Team:MoWestern Davidson/parts
From 2009.igem.org
Parts
Green Part has been cloned Red Part is under construction
tRNAs | tRNA part number | 5mer Reporter Genes | 5mer Reporter part number |
---|---|---|---|
CCCUC tRNA Suppressor | BBa_K199000 | RFP with CCCUC Addition Tet with CCCUC Addition | BBa_K199011 BBa_K199012 |
CUAGU tRNA Suppressor | BBa_K199001 | RFP with CUAGU Addition Tet with CUAGU Addition | BBa_K199003 BBa_K199004 |
CCACU tRNA Suppressor | BBa_K199002 | RFP with CCACU Addition Tet with CCACU Addition | BBa_K199005 BBa_K199006 |
CCAUC tRNA Suppressor (9-bp Anticodon) | BBa_K199007 | RFP with CCAUC Addition Tet with CCAUC Addition | BBa_K199009 BBa_K199010 |
CCAUC tRNA Suppressor (10-bp Anticodon) | BBa_K199008 | RFP with CCAUC Addition Tet with CCAUC Addition | BBa_K199009 BBa_K199010 |
CGGUC tRNA Suppressor | BBa_K199028 | RFP with CGGUC Addition Tet with CGGUC Addition | BBa_K199034 BBa_K199035 |
CUACC tRNA Suppressor | BBa_K199045 | RFP with CUACC Addition | BBa_K199085 |
AGGAC tRNA Suppressor | BBa_K199014 | RFP with AGGAC Addition | BBa_K199084 |
CCAAU tRNA Suppressor | BBa_K199047 | RFP with CCAAU Addition | BBa_K199088 |
CUAGC tRNA Suppressor | BBa_K199016 | CAT with CUAGC Addition RFP with CUAGC Addition | BBa_K199033 BBa_K199087 |
CUACU tRNA Suppressor | BBa_K199046 | RFP with CUACU Addition | BBa_K199086 |
CCACC tRNA Suppressor | BBa_K199048 | RFP with CCACC Addition | BBa_K199089 |
Intermediate and Control Parts | Part Number |
---|---|
RBS RFP with AGGAC Addition | BBa_K199074 |
RBS RFP with CUACC Addition | BBa_K199075 |
RBS RFP with CUACU Addition | BBa_K199076 |
RBS RFP with CUAGC Addition | BBa_K199077 |
RBS RFP with CCAAU Addition | BBa_K199078 |
RBS RFP with CCACC Addition | BBa_K199079 |
pBad AGGAC tRNA | BBa_K199082 |
pBad CUACC tRNA pLac CUACC tRNA | BBa_K199072 BBa_K199091 |
pBad CUACU tRNA | BBa_K199073 |
pBad CUAGC tRNA | BBa_K199083 |
pBad CCAAU tRNA | BBa_K199080 |
pBad CCACC tRNA | BBa_K199081 |
pLacIQ1 CAT Cassette | BBa_K199013 |
pLac CAT Cassette | BBa_K199049 |
pLac GFP Cassette | BBa_K199055 |
Characterization of Pre-Existing Part in the Registry
pLacIQ1 Promoter BBa_K091112
EDIT THIS The MWSU/Davidson iGEM 2009 team sequenced this promoter after obtaining gel verification results indicating that the part was too large. The team found that there was a 35 bp insertion within this promoter directly before the suffix. We believe that the E.coli cells may have mutated the promoter to silence its activity in an effort to conserve energy and select against an attribute that did not necessarily improve its fitness. Here is the 35 bp insertion:
TGTGTGGAATTGTGAGCGGATAACAATTTCACACA