Team:Valencia/Notebook/September

From 2009.igem.org

(Difference between revisions)
Line 83: Line 83:
| <Font Color="#c0c0c0">27</Font> || <Font Color="#c0c0c0">28</Font> || <Font Color="#c0c0c0">29</Font> || &nbsp;<Font Color="#c0c0c0">30</Font> || <Font Color="#c0c0c0">31</Font> || &nbsp;1 || &nbsp;2   
| <Font Color="#c0c0c0">27</Font> || <Font Color="#c0c0c0">28</Font> || <Font Color="#c0c0c0">29</Font> || &nbsp;<Font Color="#c0c0c0">30</Font> || <Font Color="#c0c0c0">31</Font> || &nbsp;1 || &nbsp;2   
|-
|-
-
| &nbsp;3 || &nbsp; 4 || &nbsp; 5 || &nbsp;6 || &nbsp;7 || &nbsp;8 || &nbsp;9  
+
| &nbsp;[[Team:Valencia/Notebook/August#August 3rd|3]] || &nbsp;[[Team:Valencia/Notebook/August#August 4th|4]] || &nbsp;[[Team:Valencia/Notebook/August#August 5th|5]] || &nbsp;[[Team:Valencia/Notebook/August#August 6th|6]] || &nbsp;[[Team:Valencia/Notebook/August#August 7th|7]] || &nbsp;8 || &nbsp;9  
|-
|-
-
| 10 || 11 || 12 || 13 || 14 || 15 || 16
+
| [[Team:Valencia/Notebook/August#August 10th|10]] || [[Team:Valencia/Notebook/August#August 11th|11]] || [[Team:Valencia/Notebook/August#August 12th|12]] || [[Team:Valencia/Notebook/August#August 13th|13]] || [[Team:Valencia/Notebook/August#August 14th|14]] || 15 || 16
|-
|-
-
|17 || 18 || 19 || 20 || 21 || 22 || 23
+
|[[Team:Valencia/Notebook/August#August 17th|17]] || [[Team:Valencia/Notebook/August#August 18th|18]] || [[Team:Valencia/Notebook/August#August 19th|19]] || [[Team:Valencia/Notebook/August#August 20th|20]] || [[Team:Valencia/Notebook/August#August 21st|21]] || 22 || 23
|-
|-
-
| 24 || 25 || 26 || 27 || 28 || 29 || 30
+
| [[Team:Valencia/Notebook/August#August 24th|24]] || [[Team:Valencia/Notebook/August#August 25th|25]] || [[Team:Valencia/Notebook/August#August 26th|26]] || 27 || 28 || 29 || 30
|-
|-
|31 ||<Font Color="#c0c0c0">1</Font> || <Font Color="#c0c0c0">2</Font> || <Font Color="#c0c0c0">3</Font> || <Font Color="#c0c0c0">4</Font> || <Font Color="#c0c0c0">5</Font> || <Font Color="#c0c0c0">6</Font>
|31 ||<Font Color="#c0c0c0">1</Font> || <Font Color="#c0c0c0">2</Font> || <Font Color="#c0c0c0">3</Font> || <Font Color="#c0c0c0">4</Font> || <Font Color="#c0c0c0">5</Font> || <Font Color="#c0c0c0">6</Font>

Revision as of 16:30, 19 September 2009


Home Team Project Human Practices Notebook News

April
Mo Tu We Th Fr Sa Su
30 31  1  2  3  4  5
 6  7  8  9 10 11 12
13 14 15 16 17 18 19
20 21 22 23 24 25 26
27 28 29 30  1  2  3
May
Mo Tu We Th Fr Sa Su
27 28 29 30  1  2  3
 4  5  6  7  8  9 10
11 12 13 14 15 16 17
18 19 20 21 22 23 24
25 26 27 28 29 30 31
June
Mo Tu We Th Fr Sa Su
 1  2  3  4  5  6  7
 8  9 10 11 12 13 14
15 16 17 18 19 20 21
22 23 24 25 26 27 28
29 30  1   2  3  4  5
July
Mo Tu We Th Fr Sa Su
29 30  1  2  3  4  5
 6 7  8  9 10 11 12
13 14 15 16 17 18 19
20 21 22 23 24 25 26
27 28 29 30 31   1  2
August
Mo Tu We Th Fr Sa Su
27 28 29  30 31  1  2
 3  4  5  6  7  8  9
10 11 12 13 14 15 16
17 18 19 20 21 22 23
24 25 26 27 28 29 30
31 1 2 3 4 5 6
September
Mo Tu We Th Fr Sa Su
31  1  2  3  4  5  6
 7  8  9 10 11 12 13
14 15 16 17 18 19 20
21 22 23 24 25 26 27
28 29 30  1 2 3 4
October
Mo Tu We Th Fr Sa Su
28 29 30   1  2  3  4
 5  6  7  8  9 10 11
12 13 14 15 16 17 18
19 20 21 22 23 24 25
26 27 28 29 30 31  1
November
Mo Tu We Th Fr Sa Su
26 27 28  29 30 31  1
 2  3  4  5  6  7  8
 9 10 11 12 13 14 15
16 17 18 19 20 21 22
23 24 25 26 27 28 29
30  1  2  3  4  5  6


September 4th

We have tried our protocol using the fluoriscense microscope.We obtained some interesting results, but finally they were only artifacts. It seems like the the microscope is a good option to "see" our yeasts.


September 11th

Today we have had an iGEM meeting.


We have repited the PCR with new primers:


Forward: 5'gaattcgcggccgcttctagatgaccagcgaccaatactc 3’

Reverse: 5’tactagtagcggccgctgcagttaggggacagctccaccg 3’


Programme


After 2 minutes at 94 ºC as a previous step. Every of our 30 cycles has these three steps:

- 45s at 94ºC

- 1min at 60º

- 1min at 72ºC


1 = wt (1 microlitre)

2 = wt (2 microlitres)

3 = Cch1 (1 microlitre)

4 = Mid1 (1 microlitre)

5 = Negative Control

6 = Possitive Control

(We used the same MWM)


We haven't obtained any result.


14th September

Trying another PCR...


We have variated the programme another time T-T


Programme


After 3 minutes at 94 ºC as a previous step. Every of our 30 cycles has these trhee steps:

- 30s at 94ºC

- 1min at 55ºC

- 1min at 72ºC

We have added a final step of 7 minutes at 72ºC.


1 = wt (1 microlitre)

2 = wt (2 microlitres)

3 = Cch1 (1 microlitre)

4 = Mid1 (1 microlitre)

5 = Negative Control

6 = Possitive Control

(We used the same MWM)


Wiiiiiiiiiiiiiiiii!!!!!!!!! We had amplification!!!!! We will use wt 1 microlitre of PCR amplification product (career 1) to build our first BioBrick in the next days.


For other side, we have prepared Arinyo's protocol only with our wt strain to characterize the behaviour of our yeast with different amounts of KOH as an input. We didn't obtain any result.


15th September

We have started with bacteria transformation. To build our first BioBrick, we selected the pSB1A3 plasmid located at 1K hole of plate 1 (distributed for the iGEM at spring 2009). We have used a E.coli strain ultracompetent called XL1-Gold. Transformation protocol comes with the strain.

After the steps, we left our strain in incubation, to make them add the plasmid.


For other side, we have prepared Arinyo's protocol only with our wt strain to characterize the behaviour of our yeast with different amounts of KOH as an input.


Back to August    |    September    |    Go to October