Team:Waterloo/Notebook/strainlist

From 2009.igem.org

(Difference between revisions)
(Strain list)
 
(8 intermediate revisions not shown)
Line 1: Line 1:
 +
{{Team:Waterloo/NavBar}}
 +
==Strain list==
==Strain list==
-
{| width="100%" border="1" cellpadding="2"
+
{| width="40%" border="1" cellpadding="2"
-
! Description !! Oligo Name !! Sequence !! Length!! column !! column !! column !! column !! column !
+
!Location!!Strain #!!Name!!Chassis/Strain!!Plasmid Backbone!!Registry Part!!Antibiotic Resistance!!Description!!Reference Date
|-
|-
-
|amplifies first half of E. coli alpha gal gene adds SalI REN site (fwd) || HI-SalI-F ||
+
|iGEM strain box 1
 +
|1
 +
|rTT + PocI
 +
|DH5α
 +
|pMA (GeneArt)
 +
|[http://partsregistry.org/Part:BBa_K093003 BBa_K093003]
 +
|Amp100
 +
|Synthesized. Contains BioBrick prefix and suffix. Reverse orientation transcriptional terminator R0015 with λ Pr promotor.
 +
|2008:09:09
 +
 
|-
|-
-
|amplifies first half of alpha gal gene adds BamHI REN site (rev) || HI-BamHI-attP-R || ATGGGATCCCCCCCAACTGAGAGAACTCAAAGGTTACCCCAGTTGGGGGTAACGCAGCGTAGCTGG || 66
+
|iGEM strain box 1
 +
|2
 +
|rPlacTT
 +
|DH5α
 +
|pMA (GeneArt)
 +
|[http://partsregistry.org/Part:BBa_K093004 BBa_K093004]
 +
|Amp100
 +
|Synthesized. Contains BioBrick prefix and suffix. Reverse [http://partsregistry.org/Part:BBa_R0011 BBa_R0011] and transcriptional terminator [http://partsregistry.org/Part:BBa_B0015 BBa_B0015].
 +
|2008:09:09
 +
 
|-
|-
-
|amplifies second half of alpha gal gene, adds KpnI site (fwd) || H2-KpnI-attP-F || CATGGTACCCCCCCAACTGAGAGAACTCAAAGGTTACCCCAGTTGGGGGCGTTTTACCTGGAGCTGG || 67
+
|iGEM strain box 1
 +
|3
 +
|PmeI
 +
|DH5α
 +
|pMA (GeneArt)
 +
|[http://partsregistry.org/Part:BBa_K093002 BBa_K093002]
 +
|Amp100
 +
|Synthesized ORF. Contains BioBrick prefix and suffix.
 +
|2008:09:09
 +
 
|-
|-
-
|amplifies second half of alpha gal gene, adds XbaI site (rev) || H2-XbaI-R || ATGTCTAGAGGTCAGCAGCGTCTGT || 25
+
|iGEM strain box 1
 +
|4
 +
|rfp'-14
 +
|DH5α
 +
|pSB1A2
 +
|[http://partsregistry.org/Part:BBa_K093005 BBa_K093005]
 +
|Amp100
 +
|RFP ([http://partsregistry.org/Part:BBa_E1010 BBa_E1010]) with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]) colony 14.
 +
|2008:09:09
 +
 
|-
|-
-
|Amplifes any biobrick, adds EcoRV end for ligation into EcoRV blunt ends (fwd) || Prefix-EcoRV-F || ATCGAATTCGCGGCCGCTTCTAG || 23
+
|iGEM strain box 1
 +
|5
 +
|rfp''-2
 +
|DH5α
 +
|pSB1AK3
 +
|
 +
|Amp100, Kan25
 +
|RFP ([http://partsregistry.org/Part:BBa_E1010 BBa_E1010]) with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]) and transcriptional terminator ([http://partsregistry.org/Part:BBa_B0015 BBa_B0015]) colony 2. Might need testing
 +
|2008:09:09
 +
 
|-
|-
-
|Amplifes any biobrick, adds EcoRV end for ligation into EcoRV blunt ends (rev) || Suffix-EcoRV-R || ATCCTGCAGCGGCCGCTACTAGTA || 24
+
|iGEM strain box 1
 +
|6
 +
|Pconst-rfp''-1
 +
|DH5α
 +
|pSB1A2
 +
|[http://partsregistry.org/Part:BBa_K093012 BBa_K093012]
 +
|Amp100
 +
|RFP ([http://partsregistry.org/Part:BBa_E1010 BBa_E1010]) with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]) and transcriptional terminator ([http://partsregistry.org/Part:BBa_B0015 BBa_B0015]) under a constitutive promoter ([http://partsregistry.org/Part:BBa_J23118 BBa_J23118]). Might need testing.
 +
|2008:09:09
 +
 
|-
|-
-
|B0034 RBS primer, use with VF2 (fwd) || Prefix-RBS || GGCCGCTTCTAGAGAAAGAGG || 21
+
|iGEM strain box 1
 +
|7
 +
|pRecA-3
 +
|DH5α
 +
|psb2k3
 +
|[http://partsregistry.org/Part:BBa_K093000 BBa_K093000]
 +
|Kan25
 +
|Engineered RecA promoter with lexA consensus sequence.
 +
|2008:10:17
 +
 
|-
|-
-
|B0034 RBS primer, use with VR (rev)|| Suffix-RBS || TTTCTCCTCTTTCTCTAGATGCGG || 24
+
|iGEM strain box 1
 +
|8
 +
|Pconst-rfp' 1
 +
|DH5α
 +
|psb1a2
 +
|
 +
|Amp100
 +
|RFP ([http://partsregistry.org/Part:BBa_E1010 BBa_E1010]) with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]) under a constitutive promoter ([http://partsregistry.org/Part:BBa_J23118 BBa_J23118])
 +
|2008:10:17
 +
 
|-
|-
-
|ordered to add Plac and RBS to the cI ORF (project 2008)  || Plac-RBS-F || GAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGGATAACAATTGACATTGTGAGCGGATAA CAAGATACTGAGCACATACTAGAGAAAGAGGAGAAATACTAG || 103
+
|iGEM strain box 1
 +
|9
 +
|c0051'
 +
|DH5α
 +
|psb1a2
 +
|[http://partsregistry.org/Part:BBa_K093006 BBa_K093006]
 +
|Amp100
 +
|[http://partsregistry.org/Part:BBa_C0051 BBa_C0051] Repressor for Lambda Pr promoter with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]). Never got sequencing results of prefix. Rest was good
 +
|2008:10:17
 +
 
