September
01.09.09, Manu, Hannes, Christoph, Laura
*evaluation of sequencing - pMA_Shortlinker, plasmid prep from 29.08.09: sequence ok
- pEx_HisDigSplitFoka, plasmid prep from 29.08.09: sequence ok
- pEx_HisDigSplitFoki, plasmid prep from 29.08.09: sequence ok
- pEx_StrepDigSplitFoka, plasmid prep from 29.08.09: sequence ok
- pEx_StrepDigSplitFoki, plasmid prep from 29.08.09: sequence ok
- pMA_ShortlinkerFoka, plasmid prep from 29.08.09: sequence not ok, the linker short middle and long were ordered without NgoMIV restriction sites -> has to be ordered again
- pMA_ShortlinkerFoki, plasmid prep from 31.08.09: see above
- pEx_HisFluASplitFoka, plasmid prep from 29.08.09: not Foka but Foki
- pEx_HisFluASplitFoka, plasmid prep from 28.08.09: not Foka but Foki
- pEx_HisFluASplitFoki, plasmid prep from 28.08.09: sequence ok
- pEx_Strep-Dig: sequence ok
- pEx_His-Dig: sequence ok
- pMAFoka prep II from 05.08.09: sequence ok
- pMAFoka prep II from 05.08.09: sequence ok
- pMAFoki prep II from 05.08.09: sequence ok
*hybridization of M13 DNA ss and the fokcontrols in equal relations
*made SDS gels --> 4°C
*SDS gel of protein expression (pEx-His-FluA-SplitLi-Foki) from 28.08.09
![]() SDS-Gel; pExHisFluASplitFoki; Lanes: NEB prestained protein marker, t0 (before induction), t1 (1 hour after induction), t2 (2 hours after induction), t3 (3 hours after induction), t4 (4 hours after induction) |
![]() SDS-Gel; pExHisFluASplitFoki ; Lanes: NEB prestained protein marker, Elution fraction 1 (after NiNTA-column), Elution fraction 2, Elution fraction 3, Elution fraction 4, Elution fraction 5, Elution fraction 6, Elution fraction 7, Elution fraction 8, Elution faction 9 |
*made 1l buffer for AGO cleavage assay: 100mM NaCl, 10mM HEPES, 5mM MnCl2, pH 7.5
*came up with idea for new BioBrick standart that would allow making fusiun proteins via "mega primer" pcr technic with only a Threonine as a scar and thereby skipping the cloning procedure: [[Image:Freiburg 09 Superstandard.jpg|none|thumb||400x400px]] The new restriction enzyme would be AcuI, that for example has no cutting site in M13mp18 and just one in pET28 and two times in pMAL-p5X core vector
AcuI cuts 14/16 bases away from its recognition sequence end would thereby cut off the whole BB prefix and most of the BB suffix (with just AC left)
*purification of pExHisFluASplitFoki via Ni-NTA column
*inoculation of pExHisFluASplitFoki36GSlinker
*starter cultures of - pExHisDigSplitFoka
- pExStrepDigSplitFoka
in 50 ml LB and Ampicillin from plates of 31.08.09
02.09.09, Manu, Hannes, Christoph, Gerrit, Laura, Isabel
*Inoculation of expression culture - pExHisDigSplitFoka
- pExStrepDigSplitFoka
in 2 times 1 liter each at 28°C , 118rpm
-> induction of expression at OD 0,4, harvesting 4 hours later
-> centrifugation at 4000 rpm, 4°C, 20 min -> put pellets in -80°C freezer
*cleaning of Ni column with 15 ml water and 10 ml Ethanol (20%)
*plasmid preparation of pExHisFluASplitFoki36GSlinker, glycerol stocks and sequencing
*repetition of SDS gel of eluate fractions (pExHisFluASplitFoki) see picture... -> fractions 2 and 3 showed the probable Foki fusion protein and were united and dialysed
![]() SDS-Gel; pExHisFluASplitFoki ; Lanes: NEB prestained protein marker, Elution fraction 1, Elution fraction 2, Elution fraction 3, Elution fraction 4, Elution fraction 5, flow through fraction 1, flow through fraction 3, washing fraction 1 (250mM imidazole), washing fraction 3 |
*order of new short, middle and long linkers with XbaI, NgoMIV and AgeI restriction sites
*made binding, washing and elution buffer (1 liter each) again for His/Ni purification
*prepared 2 liters of dialysis buffer (30mM NaCl, 20mM Tris/HCl, pH 7,4)
*centrifugation of the expression culture (20 min, 4000 rpm, 4°C), stored pellets at -20°C
*started dialysis over night with 200 ml dialysis buffer and 3 ml protein solution (elutions 2 and 3 were combined), stiring at 4°C
Meeting
*Kristian introduced GBM, please add your data to the list if you want to join the group founded for iGEM
*Fok - the tagged Oligo's arrived during the absence of Kristian and stayed one week in his mail box at room temperature. Christoph wanted to find out, how this affects the DNA
- we should repeat the Fok cutting assay with M13 dsDNA and change the origami-programm to stop at 37°C (instead of 20°C)
- new Oligo's for the cutting assay must be ordered with a length of 60 bp
- dialyse the his-tag purified protein solution to get the right ion concentrations for a ion exchange chromatography
- with the his-tag purified and dialysed protein solution we must do some tests: freeze it, thaw it and measure the stray light(photometer)
- prepare aliquots of the protein solution
- do a purification via ion exchange chromatography (MonoQ, positive charged)
- try a first cutting assay with our construct
- confirm the Oligo-Protein-interaction with a fluorescence or absorption measurement (we have to do some research on this)
*Fok-Phage Display - we want to assemble the different parts with a PCR with overlapping primers (including the GS-linker). We should use a mix of Taq and a proof reading polymerasy and have a maximum cycle number of 20 to keep the mutations as low as possible
- order parts at Mr.Gene with iGEM restriction sites
- we must plan the PCR-primers!!!
