Team:Todai-Tokyo/Protocols/Notebook Sample
From 2009.igem.org
(Difference between revisions)
Line 15: | Line 15: | ||
<h2> PCR </h2> | <h2> PCR </h2> | ||
+ | |||
+ | The yqiT gene was [[Team:Todai-Tokyo/Protocols/PCR|PCR]] amplified from pLacI-yqiT-dterm ([[Team:Todai-Tokyo/Protocols/Miniprep|miniprep]]ped on 9/7) using the following primers: | ||
+ | |||
+ | yqiT fwd: agcccgtgtagtactgtagagt | ||
+ | yqiT rev: agggatgtttgccagtcgtaattag | ||
+ | |||
+ | Using [[Team:Todai-Tokyo/Protocols/PCR|PCR program 1]] | ||
+ | |||
+ | |||
<h2> Sequencing </h2> | <h2> Sequencing </h2> | ||
<h2> Transformation </h2> | <h2> Transformation </h2> |
Revision as of 02:35, 20 October 2009
Home | The Team | The Project | Parts Submitted to the Registry | Modeling | Notebook | Protocols | Ethics |
---|
MiniprepThe following were miniprepped:
PCRThe yqiT gene was PCR amplified from pLacI-yqiT-dterm (miniprepped on 9/7) using the following primers: yqiT fwd: agcccgtgtagtactgtagagt yqiT rev: agggatgtttgccagtcgtaattag Using PCR program 1
SequencingTransformationLigationInfusionGel PurificationRE Digest |