|-
|-
-
|amplifies c31 int, adds RBS, Prefix, changes start codon to ATG, changes G to A maintaining glutamic acid codon and eliminating EcoRI site (fwd) || Int-BBa-F || GAATTCGCGGCCGCTTCTAGAGAAAGAGGAGAAATACTAGATGGACACGTACGCGGGTGCTT ACGACCGTCAGTCGCGCGAGCGCGAAAATTCG || 94
+
|iGEM strain box 1
 +
|10
 +
|PmeI - 14
 +
|DH5α
 +
|psb2k3
 +
|[http://partsregistry.org/Part:BBa_K093002 BBa_K093002]
 +
|Kan25
 +
|PmeI cloned into BioBrick vector
 +
|2008:10:17
 +
 
|-
|-
-
|amplifies c31 int, adds suffix, changes stop codon to double TAA (rev) || Int-DSC-R || CTGCAGCGGCCGCTACTAGTATTATTACGCCGCTACGTCTTCCGTG || 46
+
|iGEM strain box 1
 +
|11
 +
|PrecA RFP'
 +
|DH5α
 +
|pSB2K3
 +
|[http://partsregistry.org/Part:BBa_K093009 BBa_K093009]
 +
|Kan25
 +
|RFP ([http://partsregistry.org/Part:BBa_E1010 BBa_E1010]) with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]) under the control of [http://partsregistry.org/Part:BBa_K093000 BBa_K093000] promoter
 +
|2008:10:17
 +
 
|-
|-
-
|amplifies T7 Gene 6 exonuclease, adds ATG start codon, adds BBa prefix (fwd2) || T7gene6-F2 || GAATTCGCGGCCGCTTCTAGATGGCACTTCTTGACCTTAAAC || 42
+
|iGEM strain box 1
 +
|12
 +
|PmeI'
 +
|DH5α
 +
|pSB1A2
 +
|[http://partsregistry.org/Part:BBa_K093013 BBa_K093013]
 +
|Amp100
 +
|PmeI ([http://partsregistry.org/Part:BBa_K093002 BBa_K093002]) with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034])
 +
|2008:11:04
 +
 
|-
|-
-
|does not add standard start codon (fwd) || T7gene6-F || CAATGGAATTCGCGGCCGCTTCTAGATGGCACTTCTTGACCTTAAA || 46
+
|iGEM strain box 1
 +
|13
 +
|Pr RFP'
 +
|DH5α
 +
|psb1a2
 +
|[http://partsregistry.org/Part:BBa_K093010 BBa_K093010]
 +
|Amp100
 +
|RFP ([http://partsregistry.org/Part:BBa_E1010 BBa_E1010]) with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]) under Lamda Pr promoter (R0051)
 +
|2008:11:04
 +
 
|-
|-
-
|amplifies T7 Gene 6 exonuclease, adds double TAA stop codon, adds BBa suffix (rev2) || T7G6-R2 || CTGCAGCGGCCGCTACTAGTATTATTACGGTCTCCACAGGTAAATCTC || 48
+
|iGEM strain box 1
 +
|14
 +
|T7 gene 6  
 +
|DH5α
 +
|pSB1A2
 +
|[http://partsregistry.org/Part:BBa_K093001 BBa_K093001]
 +
|Amp100
 +
|good one, correct stop codon taataa
 +
|2009:02:13
 +
 
|-
|-
-
|does not add standard stop codon (rev) || T7gene6-R || CAATTTCTGCAGCGGCCGCTACTAGTACTACGGTCTCCACAGG || 43
+
|iGEM strain box 1
 +
|15
 +
|PkNG101
 +
|DH5α λ pir
 +
|
 +
|
 +
|Strep100
 +
| Only replicates in λ pir lysogen (r6k origin of replication) http://bccm.belspo.be/db/lmbp_plasmid_details.php?NM=pKNG101
 +
|2009:02:xx
 +
 
|-
|-
-
|amplifies T7 G6 makes product for cross over PCR with PmeI cross over PCR product || T7g6-RXO-RBS || CTAGTATTTCTCCTCTTTCTCTAGTATTATTACGGTCTCCACAGGTAAATCTC || 53
+
|iGEM strain box 1
 +
|16
 +
|H1-4 pJET
 +
|DH5α
 +
|pJET
 +
|
 +
|Amp100
 +
|''E. coli'' melA genomic DNA for homologous recombination (“left sequence”/H1) and attP site downstream
 +
|2009:03:18
 +
 
|-
|-
-
|Amplifies T7 gene 5 exonuclease, a 3'-5' exonuclease, adds BBa prefix (fwd) || T7gene5-F || CAATGGAATTCGCGGCCGCTTCTAGATGATCGTTTCTGACATCGAA || 46
+
|iGEM strain box 1
 +
|17
 +
|CI'' pJET
 +
|DH5α
 +
|pJET
 +
|
 +
|Amp100
 +
|CI repressor for lamda Pr promoter. [http://partsregistry.org/Part:BBa_C0051 BBa_C0051] with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]) and transcriptional terminator ([http://partsregistry.org/Part:BBa_B0015 BBa_B0015]) in pJET (made by crossover PCR)
 +
|2009:03:xx
 +
 
|-
|-
-
|Amplifies T7 gene 5 exonuclease, a 3'-5' exonuclease, adds BBa suffix (rev) || T7gene5-R || CAATTTCTGCAGCGGCCGCTACTAGTATCAGTGGCAAATCGCCCAATTAGG || 51
+
|iGEM strain box 1
 +
|18
 +
|pFB9002
 +
|DH5α lamda pir
 +
|pfb9001
 +
|
 +
|Strep 100
 +
|''E. coli'' melA genomic DNA for homologous recombination (“left sequence”/H1) and attP site downstream
 +
|2009:03:xx
 +
 
|-
|-
-
|amplifies phbA (fwd) || phbA-F || GAATTCGCGGCCGCTTCTAGATGAGCAATCCCTCGATCG || 39
+
|iGEM strain box 1
 +
|19
 +
|pJET H2
 +
|DH5α
 +
|pJET
 +
|
 +
|Amp100
 +
|''E. coli'' melA genomic DNA for homologous recombination (“right sequence”/H2) and attP site upstream
 +
|2009:04:09
 +
 
|-
|-
-
|amplifies phbA, non standard stop codon (rev) || phbB-R || CTGCAGCGGCCGCTACTAGTATTACAGGCGTTCCACGCACATGG || 44
+
|iGEM strain box 1
 +
|20
 +
|Pfb9003
 +
|DH5α lamda pir
 +
|pfb9001
 +
|
 +
|Strep100
 +
|''E. coli'' melA genomic DNA for homologous recombination (“right sequence”/H2) and attP site upstream
 +
|2009:04:23
 +
 