*AGO - first try to cut single strand DNA
*book rooms in a hotel (Anika wanted get some info about the hotels)
03.09.09, Manuel, Hannes, Christoph, Gerrit, Timo
*Hybridization of M13 ssDNA with FokKontrolle 2(1:100) and 3(1:100 dil)
*Digestion of M13 ssDNA FokKontrolle(FokK)1-8; 1&2;2&3;1&3 with FokI
M13 dsDNA with FokI. made a heat inactivation of 5b (95°C 10min) and 6b without FokI
*Cutting assay checked by gel electrophoresis
|
Agarose gele of M13DNA digest with fokI: Marker(fermantas gene ruler mix), M13ssDNA+fokI, M13ssDNA fokk1+fokI, M13ssDNA fokk2+fokI, M13ssDNA fokk3+fokI, M13ssDNA fokk2/3+fokI, M13ssDNA fokk2/3+fokI(heatshocked), M13ssDNA fokk1/2+fokI, M13ssDNA fokk1/2, M13ssDNA fokk2/3+fokI(37°C), M13dsDNA fokk2/3+fokI |
Plasmid: 10 µl
water: 12.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 1 NEB KuKlabstock
Restriction_enzyme_1 : 1 µl AgeI from NEB KuKlabstock
Restriction_enzyme_2 : 2 µl PstI from NEB KuKlabstock
*Gel extraction of pEX_His_FluA_Split_Foki_36GSli (prep 02.09.09 rest4 tube3)
*Ligation of vector:pEX_His_FluA_Split_Foki_36GSli(prep 02.09.09 rest4 tube3) with insert:Foka(Gelex 17.08)
Vector: 3 µl pEX_His_FluA_Split_Foki_36GSli from 02.09.09
Insert: 6 µl Foka(Gelex 17.08)
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
*Conzentrated AGO 5x via Vivaspin to final conzentration of 3µM (2ml)
*Exchanged buffer of 900µl of Aa AGO solution via dialysis
*Started PCR procedure to create Aa AGO as an BB part via megaprimer technic
*His-Dig purification of protein expression from 02.09.09 (pExHisDigSplitFoka)
*SDS gel of His-Dig purification HisDigSplitFoka
![]() SDS-Gel; pExHisDigSplitFoka ; Lanes: NEB prestained protein marker, Elution fraction 1, Elution fraction 2, Elution fraction 3, Elution fraction 4, Elution fraction 5, Elution fraction 6, flow through fraction 1, flow through fraction 3, washing fraction 1 |
*changed dialysis buffer, again with 200 ml (10:00 o'clock)
04.09.09, Manu, Hannes, Christoph, Laura, Sarah,Timo
*Ordered additional Oligo for M13mp18 cleavage with AGO: "Oligo A4" AAGTTTTTTGGGGTCGAGGTG should allow the Aa Argonaute protein to cut the M13mp18 ssDNA behind base 100. combination with A1 (cuts at 3100) should result in two destinc bandes on the gel with a 1:2 size ratio
*AGO: over night dialysis to exchange buffer to the "AGO assaybuffer". NanoDrop: 0.575 mg/ml --> 6µM in ca. 1.2 ml buffer -> -20°C freezer
*AGO cleavage assay with M13mp18 ssDNA was roughly performed following the original RNA assay (Ma et al.):
15µl of the Aa Argonaute protein in the "Ago assay buffer" were incubated 30 minutes with 1µl of 100µM of the guideoligo A1 (ACAACCATCGCCCACGCATAA)at 55°C
Then 20µl of M13mp18 ssDNA (248ng/µl)was added and incubated for 30 minutes at 55°C
One half of the solvent was treated with proteinase K solution, the other was untreated added to the agarose gele --> we obtained 2 bands which might be the circular M13 DNA and the linear M13 DNA
|
Agarose gele of AGO M13 digest; Lanes: Marker:1kb ladder, AGO M13 digest, AGO M13 digest treated with Proteinase K, untreated M13 ssDNA |
Next week we will do another assay with two guide oligos (A1 and A4) that should result in two distinct bands and thereby allow as to exclude the possibility that the bandeshift is due to AGO bound to the targed ssDNA
*AGO PCR to craeat an Aa AGO BB part failed and will be repeated on Monday
06.09.09, Hannes
*Inoculation of: - BL21de3 pEx-StrepDigSplitFoka
- BL21de3 pEx-HisDigSplitFoka
- pEx-HisFluASplitFoki-36GS-Foka
07.09.09, Laura, Manu, Gerrit, Christoph, Isabel, Anika
*Prepared LB Medium (10l)
*Purification via Strep-Tactin column of Strep-Dig-Split-Foka
*SDS Gel with eluate fractions E1 til E7 and washfractions W2 til W3 and NEB prestained proteinmarker ---> see picture result: no fusioned protein StrepDigSplitFoka eluated
*Plamidpreparation of pEx His-FluA-Split-Foki-36GSLi-Foka, glycerol stocks and sequencing
*Glycerol stocks of pEx-Strep-Dig-Split-Foka and pEx-His-Dig-Split-Foka
*Cutting experiments and analytical agarose gel of digested M13 DNA hybridized with Fok control 1 and 2, pure oligos 1 and 2, pure ds and ss M13 DNA, 1kb ladder [[Image:2009-09-07_M13_2.Bild.jpg |none|thumb|Analytical Agarose Gel of M13 Digest; Lanes: Marker:100bp ladder, Fok Control Oligo 1, Fok Control Oligo 2, M13 ssDNA Hybridized with Fok Control 1 and 2, M13 ssDNA Hybridized with Fok Control 1 and 2, ds and ss M13 DNA|400x400px]]
*Starter culture of pEx-His-Flua-Split-Foki(amp plate of 25.08.09)in BL21DE3 (200 ml LB + amp)
*Hybridisation of long, middle and short linker
*pEx His-FluA-Split-Foki-36GSLi-Foka is now called FokM [http://www.molbiotech.uni-freiburg.de/iGEM/wiki2009/index.php/Fok_monomer Sequenz]
*Transformation of FokM into BL21 de3 gold
08.09.09, Manu, Gerrit, Christoph, Sarah, Anika, Hannes, Laura, Isabel, Julia
*made LB Agar
*poured amp plates (3 plates left)
*ligation of short, middle and long linker (hybridized at 07.09.09) and pMA vector (gelex from 27.08.09)
*ligation of short, middle and long linker (hybridized at 07.09.09) and pMA_Foki (gelex from 28.08.09) and pMA_Foka (gelex from 27.08.09)
*made SDS gel of collected pellets (T0-3) from expression of StrepDigSplitFoka and HisDigSplitFoka aim: to see if induction of expression of fusioned protein was successful
![]() SDS-Gel; pExHisDigSplitFoka ; Lanes: NEB prestained protein marker, expression fraction T0, T1, T2, T3, T1, T2, T3 |
![]() SDS-Gel; pExStrepDigSplitFoka ; Lanes: NEB prestained protein marker, expression fraction T0, T1, T2, T3, T1, T2, T3 |
*Stripping of Ni-NTA column
*made starter culture (300ml LB+Amp+1%Glucose) with pEXHisDigSplitFoki in BL21de3
*Made gradient PCR (+-5 in first 10 cycles; +-2.5 in last 14 cycles) to generate BB Aa AGO part. Therefor optimised pcr protocoll and made an additional approach using DMSO
09.09.09, Gerrit, Christoph, Sarah, Isabel, Anika, Hannes, Laura, Max, Julia, Dieter
*expression of pExHisFluASplitFoki in 6 times 1 ml LB and Amp - pellets were taken at T0 (time of induction with IPTG), T1, T2, T3, T4
- at the end culture was centrifuged down at 4000rpm, 20 min, 4°C
- pellets frozen in -80° C
* Repetition of AGO cleavage assay, using oligos A1 and/or A4 to determine whether bandshift was due to AGO bound to the DNA or cleavege of the ssDNA target--> Agarose gel revealed several promising bands (see picture). Results have to be dicussed yet.
