly before the suffix. We believe that the E.coli cells may have mutated the promoter to silence its activity in an effort to conserve energy and select against an attribute that did not necessarily improve its fitness. Here is the 35 bp insertion:
+
The MWSU/Davidson iGEM 2009 team sequenced this promoter isolated from cells that had grown for several weeks when we obtained gel results indicating that the part might be too large. The team found that there was a 35 bp spontaneous insertion within this promoter directly before the suffix. We believe that the ''E.coli'' cells may have mutated the promoter to silence its activity in an effort to conserve energy and select against an attribute that did not necessarily improve its fitness. Here is the 35 bp insertion:
   TGTGTGGAATTGTGAGCGGATAACAATTTCACACA
   TGTGTGGAATTGTGAGCGGATAACAATTTCACACA
-
Our experience with this part and our conclusion concerning the mutation have been added to the promoter description in the Parts Registry so that other teams will be aware of this unique possibility. It is encouraged to sequence parts using this promoter during the construction process.
+
Our experience with this part and our conclusion concerning the mutation have been added to the promoter description in the Parts Registry so that other teams will be aware of this unique possibility. Users are encouraged to sequence parts using this promoter during the construction process. We have some versions that are wild-type and others that are mutated. If you build a new version yourself, do not maintain the plasmid in cultures for very long. Freeze down a stock as soon as possible to avoid the introduction of a silencing mutation in the promoter.  
{{Template:MoWestern_Davidson2009_end}}
{{Template:MoWestern_Davidson2009_end}}

Latest revision as of 20:11, 21 October 2009

Parts

Green Part has been cloned and sequence verified; Red Part is under construction

tRNAs tRNA part number 5mer Reporter Genes 5mer Reporter part number
CCCUC tRNA Suppressor BBa_K199000 RFP with CCCUC Addition
Tet with CCCUC Addition
BBa_K199011
BBa_K199012
CUAGU tRNA Suppressor BBa_K199001 RFP with CUAGU Addition
Tet with CUAGU Addition
BBa_K199003
BBa_K199004
CCACU tRNA Suppressor BBa_K199002 RFP with CCACU Addition
Tet with CCACU Addition
BBa_K199005
BBa_K199006
CCAUC tRNA Suppressor (9-bp Anticodon) BBa_K199007 RFP with CCAUC Addition
Tet with CCAUC Addition
BBa_K199009
BBa_K199010
CCAUC tRNA Suppressor (10-bp Anticodon) BBa_K199008 RFP with CCAUC Addition
Tet with CCAUC Addition
BBa_K199009
BBa_K199010
CGGUC tRNA Suppressor BBa_K199028 RFP with CGGUC Addition
Tet with CGGUC Addition
BBa_K199034
BBa_K199035
CUACC tRNA Suppressor BBa_K199045 RFP with CUACC Addition BBa_K199085
AGGAC tRNA Suppressor BBa_K199014 RFP with AGGAC Addition BBa_K199084
CCAAU tRNA Suppressor BBa_K199047 RFP with CCAAU Addition BBa_K199088
CUAGC tRNA Suppressor BBa_K199016 CAT with CUAGC Addition
RFP with CUAGC Addition
BBa_K199033
BBa_K199087
CUACU tRNA Suppressor BBa_K199046 RFP with CUACU Addition BBa_K199086
CCACC tRNA Suppressor BBa_K199048 RFP with CCACC Addition BBa_K199089


Intermediate and Control Parts Part Number
RBS RFP with AGGAC Addition BBa_K199074
RBS RFP with CUACC Addition BBa_K199075
RBS RFP with CUACU Addition BBa_K199076
RBS RFP with CUAGC Addition BBa_K199077
RBS RFP with CCAAU Addition BBa_K199078
RBS RFP with CCACC Addition BBa_K199079
pBad AGGAC tRNA BBa_K199082
pBad CUACC tRNA
pLac CUACC tRNA
BBa_K199072
BBa_K199091
pBad CUACU tRNA BBa_K199073
pBad CUAGC tRNA BBa_K199083
pBad CCAAU tRNA BBa_K199080
pBad CCACC tRNA BBa_K199081
pLacIQ1 CAT Cassette BBa_K199013
pLac CAT Cassette BBa_K199049
pLac GFP Cassette BBa_K199055


Characterization of Pre-Existing Part in the Registry

pLacIQ1 Promoter BBa_K091112 is an exceptionally strong promoter that has been documented.

The MWSU/Davidson iGEM 2009 team sequenced this promoter isolated from cells that had grown for several weeks when we obtained gel results indicating that the part might be too large. The team found that there was a 35 bp spontaneous insertion within this promoter directly before the suffix. We believe that the E.coli cells may have mutated the promoter to silence its activity in an effort to conserve energy and select against an attribute that did not necessarily improve its fitness. Here is the 35 bp insertion:

 TGTGTGGAATTGTGAGCGGATAACAATTTCACACA

Our experience with this part and our conclusion concerning the mutation have been added to the promoter description in the Parts Registry so that other teams will be aware of this unique possibility. Users are encouraged to sequence parts using this promoter during the construction process. We have some versions that are wild-type and others that are mutated. If you build a new version yourself, do not maintain the plasmid in cultures for very long. Freeze down a stock as soon as possible to avoid the introduction of a silencing mutation in the promoter.