|-
|-
-
|amplifies phbB (fwd)|| phbB-F || GAATTCGCGGCCGCTTCTAGATGAGCAGGGTAGCACTGG || 39
+
|iGEM strain box 1
 +
|21
 +
|pfb9004
 +
|DH5α lamda pir
 +
|pfb9001
 +
|
 +
|Strep100
 +
|Contains two attP sites flanked by ''E. coli'' melA genomic DNA for homologous recombination (H1 and H2)
 +
|2009:04:23
 +
 
|-
|-
-
|amplifies phbB, non standard stop codon (rev)|| phbB-R || CTGCAGCGGCCGCTACTAGTA TCAGGCGAAGTACTGGCCGC || 41
+
|iGEM strain box 1
 +
|22
 +
|pJET rfp-1
 +
|DH5α
 +
|pJET
 +
|
 +
|Amp100
 +
|insert: Pconst ([http://partsregistry.org/Part:BBa_J23118 BBa_J23118]) rfp ([http://partsregistry.org/Part:BBa_E1010 BBa_E1010]) EcoRV fragment for propagating pJET
 +
|2009:04:24
 +
 
|-
|-
-
|amplifies phbC (fwd) || phbC-F || GAATTCGCGGCCGCTTCTAGATGACAGCAGAGAAGGCTGAGG || 42
+
|iGEM strain box 1
 +
|79
 +
|pJET rfp-2
 +
|DH5α
 +
|pJET
 +
|
 +
|Amp100
 +
|insert: Pconst rfp EcoRV fragment
 +
|2009:04:24
 +
 
|-
|-
-
|amplifies phbC, non standard stop codon (rev) || phbC-R || CTGCAGCGGCCGCTACTAGTATCAGGCGCGCACGCGCACGTAGG || 44
+
|iGEM strain box 1
 +
|81
 +
|pJET rfp-3
 +
|DH5α
 +
|pJET
 +
|
 +
|Amp100
 +
|insert: Pconst rfp EcoRV fragment
 +
|2009:04:24
 +
 
|-
|-
-
|Amplifes RFP with J23118 constitutive promoter (BBa_K093012) anneals to promoter sequence (fwd) || RFP-BamHI-F || CATGGATCCTTGACGGCTAGCTCAGTC || 27
+
|iGEM strain box 1
 +
|23
 +
|RBS
 +
|DH5α
 +
|pSB1A2?
 +
|B0034
 +
|Amp100
 +
|Ribosome binding site (Elowitz)
 +
|
 +
 
|-
|-
-
|anneals to RFP ORF sequence adds TT (B1002) adds KpnI site, but don't use it to clone, the ORF contains other KpnI sites || RFP-KpnII-TT-R (rev) || ATGGGTACCAAAAAAAAACCCCGCCGAAGCGGGGTTTTTTTTTCTCTAGTAGCGATCTACACTAGCACTATCA || 73
+
|iGEM strain box 1
 +
|24
 +
|Pconst55%
 +
|DH5α
 +
|[http://partsregistry.org/Part:BBa_J61002 BBa_J61002]
 +
|[http://partsregistry.org/Part:BBa_J23118 BBa_J23118]
 +
|Amp100
 +
|Constitutive promoter. Expression level is 55% in comparison with the highest expression levels from this Pconst family (ex. wildtype promoter)
 +
|
 +
 
|-
|-
-
|amplifies PmeI from Pseudomonas mendocina NEB698, used to amplify synthetic ORF to add RBS (fwd)|| PmeIR-F || GAATTCCGGCCGCTTCTAGAGAAAGAGGAGAAATACTAGATGACAACAAACTCCCCCTCAG || 61
+
|iGEM strain box 1
 +
|25
 +
|TT
 +
|DH5α
 +
|pSB1AK3
 +
|[http://partsregistry.org/Part:BBa_B0015 BBa_B0015]
 +
|Amp100, Kan25
 +
|Default double transcriptional terminator
 +
|
 +
 
|-
|-
-
|amplifies PmeI from Pseudomonas mendocina NEB698, or our synthetic ORF (rev) || PmeIR-R || CTGCAGCGGCCGCTACTAGTATTATTAAACCGTACTTCGCCCCCG || 45
+
|iGEM strain box 1
 +
|26
 +
|rfp
 +
|DH5α
 +
|pSB2K3
 +
|E1010
 +
|Kan25
 +
|Red fluorescent protein (shows up pink even without appropriate wavelength of light and filter)
 +
|
 +
 
|-
|-
-
|sense oligo for RecA lexA hybrid promoter (K093000) 5' EcoRI overhang (fwd) || recA-F || AATTCGCGGCCGCTTCTAGAGTACAAAACACTTGATACTGTATATATATACAGTATAATTGCTTCAACATA|| 71
+
|iGEM strain box 1
 +
|27
 +
|Pseudomonas mendocina
 +
|kr 1
 +
|
 +
|
 +
|?
 +
|Wrong strain for cloning PmeI (received from Paul Hatzinger at Shaw Environmental NJ). Degrades N-nitrodimethylamine (NDMA). Appl Environ Microbiol. 2006 Oct;72(10):6693-8. Epub 2006 Sep 1
 +
|2008:08:xx
 +
 
|-
|-
-
|sense oligo for RecA lexA hybrid promoter (K093000) 3' SpeI overhang (rev) || recA-R || CTAGTATGTTGAAGCAATTATACTGTATATATATACAGTATCAAGTGTTTTGTACTCTAGAAGCGGCCGCG || 71
+
|iGEM strain box 1
 +
|28
 +
|Plac
 +
|DH5α
 +
|pSB1A2
 +
|[http://partsregistry.org/Part:BBa_R0010 BBa_R0010]
 +
|Amp100
 +
|Wildtype LacI repressable promoter
 +
|
 +
 
|-
|-
-
|amplifies RFP ORF adds RBS (fwd) || RFP-RBS-F || GAATTCCGGCCGCTTCTAGAGAAAGAGGAGAAATACTAGATGGCTTCCTCCGAAGACG || 58
+
|iGEM strain box 1
 +
|29
 +
|PtetR
 +
|DH5α
 +
|pSB1A2
 +
|[http://partsregistry.org/Part:BBa_R0040 BBa_R0040]
 +
|Amp100
 +
|Promoter that is repressed by tetR and derepressed by tetracyclin.
 +
|
 +
 
|-
|-
-
|amplifies RFP ORF, creates product for crossover PCR || RFP-RXO || GATGCCTGGCTCTAGTATTATTAAGCACCGGTGG || 34
+
|iGEM strain box 1
 +
|30
 +
|CI
 +
|DH5α
 +
|pSB1A2
 +
|[http://partsregistry.org/Part:BBa_C0051 BBa_C0051]
 +
|Amp100
 +
|CI repressor for λ Pr promoter
 +
|
 +
 