* test digestion of FokM shows that vector and insert are to small
* test expression of FokM aborted
* new cloning of FokM has to be done tomorrow
*new measurement of concentration of HisFluASplitFoki (dialysed at 03.09.09)
*Agarosegel of yesterdays gradient PCR again showed none of the expected bands.
|
|
* Therefore a new PCR was started using the original optimised PCR protocol (first annealing temperature 55°C, second 65°C) using the sample "Aa AGO in pET28a 27.08.09 2" as a template
*measurement of fluorescence of FluA marked oligo, protein, and oligo and protein (quenching)
*inoculation of short, middle and long linker in pMA, pMAFoki and pMAFoka
10.09.09, Manu, Hannes, Christoph, Timo, Gerrit
*His-tag purification with Ni-NTA column of expression products from yesterday (09.09.09)- HisFluASplitFoki
*Glycerin Stocks of: pMA short linker 1,2 + Fok a/i 1,2 from 09.09.09
pMA middle linker 4,5 + Fok a/i 4,5 from 09.09.09
pMA long linker 1,2 + Fok a/i 1,2 from 09.09.09
*Pellets of: pMA short linker 3,4,5,6 + Fok a/i 3,4,5,6 from 09.09.09
pMA middle linker 1,2,3,6 + Fok a/i 1,2,3,6 from 09.09.09
pMA long linker 3,4,5,6 + Fok a/i 3,4,5,6 from 09.09.09
*digestion of pEX_His_fluA_Split_Foki of 26.08.09 with NgoMIV and PstI
*digestion of pMA_36GSlinker of 28.08.09 AgeI and PstI
*gelextraction of vector and insert
*quick ligation of pEX_His_FluA_Split_FokI and 36GSLi
*transformation of pEX_His_FluA_Split_FokI+36GSLi into RV308
*plasmid preparation of pMA short linker, pMA middle linker, pMA long linker
*plasmid preparation of pEX-short/middle/long-Linker-Fok(active/inactive)
*digestion of pEX-short/middle/long-Linker-Fok(active/inactive) with NgoMIV and PstI, over night at 37°C '''Nanodrop-Data:'''
| Sample ID | User ID | Date | Time | ng/ul | A260 | A280 | 260/280 | 260/230 | Constant |
| pMA-Short_Linker 1 | FreiGEM | 10.09.2009 | 12:38 | 140,47 | 2,809 | 1,461 | 1,92 | 2,12 | 50 |
| pMA-Short_Linker 2 | FreiGEM | 10.09.2009 | 12:39 | 117,82 | 2,356 | 1,234 | 1,91 | 1,99 | 50 |
| pMA-Long_Linker 1 | FreiGEM | 10.09.2009 | 12:40 | 131,21 | 2,624 | 1,349 | 1,94 | 2,18 | 50 |
| pMA-Long_Linker 2 | FreiGEM | 10.09.2009 | 12:40 | 158,86 | 3,177 | 1,668 | 1,9 | 1,85 | 50 |
| pMA-Middle_Linker 1 | FreiGEM | 10.09.2009 | 12:41 | 197,16 | 3,943 | 2,059 | 1,92 | 2,06 | 50 |
| pMA-Middle_Linker 2 | FreiGEM | 10.09.2009 | 12:42 | 137,14 | 2,743 | 1,427 | 1,92 | 2,19 | 50 |
| pMA-Long_Linker-Foka 1 | FreiGEM | 10.09.2009 | 12:43 | 173,32 | 3,466 | 1,8 | 1,93 | 2,25 | 50 |
| pMA-Long_Linker-Foka 2 | FreiGEM | 10.09.2009 | 12:44 | 151,38 | 3,028 | 1,571 | 1,93 | 2,24 | 50 |
| pMA-Long_Linker-Foki 1 | FreiGEM | 10.09.2009 | 12:44 | 156 | 3,12 | 1,639 | 1,9 | 2,21 | 50 |
| pMA-Long_Linker-Foki 2 | FreiGEM | 10.09.2009 | 12:45 | 167,47 | 3,349 | 1,735 | 1,93 | 2,22 | 50 |
| pMA-Short_Linker-Foki 1 | FreiGEM | 10.09.2009 | 12:45 | 160,29 | 3,206 | 1,68 | 1,91 | 2,21 | 50 |
| pMA-Short_Linker-Foki 2 | FreiGEM | 10.09.2009 | 12:46 | 159,35 | 3,187 | 1,648 | 1,93 | 2,23 | 50 |
| pMA-Short_Linker-Foka 1 | FreiGEM | 10.09.2009 | 12:47 | 207,54 | 4,151 | 2,191 | 1,89 | 2,21 | 50 |
| pMA-Short_Linker-Foka 2 | FreiGEM | 10.09.2009 | 12:47 | 200,95 | 4,019 | 2,107 | 1,91 | 2,21 | 50 |
| pMA-Middle_Linker-Foki 1 | FreiGEM | 10.09.2009 | 12:48 | 185,79 | 3,716 | 1,939 | 1,92 | 2,22 | 50 |
| pMA-Middle_Linker-Foki 2 | FreiGEM | 10.09.2009 | 12:49 | 180,42 | 3,608 | 1,865 | 1,93 | 2,22 | 50 |
| pMA-Middle_Linker-Foka 1 | FreiGEM | 10.09.2009 | 12:50 | 196,37 | 3,927 | 1,997 | 1,97 | 2,19 | 50 |
| pMA-Middle_Linker-Foka 2 | FreiGEM | 10.09.2009 | 12:50 | 180,62 | 3,612 | 1,895 | 1,91 | 2,25 | 50 |
| NgoMIV_36GSLi_PstI | FreiGEM | 10.09.2009 | 15:40 | 1,72 | 0,034 | 0 | -336,01 | 0,01 | 50 |
| pEX_His_FluA-Split_FokI_AgeI_PstI | FreiGEM | 10.09.2009 | 15:41 | 0,52 | 0,01 | -0,017 | -0,6 | 0 | 50 |
11.09.09, Manu, Hannes, Christoph, Laura, Anika
*labtalk
*SDS gel of protein purification from yesterday (10.09.09) HisFluASplitFoki
![]() SDS-Gel; pExHisFluASplitFoki ; Lanes: NEB prestained protein marker, elution fractions E1-5, W1-2, D2-3 |
![]() SDS-Gel; pExHisFluASplitFoki ; Lanes: NEB prestained protein marker, expression fraction T0, T1, T2, T4, T5 |
![]() NEB prestained protein marker broad range |
*concentrations of eluate fractions 1-4 weren't measureable at photometer and nanodrop (weird spectra)
*Eluate fractions 1-4 were frozen at -80°C
