Team:Todai-Tokyo/Protocols/Notebook Sample

From 2009.igem.org

(Difference between revisions)
Line 23: Line 23:
using [[Team:Todai-Tokyo/Protocols/PCR/programs|PCR program 1]] and [[Team:Todai-Tokyo/Protocols/PCR/Enzymes|Ex-taq]].
using [[Team:Todai-Tokyo/Protocols/PCR/programs|PCR program 1]] and [[Team:Todai-Tokyo/Protocols/PCR/Enzymes|Ex-taq]].
-
This PCR reaction attaches a Biobrick prefix and suffix to the gene.
+
Note: This PCR reaction attaches a Biobrick prefix and suffix to the gene.
<h2> Sequencing </h2>
<h2> Sequencing </h2>
 +
The following were [[Team:Todai-Tokyo/Protocols/sequencing|sequenced]] using the labeled primers:
 +
 +
* pAraC Sample 1([[Team:Todai-Tokyo/Protocols/Miniprep|miniprep]]ped on 9/23)
 +
** 1) '''Biobrick vector fwd''': atatgagagcgcgcgcagagagagatg
 +
** 2) '''Biobrick vector rev''': tttttaaaagggggtgtgtgtgtaaagttt
 +
* pAraC Sample 2 ([[Team:Todai-Tokyo/Protocols/Miniprep|miniprep]]ped on 9/23)
 +
** 3) '''Biobrick vector fwd''': atatgagagcgcgcgcagagagagatg
 +
 +
'''Results''':<BR>
 +
1) Sequence read failed
 +
<BR>2) Single-base mutation found in sequence that creates stop codon; re-do the ligation
 +
<BR>3) Desired Sequence read
<h2> Transformation </h2>
<h2> Transformation </h2>

Revision as of 03:00, 20 October 2009

UT.png
Home The Team The Project Parts Submitted to the Registry Modeling Notebook Protocols Ethics



Contents

Miniprep

The following were miniprepped:

  • pLacI-RFP-dterm (From Ligation on 9/4; 4 colonies)
  • RFP ([http://partsregistry.org/wiki/index.php?title=Part:BBa_J04450 BBa_J04450] from [http://partsregistry.org/assembly/libraries.cgi?id=19 2009 Spring Distribution]; 6 colonies)

PCR

The yqiT gene was PCR amplified from pLacI-yqiT-dterm (miniprepped on 9/7) using the following primers:

yqiT fwd: agcccgtgtagtactgtagagtt
yqiT rev: agggatgtttgccagtcgtaattag

using PCR program 1 and Ex-taq.

Note: This PCR reaction attaches a Biobrick prefix and suffix to the gene.


Sequencing

The following were sequenced using the labeled primers:

  • pAraC Sample 1(miniprepped on 9/23)
    • 1) Biobrick vector fwd: atatgagagcgcgcgcagagagagatg
    • 2) Biobrick vector rev: tttttaaaagggggtgtgtgtgtaaagttt
  • pAraC Sample 2 (miniprepped on 9/23)
    • 3) Biobrick vector fwd: atatgagagcgcgcgcagagagagatg

Results:
1) Sequence read failed
2) Single-base mutation found in sequence that creates stop codon; re-do the ligation
3) Desired Sequence read

Transformation

Ligation

Infusion

Gel Purification

RE Digest

Colony PCR

Retrieved from "http://2009.igem.org/Team:Todai-Tokyo/Protocols/Notebook_Sample"