|-
|-
-
|Amplifies RK2 oriT adds MunI site (compatible end with EcoRI) (fwd) || RK2E-F || CATCAATTGCCGGCCAGCCTCGCAGAGCA || 29
+
|iGEM strain box 1
 +
|31
 +
|rTT
 +
|DH5α
 +
|pSB1A2
 +
|B0025
 +
|Amp100
 +
|Reverse transcriptional terminator ([http://partsregistry.org/Part:BBa_B0015 BBa_B0015])
 +
|2008:xx:xx
 +
 
|-
|-
-
|Amplifies RK2 oriT adds EcoRI site, adds attB site in the forward orientation (rev) || RK2E-R || ATGGAATTCCGCGCCCGGGGAGCCCAAGGGCACGCCCTGGCACCCCGGGCAGGATAGGTGAAGT || 64
+
|iGEM strain box 1
 +
|32
 +
|Taq
 +
|DH5α
 +
|
 +
|
 +
|Amp100
 +
|Taq strain from Moffatt lab for purifying taq
 +
|2008:08:xx
 +
 
|-
|-
-
|ampifies RK2 oriT adds PstI site, adds attB in the reverse orientation (fwd) || RK2-FP || CATCTGCAGCGCGCCCGGGGAGCCCAAGGGCACGCCCTGGCACCCCGGCCAGCCTCGCAGAGCA || 64
+
|iGEM strain box 1
 +
|33
 +
|Pconst+
 +
|DH5α
 +
|pSB1A2
 +
|[http://partsregistry.org/Part:BBa_J23119 BBa_J23119]
 +
|Amp100
 +
|Wildtype promoter─strongest of this promoter family ([http://partsregistry.org/Part:BBa_J23100 BBa_J23100]-[http://partsregistry.org/Part:BBa_J23119 BBa_J23119])
 +
|
 +
 
|-
|-
-
|amplifes RK2 oriT adds Mph1103I site (compatible end with PstI) (rev) || RK2-RP || ATGATGCATCCGGGCAGGATAGGTGAAGT || 29
+
|iGEM strain box 1
 +
|34
 +
|LacI
 +
|DH5α
 +
|pSB1A2
 +
|[http://partsregistry.org/Part:BBa_C0012 BBa_C0012]
 +
|Amp100
 +
|LacI repressor for Plac Promoter ([http://partsregistry.org/Part:BBa_R0010 BBa_R0010]) with LVA degredation tag
 +
|
 +
 
|-
|-
-
|BBa sequencing/Colony PCR primer (fwd)  || VF2 || TGCCACCTGACGTCTAAGAA || 20
+
|iGEM strain box 1
 +
|35
 +
|Pconst4%
 +
|DH5α
 +
|[http://partsregistry.org/Part:BBa_J61002 BBa_J61002]
 +
|[http://partsregistry.org/Part:BBa_J23109 BBa_J23109]
 +
|Amp100
 +
|Constitutive promoter. Expression level is 4% in comparison with the highest expression levels from this Pconst family (ex. wildtype promoter)
 +
|
 +
 