*Checking of the plates pEX_His_FluA_Split_Foki_36GsLi RV308 (Trafo of 10.09.09) showed none Bacteriagrowth, perhaps problems with the GelEX
*gelextraction of NgoMIV-Short/Middle/LongLinker-FokA-PstI (the Fok(inactive) digests didn't work: no bands on the gel)
14.09.09, Gerrit, Manu, Laura, Anika, Isabel, Timo
*fetched a new QuickLigase-Kit at the NEB-Freezer
*aliquoted the QuickLigase Buffer to 20 µl aliquots
*Ligation of vector:pEX_His_FluA (gelex from 20.08.09) with insert: Short/Middle/Long-Linker-Foka(Gelex from 11.09.09)
Vector: 3 µl pEX_His_FluA from 20.08.09 (digested with AgeI and PstI)
Insert: 6 µl Short/Middle/Long-Linker(Gelex from 11.09.09, digested with NgoMIV and PstI)
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
*Ligation of vector:pEX_His_Dig (gelex from 27.08.09) with insert: Short/Middle/Long-Linker-Foka(Gelex from 11.09.09)
Vector: 3 µl pEX_His_FluA from 27.08.09 (digested with AgeI and PstI)
Insert: 6 µl Short/Middle/Long-Linker(Gelex from 11.09.09, digested with NgoMIV and PstI)
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
*Ligation of vector:pEX_Strep_Dig (gelex from 27.08.09) with insert: Short/Middle/Long-Linker-Foka(Gelex from 11.09.09)
Vector: 3 µl pEX_His_FluA from 27.08.09 (digested with AgeI and PstI)
Insert: 6 µl Short/Middle/Long-Linker(Gelex from 11.09.09, digested with NgoMIV and PstI)
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
*Ligation of vector:pMA_Foki (gelex from 27.08.09) with insert: Short/Middle/Long-Linker(hybridized 07.09.09)
Vector: 3 µl pMA_Foki (digested with XbaI and NgoMIV)
Insert: 6 µl Short/Middle/Long-Linker(cutting sites: NgoMIV and PstI)
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
*transformation of pEx-His-FluA-Short/Middle/LongLinker-Fok(active) into RV308
*transformation of pEx-His-Dig-Short/Middle/LongLinker-Fok(active) into RV308
*transformation of pEx-Strep-Dig-Short/Middle/LongLinker-Fok(active) into RV308
*transformation of pMA-Short/Middle/LongLinker-Fok(inactive) into RV308
*prepared SDS gels
*Digest of pMA_Foki(prep I 05.08.09) with XbaI and NgoMIV
Plasmid: 10 µl
water: 14.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 4 igem stock
Restriction_enzyme_1 : 1 µl XbaI from NEB KuKlabstock
Restriction_enzyme_2 : 1 µl NgoMIV from NEB KuKlabstock
-> preparative gel, freezed gel slice in case ligation won't work again
*test-digest of pMA_short/middle/longlinker_Foka/i(prep 10.09.09) with FokI
Plasmid: 4 µl
buffer: 0.5 µl buffer 4 igem stock
Restriction_enzyme_1 : 0.5 µl FokI from igem stock
|
Analytical agarose-Gel; Lanes: NEB 100 bp DNA ladder, pMAShortliFoka, pMAMiddleliFoka, pMALongliFoka, pMAShortliFoki, pMAMiddleliFoki, pMALongliFoki, |
*ordering of fluorscin marked oligos
*preparation of competent cells: RV308, there is no antibiotic in the approach because this bacterial strain has no resistance(on shaker in 37°C romm over night until tomorrow)
*planning of Fos_bZip with freigem restricion sites
* Sequencing of - pMAShortlinker clone 1 plasmid prep of 10.09
- pMAmiddellinker clone 2(4) plasmid prep of 10.09
- pMAlonglinker clone 1 plasmid prep of 10.09
- pMAShortlinker+FokA clone 2 plasmid prep of 10.09
- pMAShortlinker+FokI clone 2 plasmid prep of 10.09
- pMAmiddellinker+FokA clone 4(2) plasmid prep of 10.09
- pMAmiddellinker+FokI clone 4 plasmid prep of 10.09
- pMAlonglinker+FokI clone 1 plasmid prep of 10.09
- pMAlonglinker+FokA clone 1 plasmid prep of 10.09
* digest with HaeII (+76, NEB IV, BSA) of 28 minipreps Plasmid: 5 µl
water: 3,6 µl
BSA: 0.1 µl (100x)from iGEM stock
buffer NEB IV: 1 µl buffer (10x)from iGEM stock
Restriction_enzyme_1 : 0,3 µl HaeII
*preparative gel (1%) Marker 1kb; -Eco 86/88; -Eco 86/89; TTT 86/88; TTT 86/89; Taq 86/88; Taq 86/89 Marker 1kb; -Eco 87/88; -Eco 87/89; TTT 87/88; TTT 87/89; Taq 87/88
*gel extraction of (kit from Janina) Taq 86/88, Taq 86/89, Taq 87/88, Taq 87/89 in 50 µl 70°C water
*analytic gel (1%) Marker 1kb; samples 442-1, 442-2, 442-3; samples 443-1, 443-2, 443-3; 427-1 to -12; 424-1 to -12; Taq 87/89
*transformation of EcoRI-removal ligation TorA-flag and DsbA-flag, vector control
* Inoculation of: - startingculture His+Dig+Split+FokA (from 31.08.09) 200ml LB+200µl Amp + 2g glucose --> 24°C 180rpm
15.09.09, Manu, Hannes, Gerrit, Anika, Sarah, Laura
*over-night culture of pEX-His-Dig-Split-Fok(active) showed an OD(600) of 0,132. No expression was started.
