Team:Todai-Tokyo/Protocols/Notebook Sample

From 2009.igem.org

(Difference between revisions)
Line 30: Line 30:
The following were [[Team:Todai-Tokyo/Protocols/sequencing|sequenced]] using the labeled primers:
The following were [[Team:Todai-Tokyo/Protocols/sequencing|sequenced]] using the labeled primers:
-
* pAraC Sample 1([[Team:Todai-Tokyo/Protocols/Miniprep|miniprep]]ped on 9/23)
+
* pAraC Sample 1 ([[Team:Todai-Tokyo/Protocols/Miniprep|miniprep]]ped on 9/23)
** 1) '''Biobrick vector fwd''': atatgagagcgcgcgcagagagagatg
** 1) '''Biobrick vector fwd''': atatgagagcgcgcgcagagagagatg
** 2) '''Biobrick vector rev''': tttttaaaagggggtgtgtgtgtaaagttt
** 2) '''Biobrick vector rev''': tttttaaaagggggtgtgtgtgtaaagttt
Line 42: Line 42:
<h2> Transformation </h2>
<h2> Transformation </h2>
-
<h2> Ligation </h2>
+
 
 +
The following were Transformed into ''E. coli'' competent cells:
 +
 
 +
* pAraC-RBS ([http://partsregistry.org/wiki/index.php?title=Part:BBa_J04451 BBa_J04451] from [http://partsregistry.org/assembly/libraries.cgi?id=19 2009 Spring Distribution])
 +
* pLacI ([[Team:Todai-Tokyo/Protocols/Miniprep|miniprep]]ped on 9/23)
 +
 
 +
<h2> Ligation + Transformation </h2>
<h2> Infusion </h2>
<h2> Infusion </h2>
<h2> Gel Purification </h2>
<h2> Gel Purification </h2>
<h2> RE Digest </h2>
<h2> RE Digest </h2>
<h2> Colony PCR </h2>
<h2> Colony PCR </h2>

Revision as of 03:16, 20 October 2009

UT.png
Home The Team The Project Parts Submitted to the Registry Modeling Notebook Protocols Ethics



Contents

Miniprep

The following were miniprepped:

  • pLacI-RFP-dterm (From Ligation on 9/4; 4 colonies)
  • RFP ([http://partsregistry.org/wiki/index.php?title=Part:BBa_J04450 BBa_J04450] from [http://partsregistry.org/assembly/libraries.cgi?id=19 2009 Spring Distribution]; 6 colonies)

PCR

The yqiT gene was PCR amplified from pLacI-yqiT-dterm (miniprepped on 9/7) using the following primers:

yqiT fwd: agcccgtgtagtactgtagagtt
yqiT rev: agggatgtttgccagtcgtaattag

using PCR program 1 and Ex-taq.

Note: This PCR reaction attaches a Biobrick prefix and suffix to the gene.


Sequencing

The following were sequenced using the labeled primers:

  • pAraC Sample 1 (miniprepped on 9/23)
    • 1) Biobrick vector fwd: atatgagagcgcgcgcagagagagatg
    • 2) Biobrick vector rev: tttttaaaagggggtgtgtgtgtaaagttt
  • pAraC Sample 2 (miniprepped on 9/23)
    • 3) Biobrick vector fwd: atatgagagcgcgcgcagagagagatg

Results:
1) Sequence read failed
2) Single-base mutation found in sequence that creates stop codon; re-do the ligation
3) Desired Sequence read

Transformation

The following were Transformed into E. coli competent cells:

  • pAraC-RBS ([http://partsregistry.org/wiki/index.php?title=Part:BBa_J04451 BBa_J04451] from [http://partsregistry.org/assembly/libraries.cgi?id=19 2009 Spring Distribution])
  • pLacI (miniprepped on 9/23)

Ligation + Transformation

Infusion

Gel Purification

RE Digest

Colony PCR

Retrieved from "http://2009.igem.org/Team:Todai-Tokyo/Protocols/Notebook_Sample"