|-
|-
-
|BBa sequencing/Colony PCR primer (rev)  || VR || ATTACCGCCTTTGAGTGAGC || 20
+
|iGEM strain box 1
 +
|36
 +
|TTbi
 +
|DH5α
 +
|pSB1AK3
 +
|[http://partsregistry.org/Part:BBa_B0014 BBa_B0014]
 +
|Amp100,Kan25
 +
|Double terminator─not as strong as [http://partsregistry.org/Part:BBa_B0015 BBa_B0015] but more even efficiency for forward and reverse use.
 +
|
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|37
 +
|Pconst100%
 +
|DH5α
 +
|[http://partsregistry.org/Part:BBa_J61002 BBa_J61002]
 +
|[http://partsregistry.org/Part:BBa_J23100 BBa_J23100]
 +
|Amp100
 +
|Constitutive promoter. Expression level is 100%─the highest expression level for this Pconst family (i.e., wildtype promoter)
 +
|
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|38
 +
|PlacCI''
 +
|DH5α
 +
|pSB2K3
 +
|
 +
|Kan25
 +
|cI repressor ([http://partsregistry.org/Part:BBa_C0051 BBa_C0051]) with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]) and transcriptional terminator ([http://partsregistry.org/Part:BBa_B0015 BBa_B0015]) under the promoter Plac ([http://partsregistry.org/Part:BBa_R0011 BBa_R0011]).
 +
|2009:04:xx
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|39
 +
|pTC300
 +
|DH5α
 +
|pUC19
 +
|
 +
|Cm10, Kan25
 +
|Strain containing Kanamycin resistance gene, and SacB negative selection gene flanked together by BamHI sites
 +
|2009:05:30
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|40
 +
|DB 3.1
 +
|DB 3.1
 +
|
 +
|
 +
|
 +
|CCDB resistant strain, contains mutation in GyrA
 +
|2009:05:30
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|41
 +
|DH5α
 +
|DH5 alpha
 +
|
 +
|
 +
|
 +
|For making competent cells. Default strain for
 +
|2007:xx:xx
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|42
 +
|pFB9006
 +
|DH5α λ pir
 +
|pFB9001
 +
|
 +
|Strep100/Kan20
 +
|pFB9005+KanSac. pFB9001 containing H2 homologous region to ''E. coli'' melA gene. Does not contain H1 region.
 +
|2009:06:xx
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|43
 +
|pSB1A3
 +
|DH5α
 +
|pSB1A3
 +
|
 +
|Amp 100
 +
|BioBrick vector from 2009 registry.
 +
|2009:06:16
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|44
 +
|luxI''
 +
|DH5α
 +
|pSB1AK3
 +
|
 +
|Amp100, Kan 25??
 +
|luxI ([http://partsregistry.org/Part:BBa_C0061 BBa_C0061]) +RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]) and transcriptional terminator ([http://partsregistry.org/Part:BBa_B0015 BBa_B0015])
 +
|2007:xx:xx
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|45
 +
|PlaclasR''
 +
|DH5α
 +
|pSB1A2
 +
|
 +
|Amp100
 +
|lasR (C0079) with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]) and TT ([http://partsregistry.org/Part:BBa_B0015 BBa_B0015]) under the control of a lac promoter (unsure which promoter - would need testing/sequencing)
 +
|2007:xx:xx
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|46
 +
|Plux rfp'
 +
|DH5α
 +
|pSB2K3
 +
|
 +
|Kan25
 +
|RFP ([http://partsregistry.org/Part:BBa_E1010 BBa_E1010]) with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]under Plux promoter
 +
|2007:xx:xx
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|47
 +
|Plas rfp'
 +
|DH5α
 +
|pSB2K3
 +
|
 +
|Kan25
 +
|RFP ([http://partsregistry.org/Part:BBa_E1010 BBa_E1010]) with RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034])  under Plas promoter ([http://partsregistry.org/Part:BBa_R0079 BBa_R0079])
 +
|2007:xx:xx
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|48
 +
|Ptet rfp'
 +
|DH5α
 +
|pSB2K3
 +
|
 +
|Kan25
 +
|RFP ([http://partsregistry.org/Part:BBa_E1010 BBa_E1010]) with RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034])  under Ptet promoter ([http://partsregistry.org/Part:BBa_R0040 BBa_R0040])
 +
|2007:xx:xx
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|49
 +
|PompR rfp'
 +
|DH5α
 +
|pSB2K3
 +
|
 +
|Kan25
 +
|RFP ([http://partsregistry.org/Part:BBa_E1010 BBa_E1010]) with RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034])  under PompR promoter
 +
|2007:xx:xx
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|50
 +
|tetR''
 +
|DH5α
 +
|pSB2K3
 +
|
 +
|Kan25
 +
|tetR repressor ([http://partsregistry.org/Part:BBa_C0040 BBa_C0040]) with RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]) and TT ([http://partsregistry.org/Part:BBa_B0015 BBa_B0015])
 +
|2007:xx:xx
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|51
 +
|???
 +
|DH5α
 +
|pSB2K3
 +
|
 +
|Kan25
 +
|
 +
|
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|52
 +
|lasI''
 +
|DH5α
 +
|pSB2K3
 +
|
 +
|Kan25
 +
|lasI ([http://partsregistry.org/Part:BBa_C0078 BBa_C0078]) with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]) and TT ([http://partsregistry.org/Part:BBa_B0015 BBa_B0015])
 +
|2007:xx:xx
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|53
 +
|tetR''
 +
|DH5α
 +
|pSB2K3
 +
|
 +
|Kan25
 +
|tetR repressor ([http://partsregistry.org/Part:BBa_C0040 BBa_C0040]) with RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]) and TT ([http://partsregistry.org/Part:BBa_B0015 BBa_B0015])
 +
|2007:xx:xx
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|54
 +
|tetR'
 +
|DH5α
 +
|pSB1A2
 +
|
 +
|Amp100
 +
|tetR repressor ([http://partsregistry.org/Part:BBa_C0040 BBa_C0040]) with RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034])
 +
|2007:xx:xx
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|55
 +
|lasR''
 +
|DH5α
 +
|pSB1A2
 +
|
 +
|Amp100
 +
|lasR ([http://partsregistry.org/Part:BBa_C0079 BBa_C0079]) with RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]) and TT ([http://partsregistry.org/Part:BBa_B0015 BBa_B0015])
 +
|2007:xx:xx
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|56
 +
|Plac IA7K
 +
|DH5α
 +
|pSB1A2
 +
|
 +
|Amp100
 +
|????
 +
|
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|57
 +
|pSB1A2 attB TG
 +
|DH5α
 +
|pSB1A2
 +
|
 +
|Amp100
 +
|Was previously Pr RFP', RFP was cut out and attB TG was inserted. Flanked by EcoRI and PstI sites.
 +
|2009:07:06
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|58
 +
|pSB1A2 attB TT
 +
|DH5α
 +
|pSB1A2
 +
|
 +
|Amp100
 +
|Same as Strain #57, except the inserted fragment was attB TT instead. This is the wild-type attB.
 +
|2009:07:06
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|59
 +
|pSB1A2 attB CT
 +
|DH5α
 +
|pSB1A2
 +
|
 +
|Amp100
 +
|Same as Strain #57, except the inserted fragment was attB CT instead.
 +
|2009:07:06
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|60
 +
|rPlacTT + PlacCI
 +
|DH5α
 +
|pSB2K3
 +
|
 +
|
 +
|
 +
|2009:06:15
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|61
 +
|2008 Construct w/o Promoter
 +
|DH5α
 +
|pSB1A2
 +
|
 +
|Amp100
 +
|RBS + Pmel + rPlacTT + PlacCI. 2008 project.
 +
|2009:07:10
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|62
 +
|2008 Constant
 +
|DH5α
 +
|
 +
|
 +
|Amp100
 +
|
 +
|2009:07:15
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|63
 +
|pSB3C5
 +
|DB3.1
 +
|pSB3C5
 +
|
 +
|Cm25
 +
|Low copy # plasmid, no promoter, no RBS, "CCDD" (BBa 15001/15002)?
 +
|
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|64
 +
|BBa
 +
|
 +
|pSB3C5
 +
|
 +
|
 +
|
 +
|
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|65
 +
|pKNG101
 +
|DH5α
 +
|pKNG101
 +
|
 +
|Strep100
 +
|Plasmid backbone for the pFB9xxx series.
 +
|2009:08:07
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|66
 +
|DH5α λ pir
 +
|DH5 alpha lambda pir
 +
|None
 +
|
 +
|None
 +
|DH5α λ pir stock for making competent cells.
 +
|2009:07:24
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|67
 +
|pFB9007
 +
|DH5α λ pir
 +
|pFB9001
 +
|
 +
|Strep100
 +
|Contains H2 region and an attP site. Same as pFB9004 except w/o the truncated SacB gene on the plasmid backbone.
 +
|2009:08:05
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|68
 +
|pFB9008
 +
|DH5α λ pir
 +
|pFB9007
 +
|
 +
|Strep100
 +
|Same as pFB9007, but it has RFP cloned in upstream of the attP site and the H2 region.
 +
|2009:08:05
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|69
 +
|pFB9009 #2
 +
|DH5α λ pir
 +
|pFB9008+H1
 +
|
 +
|Strep100/Kan20
 +
|Same as pFB9008+H2, but it has Kanr and sacB genes cloned in between the H1&H2 regions, directly downstream adjacent to the RFP.
 +
|2009:08:28
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|70
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
|
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|71
 +
|pSB4A5
 +
|DH5α
 +
|pSB4A5
 +
|
 +
|Amp100
 +
|Low copy number, no promoter, no RBS.
 +
|2009:08:28
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|72
 +
|pSB4C5
 +
|DB3.1
 +
|pSB4C5
 +
|
 +
|Cm25
 +
|Low copy number, no promoter, no RBS.
 +
|2009:08:28
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|73
 +
|OriT-L #13
 +
|DH5α
 +
|pSB1A2
 +
|
 +
|Amp100
 +
|
 +
|2009:08:28
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|74
 +
|OriT-L #18
 +
|DH5α
 +
|pSB1A2
 +
|
 +
|Amp100
 +
|
 +
|2009:08:28
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|75
 +
|[http://partsregistry.org/Part:BBa_J23116 BBa_J23116] Pconst
 +
|DH5α
 +
|[http://partsregistry.org/Part:BBa_J61002 BBa_J61002]
 +
|
 +
|Amp100
 +
|
 +
|2009:08:28
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|76
 +
|[http://partsregistry.org/Part:BBa_J23118 BBa_J23118] Pconst
 +
|DH5α
 +
|[http://partsregistry.org/Part:BBa_J61002 BBa_J61002]
 +
|
 +
|Amp100
 +
|
 +
|2009:08:28
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|77
 +
|pFB9008+H1 #13
 +
|DH5α λ pir
 +
|pFB9007
 +
|
 +
|Strep100/Kan20
 +
|Same as pFB9008, except that H1 region and its attP site are cloned in upstream of the RFP gene to flank the RFP. Low copy number.
 +
|2009:08:28
 +
 