*the LB/Amp plates of pEx-His/Strep-Flua/Dig-Short/Middle/LongLinker-Fok(active) show only few colonies. One construct is completly missing (pEx-His-Dig-ShortLinker-Fok(active)).
*the LB/Amp plates of pMA-Short/Middle/LongLinker-Fok(inactive) showed many colonies.
* Plamidpreparation of RV308 pMA_36GSLi Klon3/4(plate from 27.08.09), glycerol stocks and sequencing
* continued phage display: digestion of 442-1 of 14.09.09 with XmnI and NheI
Plasmid: 20 µl
water: 3,7 µl
BSA: 0.3 µl (100x)from iGEM stock
buffer NEB IV: 3 µl buffer (10x)from iGEM stock
Restriction_enzyme_1 : 1,5 µl XmnI from NEB KuKlabstock
Restriction_enzyme_2 : 1,5 µl NheI from NEB KuKlabstock
digestion of 443-1 of 14.09.09 with XmnI and NheI
Plasmid: 18 µl
water: 5,7 µl
BSA: 0.3 µl (100x)from iGEM stock
buffer NEB IV: 3 µl buffer (10x)from iGEM stock
Restriction_enzyme_1 : 1,5 µl XmnI from NEB KuKlabstock
Restriction_enzyme_2 : 1,5 µl NheI from NEB KuKlabstock
finished transformation of 436;423-427 and V/1;V/6;V/411;V/375
*chemical competent cells of RV308
*glycerol stock of RV308
*preparation of electrical competent cells: RV308, there is no antibiotic in the approach because this bacterial strain has no resistance(on shaker in 37°C romm over night until tomorrow)
*simulated Hybridization of M13 DNA - hybridization with Fok control 2 & 3 oligos
- 10µl M12 ssDNA
- 10µl MgCl from iGEm Stock
- 5µl Tris-HCl
- 2µl Fok-Kontrolle 2 (org. Tube from 28.07.09)
- 2µl Fok-Kontrolle 3 (org tube from 06.08.09)
* Testdigest with FokI with:
10µl M13DNA+Oligo2+3
1,2µl Puffer4
1µl FokI
Gel:
Marker / ssDNA+Oligo2+3+Fok / ssDNA+Oligo2+3+Fok / ssDNA+Oligo2+3 37° / ssDNA+ Oligo2+3 4°
BILD
*ordered His_GSG_Fos_bZip
16.09.09,Gerrit, Anika, Sarah, Laura, Isabel
*made plasmid preparation of pEX-Strep-Dig-middleLinker-FokA clone 1 and clone 2
pEX-Strep-Dig-shortLinker-FokA clone 1 and clone 2
pEX-His-Dig-middleLinker-FokA clone 1 and clone 2
pEX-His-FluA-shortLinker-FokA clone 1 and clone 2
pEX-His-FluA-middleLinker-FokA clone 1 and clone 2
pMA-shortLinker-FokI clone 1 and clone 2
pMA-middleLinker-FokI clone 1 and clone 2
pMA-longLinker-FokI clone 1 and clone 2
glycerol stocks stored in "iGEM AA" at -80°C
*continued phage display - plasmid preparation of:
444-1,444-2,444-3;445-1,445-2,445-3;443-1;442-1
- sequencing of 444-1 and 445-1 with primer:sfLacP1
- digest of 444-1 and 445-1 with SfiI and NheI
'''444-1'''
Plasmid: 19 µl
water: 5 µl
BSA: 0.3 µl (100x)from iGEM stock
buffer NEB IV: 3 µl buffer (10x)from iGEM stock
Restriction_enzyme_1 : 1,5 µl SfiI from NEB KuKlabstock
Restriction_enzyme_2 : 1,5 µl NheI from NEB KuKlabstock
'''445-1'''
Plasmid: 15 µl
water: 9 µl
BSA: 0.3 µl (100x)from iGEM stock
buffer NEB IV: 3 µl buffer (10x)from iGEM stock
Restriction_enzyme_1 : 1,5 µl SfiI from NEB KuKlabstock
Restriction_enzyme_2 : 1,5 µl NheI from NEB KuKlabstock
- preparative gel (1%)of digest of 442-1 and 443-1, 440-5
*expression cultures (4 flasks à 1l) of HisDigSplitFoka - took pellets at T0-T4
- centrifuged at 4000 rpm, 4°C, 20 min
- froozen pellets in -80°C
*made 5l LB medium
* electrical competent cells of RV308, stored in box at -80°C
17.09.09,Hannes, Anika, Sarah, Laura, Isabel, Timo, Manuel
*Digest of pEX_His_FluA (prep 20.08.09 clone), pExHisDig (prep 27.08.09, clone 1) and pExStrepDig (prep 27.08.09, clone 1) with AgeI and SpeI
Plasmid: 10 µl
water: 14.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 4 NEB iGEM stock
Restriction_enzyme_1 : 2 µl AgeI from NEB KuKlabstock
Restriction_enzyme_2 : 1 µl SpeI from NEB KuKlabstock
*Digest of pMA_Shortli_Foki (prep 10.09.09 clone 2), pMA_Middleli_Foki (prep 10.09.09 clone 4) and pMA_Longli_Foki (prep 10.09.09 clone 1) with NgoMIV and SpeI
Plasmid: 10 µl
water: 14.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 4 NEB iGEM stock
Restriction_enzyme_1 : 1 µl NgoMIV from NEB KuKlabstock
Restriction_enzyme_2 : 1 µl SpeI from NEB KuKlabstock
-> stored in -20°C
*preparation of binding buffer, washing buffer I and II and elution buffer for the ni-column
*purification of the expression cultures of 16.09.09 HisDigSplitFoka (ni-column)
*'''continued the phage display:'''
*preparation of 425-1 to 425-10; 428-1 to 428-10; 423-1,424-1,426-1,427-1,429-1,436-1
*test digest of all 425 and 428 probes with HaeII
DNA: 5 µl
water: 3,7 µl
BSA: 0.1 µl NEB iGEM stock
buffer: 1 µl buffer 4 NEB iGEM stock
Restriction_enzyme : 0,2 µl HaeII from NEB KuKlabstock
*dephosphorylation of the vector fragments 444 and 445 with SAP to stop the digest (2x1µl for 30min 37°C and 1X20min 70°C)
*preparative gel of the vector fragments pJs#375(digest and re-digest), 444 and 445 and gel extraction
18.09.09 Isabel, Sarah, Laura, Manu, Timo, Hannes, Anika
'''*continued phage display'''
*sequencing of 423,424,426,427,429,436
*analytical gel of test digests of 425 (1-10) and 428 (1-10) and sequencing of
*ligation of V/444, V7445 and V/375 re-digest with 3 approaches: '''1)''' 1µl vector
5µl insert 10
1µl ligase buffer
1µl T4 ligase
2µl water
'''2)''' 1µl vector
5µl insert 11
1µl ligase buffer
1µl T4 ligase
2µl water
'''3)''' 1µl vector
1µl ligase buffer
1µl T4 ligase
7µl water
19.09.09 Julia
*Put plates from 37°C and digestion from 37°C room to the cooling room at 4°C
*Centrifuged 427-1; 424-1 down and froze the pellet at -20°C
21.09.09 Laura, Gerrit, Isabel, Sarah, Hannes, Anika, Julia
*continued phage display -plasmidpreparation of 424-1,424-2,424-3 and 427-1,427-2,427-3
-digestion of 424-1 with XmnI and NheI (37°C) for 6h
DNA: 58µl
buffer IV:11µl
BSA:1,1µl
enzyme_1: 1,5µl
enzyme_2: 1,5µl
-new digest of 444-1 and 445-1 with SfiI (50°C)for 6h and then with NheI (37°C over night)
'''444-1''' DNA: 19µl
buffer IV:3µl
BSA:0,3µl
water:4,7µl
enzyme_1: 1,5µl
enzyme_2: 1,5µl
'''445-1''' DNA: 15µl
buffer IV:3µl
BSA:0,3µl
water:8,7µl
enzyme_1: 1,5µl
enzyme_2: 1,5µl
-ligation of digests of 444-1,445-1 and 375(re-digest)
*SDS gel of HisDigSplitFoka
![]() SDS-Gel; HisDigSplitFoka; Lanes: NEB prestained protein markerbroad range, elution fraction 1-9 |
![]() SDS-Gel; HisDigSplitFoka; Lanes: NEB prestained protein markerbroad range, t0 (before induction), t1 (1 hour after induction), t2 (2 hours after induction), t3 (3 hours after induction), t4 (4 hours after induction), flow through fraction 1, flow through fraction 3, washing fraction 1, washing fraction 3 |
![]() NEB prestained protein marker broad range |
* Transformation with chemical and electro competent cells(RV 308):
- did not work with chemical competent cells
- but worked with electro competent cells, absorption wavelength 400 nm (like CFP)
(pictures coming soon, not finished jet)
*Gel extraction with GelEx Kit from Quiagen: pEX-StrepDig, pEX-HisFluA, pEX-HisDig, short-linker Foki, middle-linker Foki, long-linker Foki
*Ligation with QuickLigase: -short-linker Foki +pEx-HisDig/+pEX-HisFluA/+pEX-StrepDig -middle-linker Foki +pEx-HisDig/+pEX-HisFluA/+pExStrepDig -long-linker Foki +pEx-HisDig/+pEX-HisFluA/+pEX-StrepDig
*Transformation of Ligations with 100µl RV competent cells, 37°C room over night
*sorting of right and wrong sequenced parts and parts which need subsequent cloning into a different vector
*lab talk (Kristian, Tobias, Sven, Gerrit, Laura) - DsbA-signalsequence for the exprot into the periplasma will be cloned to the Foka completed parts
- in vivo experiment of e.colis cotransformated with Foka and Foki completed plasmids, elektroporated, transformated with M13 DNA ss with hybridized oligos, fluroescent oligos and without oligos
-> plaque essay will show efficency of Fok
- in vitro essay will be done with Fos fusioned to Foka, JUN fusioned to GFP and Foki added to experiment
22.09.09 Gerrit, Isabel, Sarah, Max, Hannes, Caro, Timo, Julia, Laura
*continued phage display:'''
*plasmid prep of pEX His Dig Rest Klone 6 pellet
*digest of pEX His Dig plasmid prep of 22.09 with ageI and pstI
*digest of pEX Strep Dig plsamidprep of 27.08 with ageI and pstI
*digest of pEXHis FluA Split Foki 27.08 with xbaI and pstI , for rechieving a pEX vector
*gel extraction of the digests
|
1: pMA-Strep-Dig, 2: pEX-Strep-Dig |
*Quick ligation of pEXvector+HisFluA(gel Ex of 6.08.09) ; pEXHisDig+middle linker Foka(gel EX 11.09), pEXStrepDig+middle linker Foka(gel EX 11.09) ,pEXStrepDig+short linker Foka(gel EX 11.09)
*Transformation of the different constructs into RV308 bacteria
*finishing of list of sequenced parts -> in folder SOPS
23.09.09 Gerrit, Julia, Laura, Anika, Isabel
'''Periplasma-project'''*Transformation of plasmid vectors in XL1blue competent cells: Tt-; Aa in pet 28a; pet 39b
*poured plates with Kan and Tet, 14 plates left in 4°c room
*put in 37°c room over night
*Digest of pMAStrep (prep of 09.07.09), pMAStrepFluA (prep of 06.08.09), pMAStrepDig (prep of 24.08.09) and pExStrepDig (prep of 27.08.09) with NgoMIV
purpose: to get rid of snd NgoMIV restriction site Plasmid: 10 µl
water: 16.5 µl
buffer: 3 µl buffer 4 NEB iGEM stock
Restriction_enzyme_1 : 1 µl NgoMIVI from NEB KuKlabstock
*preparative gel and gel extraction
|
1: pMA-Strep-Dig, 2: pEX-Strep-Dig |
|
1: pMA-Strep, 2: pMA-Strep-FluA |
*ligation and transformation
* phage display - pelleted newly grown vector constructs (AGO)
24.09.09 Gerrit, Julia, Laura, Hannes, Caro
*plasmid preparation of - pExHisDigMiddleliFoka
- pExStrepDigMiddleliFoka
- pExStrepDigShortliFoka
- pExHisFluA
-> glycerolstocks in new glycerolstocks in -80°C, pellets in -20°C in pellet box
*SDS-gel of eluate, flow through and wash fractions of expressed and purified HisDigSplitFoka from 17.09.09
*Western Blot of HisDigSplitFoka SDS Gel, incubated with anti His-Tag antibodies --> no ECL signal
*repetition of M13 ssDNA digest with oligos "Fokkontolle 2+3" and FokI --> didn't work