 +
|-
 +
|iGEM strain box 1
 +
|78
 +
|pSB4C5-1
 +
|DB3.1
 +
|pSB4C5
 +
|
 +
|Cm25
 +
|
 +
|2009:08:20
 +
 
|-
|-
 +
|iGEM strain box 1
 +
|79
 +
|pSB4C5-2
 +
|DB3.1
 +
|pSB4C5
 +
|
 +
|Cm25
 +
|
 +
|2009:08:20

Latest revision as of 00:25, 22 October 2009

Strain list

LocationStrain #NameChassis/StrainPlasmid BackboneRegistry PartAntibiotic ResistanceDescriptionReference Date
iGEM strain box 1 1 rTT + PocI DH5α pMA (GeneArt) [http://partsregistry.org/Part:BBa_K093003 BBa_K093003] Amp100 Synthesized. Contains BioBrick prefix and suffix. Reverse orientation transcriptional terminator R0015 with λ Pr promotor. 2008:09:09
iGEM strain box 1 2 rPlacTT DH5α pMA (GeneArt) [http://partsregistry.org/Part:BBa_K093004 BBa_K093004] Amp100 Synthesized. Contains BioBrick prefix and suffix. Reverse [http://partsregistry.org/Part:BBa_R0011 BBa_R0011] and transcriptional terminator [http://partsregistry.org/Part:BBa_B0015 BBa_B0015]. 2008:09:09
iGEM strain box 1 3 PmeI DH5α pMA (GeneArt) [http://partsregistry.org/Part:BBa_K093002 BBa_K093002] Amp100 Synthesized ORF. Contains BioBrick prefix and suffix. 2008:09:09
iGEM strain box 1 4 rfp'-14 DH5α pSB1A2 [http://partsregistry.org/Part:BBa_K093005 BBa_K093005] Amp100 RFP ([http://partsregistry.org/Part:BBa_E1010 BBa_E1010]) with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]) colony 14. 2008:09:09
iGEM strain box 1 5 rfp-2 DH5α pSB1AK3 Amp100, Kan25 RFP ([http://partsregistry.org/Part:BBa_E1010 BBa_E1010]) with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]) and transcriptional terminator ([http://partsregistry.org/Part:BBa_B0015 BBa_B0015]) colony 2. Might need testing 2008:09:09
iGEM strain box 1 6 Pconst-rfp-1 DH5α pSB1A2 [http://partsregistry.org/Part:BBa_K093012 BBa_K093012] Amp100 RFP ([http://partsregistry.org/Part:BBa_E1010 BBa_E1010]) with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]) and transcriptional terminator ([http://partsregistry.org/Part:BBa_B0015 BBa_B0015]) under a constitutive promoter ([http://partsregistry.org/Part:BBa_J23118 BBa_J23118]). Might need testing. 2008:09:09
iGEM strain box 1 7 pRecA-3 DH5α psb2k3 [http://partsregistry.org/Part:BBa_K093000 BBa_K093000] Kan25 Engineered RecA promoter with lexA consensus sequence. 2008:10:17
iGEM strain box 1 8 Pconst-rfp' 1 DH5α psb1a2 Amp100 RFP ([http://partsregistry.org/Part:BBa_E1010 BBa_E1010]) with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]) under a constitutive promoter ([http://partsregistry.org/Part:BBa_J23118 BBa_J23118]) 2008:10:17
iGEM strain box 1 9 c0051' DH5α psb1a2 [http://partsregistry.org/Part:BBa_K093006 BBa_K093006] Amp100 [http://partsregistry.org/Part:BBa_C0051 BBa_C0051] Repressor for Lambda Pr promoter with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]). Never got sequencing results of prefix. Rest was good 2008:10:17
iGEM strain box 1 10 PmeI - 14 DH5α psb2k3 [http://partsregistry.org/Part:BBa_K093002 BBa_K093002] Kan25 PmeI cloned into BioBrick vector 2008:10:17
iGEM strain box 1 11 PrecA RFP' DH5α pSB2K3 [http://partsregistry.org/Part:BBa_K093009 BBa_K093009] Kan25 RFP ([http://partsregistry.org/Part:BBa_E1010 BBa_E1010]) with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]) under the control of [http://partsregistry.org/Part:BBa_K093000 BBa_K093000] promoter 2008:10:17
iGEM strain box 1 12 PmeI' DH5α pSB1A2 [http://partsregistry.org/Part:BBa_K093013 BBa_K093013] Amp100 PmeI ([http://partsregistry.org/Part:BBa_K093002 BBa_K093002]) with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]) 2008:11:04
iGEM strain box 1 13 Pr RFP' DH5α psb1a2 [http://partsregistry.org/Part:BBa_K093010 BBa_K093010] Amp100 RFP ([http://partsregistry.org/Part:BBa_E1010 BBa_E1010]) with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]) under Lamda Pr promoter (R0051) 2008:11:04
iGEM strain box 1 14 T7 gene 6 DH5α pSB1A2 [http://partsregistry.org/Part:BBa_K093001 BBa_K093001] Amp100 good one, correct stop codon taataa 2009:02:13
iGEM strain box 1 15 PkNG101 DH5α λ pir Strep100 Only replicates in λ pir lysogen (r6k origin of replication) http://bccm.belspo.be/db/lmbp_plasmid_details.php?NM=pKNG101 2009:02:xx
iGEM strain box 1 16 H1-4 pJET DH5α pJET Amp100 E. coli melA genomic DNA for homologous recombination (“left sequence”/H1) and attP site downstream 2009:03:18
iGEM strain box 1 17 CI pJET DH5α pJET Amp100 CI repressor for lamda Pr promoter. [http://partsregistry.org/Part:BBa_C0051 BBa_C0051] with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]) and transcriptional terminator ([http://partsregistry.org/Part:BBa_B0015 BBa_B0015]) in pJET (made by crossover PCR) 2009:03:xx
iGEM strain box 1 18 pFB9002 DH5α lamda pir pfb9001 Strep 100 E. coli melA genomic DNA for homologous recombination (“left sequence”/H1) and attP site downstream 2009:03:xx
iGEM strain box 1 19 pJET H2 DH5α pJET Amp100 E. coli melA genomic DNA for homologous recombination (“right sequence”/H2) and attP site upstream 2009:04:09
iGEM strain box 1 20 Pfb9003 DH5α lamda pir pfb9001 Strep100 E. coli melA genomic DNA for homologous recombination (“right sequence”/H2) and attP site upstream 2009:04:23
iGEM strain box 1 21 pfb9004 DH5α lamda pir pfb9001 Strep100 Contains two attP sites flanked by E. coli melA genomic DNA for homologous recombination (H1 and H2) 2009:04:23
iGEM strain box 1 22 pJET rfp-1 DH5α pJET Amp100 insert: Pconst ([http://partsregistry.org/Part:BBa_J23118 BBa_J23118]) rfp ([http://partsregistry.org/Part:BBa_E1010 BBa_E1010]) EcoRV fragment for propagating pJET 2009:04:24
iGEM strain box 1 79 pJET rfp-2 DH5α pJET Amp100 insert: Pconst rfp EcoRV fragment 2009:04:24
iGEM strain box 1 81 pJET rfp-3 DH5α pJET Amp100 insert: Pconst rfp EcoRV fragment 2009:04:24
iGEM strain box 1 23 RBS DH5α pSB1A2? B0034 Amp100 Ribosome binding site (Elowitz)
iGEM strain box 1 24 Pconst55% DH5α [http://partsregistry.org/Part:BBa_J61002 BBa_J61002] [http://partsregistry.org/Part:BBa_J23118 BBa_J23118] Amp100 Constitutive promoter. Expression level is 55% in comparison with the highest expression levels from this Pconst family (ex. wildtype promoter)
iGEM strain box 1 25 TT DH5α pSB1AK3 [http://partsregistry.org/Part:BBa_B0015 BBa_B0015] Amp100, Kan25 Default double transcriptional terminator
iGEM strain box 1 26 rfp DH5α pSB2K3 E1010 Kan25 Red fluorescent protein (shows up pink even without appropriate wavelength of light and filter)
iGEM strain box 1 27 Pseudomonas mendocina kr 1 ? Wrong strain for cloning PmeI (received from Paul Hatzinger at Shaw Environmental NJ). Degrades N-nitrodimethylamine (NDMA). Appl Environ Microbiol. 2006 Oct;72(10):6693-8. Epub 2006 Sep 1 2008:08:xx
iGEM strain box 1 28 Plac DH5α pSB1A2 [http://partsregistry.org/Part:BBa_R0010 BBa_R0010] Amp100 Wildtype LacI repressable promoter
iGEM strain box 1 29 PtetR DH5α pSB1A2 [http://partsregistry.org/Part:BBa_R0040 BBa_R0040] Amp100 Promoter that is repressed by tetR and derepressed by tetracyclin.
iGEM strain box 1 30 CI DH5α pSB1A2 [http://partsregistry.org/Part:BBa_C0051 BBa_C0051] Amp100 CI repressor for λ Pr promoter
iGEM strain box 1 31 rTT DH5α pSB1A2 B0025 Amp100 Reverse transcriptional terminator ([http://partsregistry.org/Part:BBa_B0015 BBa_B0015]) 2008:xx:xx
iGEM strain box 1 32 Taq DH5α Amp100 Taq strain from Moffatt lab for purifying taq 2008:08:xx
iGEM strain box 1 33 Pconst+ DH5α pSB1A2 [http://partsregistry.org/Part:BBa_J23119 BBa_J23119] Amp100 Wildtype promoter─strongest of this promoter family ([http://partsregistry.org/Part:BBa_J23100 BBa_J23100]-[http://partsregistry.org/Part:BBa_J23119 BBa_J23119])
iGEM strain box 1 34 LacI DH5α pSB1A2 [http://partsregistry.org/Part:BBa_C0012 BBa_C0012] Amp100 LacI repressor for Plac Promoter ([http://partsregistry.org/Part:BBa_R0010 BBa_R0010]) with LVA degredation tag
iGEM strain box 1 35 Pconst4% DH5α [http://partsregistry.org/Part:BBa_J61002 BBa_J61002] [http://partsregistry.org/Part:BBa_J23109 BBa_J23109] Amp100 Constitutive promoter. Expression level is 4% in comparison with the highest expression levels from this Pconst family (ex. wildtype promoter)
iGEM strain box 1 36 TTbi DH5α pSB1AK3 [http://partsregistry.org/Part:BBa_B0014 BBa_B0014] Amp100,Kan25 Double terminator─not as strong as [http://partsregistry.org/Part:BBa_B0015 BBa_B0015] but more even efficiency for forward and reverse use.
iGEM strain box 1 37 Pconst100% DH5α [http://partsregistry.org/Part:BBa_J61002 BBa_J61002] [http://partsregistry.org/Part:BBa_J23100 BBa_J23100] Amp100 Constitutive promoter. Expression level is 100%─the highest expression level for this Pconst family (i.e., wildtype promoter)
iGEM strain box 1 38 PlacCI DH5α pSB2K3 Kan25 cI repressor ([http://partsregistry.org/Part:BBa_C0051 BBa_C0051]) with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]) and transcriptional terminator ([http://partsregistry.org/Part:BBa_B0015 BBa_B0015]) under the promoter Plac ([http://partsregistry.org/Part:BBa_R0011 BBa_R0011]). 2009:04:xx
iGEM strain box 1 39 pTC300 DH5α pUC19 Cm10, Kan25 Strain containing Kanamycin resistance gene, and SacB negative selection gene flanked together by BamHI sites 2009:05:30
iGEM strain box 1 40 DB 3.1 DB 3.1 CCDB resistant strain, contains mutation in GyrA 2009:05:30
iGEM strain box 1 41 DH5α DH5 alpha For making competent cells. Default strain for 2007:xx:xx
iGEM strain box 1 42 pFB9006 DH5α λ pir pFB9001 Strep100/Kan20 pFB9005+KanSac. pFB9001 containing H2 homologous region to E. coli melA gene. Does not contain H1 region. 2009:06:xx
iGEM strain box 1 43 pSB1A3 DH5α pSB1A3 Amp 100 BioBrick vector from 2009 registry. 2009:06:16
iGEM strain box 1 44 luxI DH5α pSB1AK3 Amp100, Kan 25?? luxI ([http://partsregistry.org/Part:BBa_C0061 BBa_C0061]) +RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]) and transcriptional terminator ([http://partsregistry.org/Part:BBa_B0015 BBa_B0015]) 2007:xx:xx