*digest of pExHisFluASplitFoki (clon 2, 26.08.09) and pExStrepDigSplitFoka (clon 1, 29.08.09) purpose: to ligate these parts in order to get a construct for the in vivo assay Plasmid: 10 µl pExHisFluASplitFoki
water: 14.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 2 NEB iGEM stock
Restriction_enzyme_1 : 2 µl PstI from NEB KuKlabstock
Restriction_enzyme_2 : 1 µl SpeI from NEB KuKlabstock
Plasmid: 10 µl pExStrepDigSplitFoka
water: 14.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 3 NEB iGEM stock
Restriction_enzyme_1 : 1 µl PstI from NEB KuKlabstock
*preparative gel
|
Agarose-gel ; Lanes: NEB 1kb DNA ladder, pExHisFluASplitFoki, pExStrepDigSplitFoka |
* inoculation
- pEX Strep+Dig+Split+FokA 10ml LB+Amp
- pEX_His+Dig+Split+FokA 10ml LB+Amp
- pEX Strep+Dig 5ml LB+Amp
- pMA_Strep+Dig 5ml LB+Amp
- pMA_Strep 5ml LB+Amp
- pMA_Strep+FluA 5ml LB+Amp
|
1: pEX-Strep-Dig-LL-Foki, 3: pEX-His-FluA-LL-Foki, 5: pEX-His-Dig-LL-Foki, 7:pEX-His-Dig-ML-Foki |
* Periplasma Project
*1) Inoculation - Pet39bXLblue in 100ml LB + 100µl KAN + 100µl TET
- aa in pet28aXL1blue in 100µl KAN + 100µl TET
- Tt- XL1blue in 100µl KAN + 100µl TET
- Incubation (37°C) for 6 hours
*2)Transformation --> XL1 blue pBadRDF
-Plasmid DNA 0,6µl -cells 40 µl -100 µl and rest platet out on AMP/Tet Plats
* 3)Miniprep - pJS419 - pJS418 - Concentrations determined with Nanodrop
*3) Testdigest 2:pEX Strep Dig split FokA
-digested with: XbaI and NgoniV
n: Fermentas GeneRuler DNA Ladder Mix |400x400px]] -To 1) DNA 22,97 [µl]
NEB4 3,0[µl]
XbaI 1,5[µl]
NganIV 1,5[µl]
BSA 0,5[µl]
H20 0,53[µl]
- To 2) DNA 21,97 [µl]
NEB4 3,0[µl]
XbaI 1,5[µl]
NganIV 1,5[µl]
BSA 0,5[µl]
H20 2,25[µl]
- Purification: 0,8% Agarosegel
- Quigen Gelex SpinKit
25.09.09 Gerrit,Laura,Hannes,Isabel,Max,Anika,Caro, Timo
*Periplasma Project 1) Ligation with Quick Ligase from NEB
- 2fold Quick Ligase Buffer 10µl
- DNA ( Insert(0,5µl)+Vector(9µl))
- Ligase 1µl
-10 min Ligation at RT
2) Miniprep
pEX His Dig Split FokA
pEX Strep Dig Split FokA
Nanodrop Data [[Image:Freiburg_09 Nanodrop 25-9.jpg |none|thumb|The two last lines only|400x400px]]
Stored: Plasmidbox in freezer
* Amp preparation, -20°C
* Plasmidprep
- pEXStrep+Dig Clone 1+2 (Tube 1+2)
- pMA_Strep+Dig Clone 1+2 (Tube 3+4)
- pMA_Strep Clone 1+2 (Tube 5+6)
- pMA_Step+FluA Clone 1+2 (Tube 7+8)
--> -80°C
* pellets of:
- pEX_Strep+Dig Clone 3+4 (Tube 9+10)
- pMA_Strep+Dig Clone 3+4 (Tube 11+12)
- pMA_Strep Clone 3+4 (Tube 13+14)
- pMA_Step+FluA Clone 3+4 (Tube 15+16)
--> -20°C
* Transformation of
pEX_His+FluA+Split+Foki+Strep+Dig+Dig+Split+FokA into RV308 and XBL
* phage display - error prone PCR
water: 29,3µl
DNA: 1,8µl
buffer: 5µl (10x, without MgCl2)
primers (87/88 or 87/89): 1,5µl each
dNTPs: 1,5µl (10mM each)
Taq: 1µl
MgCl2: 12µl (25mM)
MnCl2: 5µl (5mM)
26.09.09 Caro
* Inoculation - 4 clones respectively of:
-pEX His dig ML FokA
-pEX Strep Dig SL FokA
-pEX His FluA
-pEX Strep Dig ML FokA
-pEX His FluA Split Foki Strep Dig Split FokA aus RV308
-pEX His FluA Split Foki Strep Dig Split FokA aus XL
- Medium:
- 200 ml LB
- 2g Glucose (sterile filtered)
- 200 µl AMP
* new DsbA SS insertion in front of FokA constructs
- 3 h digestion of pEX_His_Dig_Split_FokA (prep 25.9.) & pEX_Strep_Dig_Split_FokA using 1.5 µL XbaI, NgoMIV in 30 µL final
- 0.8 % agarose gel
- GelEx, 30 µL elution
- Quickligation using 1:3 ratio, 10'
- transformed XL1 & BL21 chemically using 10 µL ligation rx. (low conc.) & 50 µL cells
27.09.09 Anika, Hannes
* Miniprep [[Image:Freiburg09_270909_Minipreps.jpg|none|thumb||600x600px]]
* test digest of DsbA ss insertion - 800 ng DNA, 0.5 µL AvaI & XbaI, 15 µL total, 30'
- 2 % high-res agarose gel, 100 bp ladder (expected: 237 bp for His, 242 bp for Strep, failure = 184 bp)
* all new DsbA insertion transformations successful, control plate empty --> o/n cultures in LB (Glu, Amp), 4 each (DsbA_His_Dig_Split_FokA & DsbA_Strep_Dig_Split_FokA, XL1 & BL21)
*Inoculation of starter culture for expression -pExHisFluASplitFoki in BL21de3 (300ml LB Amp, 1% glucose)
--> 26°C
*inoculation of -pEx_DsbAss_HisDigSplitFoka in XL1
-pEx_DsbAss_StrepDigSplitFoka in XL1
-pEx_DsbAss_HisDigSplitFoka in BL21
-pEx_DsbAss_StrepDigSplitFoka in BL21
in 5ml LB Amp, 1% glucose
28.09.09 Isabel, Sarah, Gerrit, Anika, Hannes, Timo, Caro, Max
*plasmid preparation of pEX_DsbAss-His-Dig-Split-FokA (clone 1-5) and pEX-DsbAss-Strep-Dig-Split-FokA (clone 1-5)
*continued phage display - plasmid preparation of pJs#440
- error prone PCR
water: 21,75µl
template: 1,5µl
primers (87/88 or 87/89): 1,5µl (10µM) each
dNTPs: 1,5µl (10mM each)
Taq: 1µl
buffer(10x): 5µl
MnCl2: 5µl (5mM)
MgCl2: 12µl (25mM)
-> 4 samples of 87/88 and 87/89 each
water: 26µl
pcr-product ("template"): 2µl
primers (87/88 or 87/89): 1,5µl each
dNTPs: 1,5µl (10mM each)
Taq: 1µl
buffer: 5µl
MnCl2: 2,5µl
MgCl2: 9µl
-> 4 samples of 87/88 and 87/89 each
*transformation of pEx_HisFluASplitFoki in BL21de3
*inoculation of -pEx_HisDigSplitFoka in XL1blue (?)