iGEM strain box 1 45 PlaclasR DH5α pSB1A2 Amp100 lasR (C0079) with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]) and TT ([http://partsregistry.org/Part:BBa_B0015 BBa_B0015]) under the control of a lac promoter (unsure which promoter - would need testing/sequencing) 2007:xx:xx
iGEM strain box 1 46 Plux rfp' DH5α pSB2K3 Kan25 RFP ([http://partsregistry.org/Part:BBa_E1010 BBa_E1010]) with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]) under Plux promoter 2007:xx:xx
iGEM strain box 1 47 Plas rfp' DH5α pSB2K3 Kan25 RFP ([http://partsregistry.org/Part:BBa_E1010 BBa_E1010]) with RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]) under Plas promoter ([http://partsregistry.org/Part:BBa_R0079 BBa_R0079]) 2007:xx:xx
iGEM strain box 1 48 Ptet rfp' DH5α pSB2K3 Kan25 RFP ([http://partsregistry.org/Part:BBa_E1010 BBa_E1010]) with RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]) under Ptet promoter ([http://partsregistry.org/Part:BBa_R0040 BBa_R0040]) 2007:xx:xx
iGEM strain box 1 49 PompR rfp' DH5α pSB2K3 Kan25 RFP ([http://partsregistry.org/Part:BBa_E1010 BBa_E1010]) with RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]) under PompR promoter 2007:xx:xx
iGEM strain box 1 50 tetR DH5α pSB2K3 Kan25 tetR repressor ([http://partsregistry.org/Part:BBa_C0040 BBa_C0040]) with RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]) and TT ([http://partsregistry.org/Part:BBa_B0015 BBa_B0015]) 2007:xx:xx
iGEM strain box 1 51 ??? DH5α pSB2K3 Kan25
iGEM strain box 1 52 lasI DH5α pSB2K3 Kan25 lasI ([http://partsregistry.org/Part:BBa_C0078 BBa_C0078]) with RBS ([http://partsregistry.org/Part:BBa_E0034 BBa_E0034]) and TT ([http://partsregistry.org/Part:BBa_B0015 BBa_B0015]) 2007:xx:xx
iGEM strain box 1 53 tetR DH5α pSB2K3 Kan25 tetR repressor ([http://partsregistry.org/Part:BBa_C0040 BBa_C0040]) with RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]) and TT ([http://partsregistry.org/Part:BBa_B0015 BBa_B0015]) 2007:xx:xx
iGEM strain box 1 54 tetR' DH5α pSB1A2 Amp100 tetR repressor ([http://partsregistry.org/Part:BBa_C0040 BBa_C0040]) with RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]) 2007:xx:xx
iGEM strain box 1 55 lasR DH5α pSB1A2 Amp100 lasR ([http://partsregistry.org/Part:BBa_C0079 BBa_C0079]) with RBS ([http://partsregistry.org/Part:BBa_B0034 BBa_B0034]) and TT ([http://partsregistry.org/Part:BBa_B0015 BBa_B0015]) 2007:xx:xx
iGEM strain box 1 56 Plac IA7K DH5α pSB1A2 Amp100 ????
iGEM strain box 1 57 pSB1A2 attB TG DH5α pSB1A2 Amp100 Was previously Pr RFP', RFP was cut out and attB TG was inserted. Flanked by EcoRI and PstI sites. 2009:07:06
iGEM strain box 1 58 pSB1A2 attB TT DH5α pSB1A2 Amp100 Same as Strain #57, except the inserted fragment was attB TT instead. This is the wild-type attB. 2009:07:06
iGEM strain box 1 59 pSB1A2 attB CT DH5α pSB1A2 Amp100 Same as Strain #57, except the inserted fragment was attB CT instead. 2009:07:06
iGEM strain box 1 60 rPlacTT + PlacCI DH5α pSB2K3 2009:06:15
iGEM strain box 1 61 2008 Construct w/o Promoter DH5α pSB1A2 Amp100 RBS + Pmel + rPlacTT + PlacCI. 2008 project. 2009:07:10
iGEM strain box 1 62 2008 Constant DH5α Amp100 2009:07:15
iGEM strain box 1 63 pSB3C5 DB3.1 pSB3C5 Cm25 Low copy # plasmid, no promoter, no RBS, "CCDD" (BBa 15001/15002)?
iGEM strain box 1 64 BBa pSB3C5
iGEM strain box 1 65 pKNG101 DH5α pKNG101 Strep100 Plasmid backbone for the pFB9xxx series. 2009:08:07
iGEM strain box 1 66 DH5α λ pir DH5 alpha lambda pir None None DH5α λ pir stock for making competent cells. 2009:07:24
iGEM strain box 1 67 pFB9007 DH5α λ pir pFB9001 Strep100 Contains H2 region and an attP site. Same as pFB9004 except w/o the truncated SacB gene on the plasmid backbone. 2009:08:05
iGEM strain box 1 68 pFB9008 DH5α λ pir pFB9007 Strep100 Same as pFB9007, but it has RFP cloned in upstream of the attP site and the H2 region. 2009:08:05
iGEM strain box 1 69 pFB9009 #2 DH5α λ pir pFB9008+H1 Strep100/Kan20 Same as pFB9008+H2, but it has Kanr and sacB genes cloned in between the H1&H2 regions, directly downstream adjacent to the RFP. 2009:08:28
iGEM strain box 1 70
iGEM strain box 1 71 pSB4A5 DH5α pSB4A5 Amp100 Low copy number, no promoter, no RBS. 2009:08:28
iGEM strain box 1 72 pSB4C5 DB3.1 pSB4C5 Cm25 Low copy number, no promoter, no RBS. 2009:08:28
iGEM strain box 1 73 OriT-L #13 DH5α pSB1A2 Amp100 2009:08:28
iGEM strain box 1 74 OriT-L #18 DH5α pSB1A2 Amp100 2009:08:28
iGEM strain box 1 75 [http://partsregistry.org/Part:BBa_J23116 BBa_J23116] Pconst DH5α [http://partsregistry.org/Part:BBa_J61002 BBa_J61002] Amp100 2009:08:28
iGEM strain box 1 76 [http://partsregistry.org/Part:BBa_J23118 BBa_J23118] Pconst DH5α [http://partsregistry.org/Part:BBa_J61002 BBa_J61002] Amp100 2009:08:28
iGEM strain box 1 77 pFB9008+H1 #13 DH5α λ pir pFB9007 Strep100/Kan20 Same as pFB9008, except that H1 region and its attP site are cloned in upstream of the RFP gene to flank the RFP. Low copy number. 2009:08:28
iGEM strain box 1 78 pSB4C5-1 DB3.1 pSB4C5 Cm25 2009:08:20
iGEM strain box 1 79 pSB4C5-2 DB3.1 pSB4C5 Cm25 2009:08:20