-pEx_StrepDigSplitFoka in XL1blue (?)
29.09.09 Gerrit, Anika, Hannes, Caro, Laura, Christoph, Max
*Identified the mutation that was revealed by the latest sequencing: All plasmids bared a mutation that led to an exchange in amino acid sequence: 371 L->S. The aa 371 (indicated in pink on the right) is part of an peripheral alpha helix in the mid-domain of the argonaute protein and has no contacts to aa outside of the alpha helix and should the thereby not have major influence of the structure or function of the protein. [[Image:Freiburg 09 Mutation in AGO.png|none|thumb||600x600px]]
*because the ligation pExHisFluASplitFoki_StrepDigSplitFoka didn't work a new digest of pExHisFluASplitFoki and pExStrepDigSplitFoka was done: Plasmid: 10 µl pExHisFluASplitFoki, clone 1 (100µl) from 26.08.09
water: 14.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 2 NEB iGEM stock
Restriction_enzyme_1 : 2 µl PstI from NEB KuKlabstock
Restriction_enzyme_2 : 1 µl SpeI from NEB KuKlabstock
Plasmid: 10 µl pExStrepDigSplitFoka, clone from 29.08.09
water: 14.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 3 NEB iGEM stock
Restriction_enzyme_1 : 2 µl XbaI from NEB KuKlabstock
Restriction_enzyme_2 : 1 µl PstI from NEB KuKlabstock
->put in 37°C for 2h
*dephosphorylation of vector pExHisFluASplitFoki by SAP DNA: 30µl
SAP: 0,5µl
SAP buffer: 3,5µl
water: 1µl
- 37°C for 30min
- 70°C for 20min
- PCR purification Kit (normally direct digest would have been sufficient
*preparative gel of digest to gain vector and insert
|
1: pEx-HisA-FluA-splitli-Fok_i, 2: pEX-Strep-Dig-Split-Fok_a |
*gel extraction
|
1:Streo-Dig-Split-FokA, 2: pJS419, 3:His-Dig-Split-Fok_a, 4: RBS-Strep-Dig-Split-Fok_a |
*ligation of pExHisFluASplitFoki and StrepDigSplitFoka, pExHisFluASplitFoki (as negativ control)
*transformation of pExHisFluASplitFoki_StrepDigSplitFoka and pExHisFluASplitFoki (negative control)
*PCR primer forward and reverse for the in vivo assay/ polycistronic assay arrived -> PCR with pEXStrepDigSplitFoka was done to amplificate the gene and insert a RBS site simultanously
*Inoculation of starter culture for expression and glycerol stocks: - pEx_HisFluASplitFoki in BL21de3 (300ml 2YT Amp, 1% Gluc) --> 26°C
*Inoculation of - pET-39b+ in XL1blue (15ml LB+Kan) --> plasmidprep for cleavage assays with AGO tomorrow
--> 37°C over night
*sequencing of HisFluASplitFoki clone 1 (100µl) from 26.08.09
30.09.09 Gerrit, Hannes, Caro, Anika, Max, Isabel, Christoph, Julia
*cloning His_ & Strep_ Dig_Split_FokA into pJS 419 phagemid vector - digested pEX vectors & pJS419 w/ XbaI, NotI using 16 µL DNA
--> 1 % agarose gel
*ssDNA production - digestion of pET-39b(+): EcoRI, XbaI
|
|
* Miniprep. of pET-39b+ ,stored in -20°C
* Miniprep. of RV_Test ,stored in -20°C
* phage display - error prone PCR
50µl PCR buffer (10x) without MgCl2
50µl MnCl2 (5mM)
120µl MgCl2 (25mM)
15µl primer #7
11,7µl primer #1
20µl dNTPs (each 10mM)
10µl Taq
218,3µl water
apportion total into 2 tubes à 245µl
add 5 µl of plasmid 425-2 and 428-6 (each 50ng/µl)
make aliquots à 50µl
- ligation
2 samples:
2µl vector
12µl insert (digest 87/88)
1µl Ligase
2µl Ligase buffer
3µl water
3 samples:
2µl vector
20,4µl insert (digest 87/89)
1µl Ligase
2,6µl Ligase buffer
*digest of pExStrepDigSplitFoka from 29.08.09 clon 1b because ligation or trafo didn't work and concentration of insert after gelex was probably too low
|
Agarose-gel ; Lanes: NEB 1kb DNA ladder, pExHisFluASplitFoki, pExStrepDigSplitFoka |
water: 14.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 3 NEB iGEM stock
Restriction_enzyme_1 : 2 µl XbaI from NEB KuKlabstock
Restriction_enzyme_2 : 1 µl PstI from NEB KuKlabstock
->put in 37°C for 2h
*preparative gel of digest -> didn't work (no insert could be seen)
*sequence of pExHisFluASplitFoki from 26.08.09, clone 100ul checked: ok
*protein expression of pEx_HisFluASplitFoki in BL21de3 --> pellets frozen at -80°C
*phosphorylised AGO A1 guide oligo via T4 Polynucleotid Kinase (with T4 Ligase Buffer) Final 20µl with 2.5 µM Oligo
*Started making Phages with wt Aa AGO: DsbA-flag-AGO-CDg3p; DsbA-flag-AGO-noAmber-CDg3p; TorA-flag-AGO-CDg3p; TorA-flag-AGO-noAmber-CDg3p -> Cells with the DsbA Phagmid-vektor showed very poor growth
* Prepared Phage ELISA via Anti-Flag as well as Strep-Biotinylated target Oligo
"












