In order to create a universal
restriction
enzyme, we followed several ideas and models. The first and most
promising idea
we had was to create a monomeric restriction enzyme as it represents the optimal and
easiest
model for a universal restriction enzyme
If we are able to employ a
monomeric enzyme,
this protein would have a couple of advantages: Most importantly we
would no longer
need two separate oligonucleotides to achieve specific binding and
cleavage of
the target DNA. Also, only one protein has to be purified –
thus saving time and
money. A scientific advantage is the option to optimize the monomer by
phage
display. Using this technology, we would have the chance to create a
thermostable, specific, universal restriction enzyme whose DNA binding
specificity
is simply created by a single oligonucleotide.
Our goal was first, to create
a Fok-monomer that
is able to cut DNA without a primary dimerization step, and second, to
show
that our heterodimeric interface design works properly. To reach this,
we had
to clone all the required parts one after another, resulting in a huge
fusion
protein.
Results
3D modeling and design goals
 |
| Fig. 1:
Scheme of monomoeric Fok:
I.
lipocalin, II.
Foka/Foki (heterodimers), III.
Linker, IV. His-Tag |
The necessary parts in the
model of a
monomeric restriction enzyme are: Tag-binding protein (lipocalin) - Fok
heterodimer1 -
linker - Fok heterodimer2 (Fig. 1).
| Tag |
binding protein |
linker |
Fok heterodimer |
HisTag (BBa_K157011)
StrepTag(BBa_K157012)
|
FluA(BBa_K157004)
DigA(BBa_K243003)
Fos(BBa_K243027)
|
GSAT-Linker(BBa_K243029)
SEGLinker(BBa_K243030)
|
FokA (K243000)
Foki (K243001)
|
Tab. 1: List of
parts usable for
Fok Monomer
In order to purify this fusion
protein, we employed an N-terminal tag. The binding protein (a lipocalin-derived binding protein referred to as anticalin in analogy to antibodies) mediates
between the
FokI protein and the tagged oligonucleotide. Both parts of the Fok heterodimers are
associated with a long flexible linker allowing
them to establish the cutting site conformation. This artificial
restriction
nuclease domain is the functional part of the monomer and catalyzes the
DNA
cleavage.
Before
we started in the wet lab, we thoroughly planned all
the individual steps. To figure out the best way to create the Fok
monomer, we first designed it in
silico.

|
| Fig. 2:
3D model of Fok Monomer |
The model (Fig. 2) shows that we
have to use a
linker which is about 70 Angstrom in length to
span the required
distance between the two Fok parts. Therefore, we decided to order two
complementary oligonucleotides encoding a 36 amino acid long glycine-serine
linker.
5'-CTAGATGGCCGGCGGTTCTGGTGGTGGTTCTGGCGGTGGTTCTGGAGGTAGTTCTGGCGGTGGATCTGGAGGCGGTTCTGGGTCAGGATCTGGTGGAGGTTCTGGCTCTGGGAATCAGA-3'
3'-TACCGGCCGCCAAGACCACCACCAAGACCGCCACCAAGACCTCCATCAAGACCGCCACCTAGACCTCCGCCAAGACCCAGTCCTAGACCACTACCAAGACCGAGACCCTTAGTCTGGCC-5
Cloning
However, at this stage the first
problem
appeared. These are the oligonucleotides, each
120 nt long, which we ordered from Mr.Gene. Unfortunately, we made a mistake when
ordering the
complementary oligonucleotide. Accidentally we introduced two mismatches
(compare
colored bases in the sequence). But somehow we managed to dimerize the
two
oligonucleotides. After dimerization in the thermocycler
and
cloning into a pMA (BBa_K243031) vector (XbaI/AgeI) some mutations
appeared in
the 36GSLinker gene caused by the mismatches. As there was no
frame
shift we decided to carry on.
First, we picked the parts we were going to
use. We decided to use one we already completed in our earlier
experiments: His
– FluA – Split -
Foki (BBa_K243010) had all the functions we needed. These are (i) a purification tag,
(ii) a Fok domain and (iii) the anticalin that binds the
tagged
oligonucleotide (Fig. 1). Cloning the linker (no part) behind these parts was
the next
step. We followed the assembly standard 25 and opened the vector with AgeI
and
PstI and cut the inserted with NgoMIV and PstI.
 |
|
Fig. 3: Gel
picture of test digest
|
However, we ran into some more problems. After cloning Foka
(BBa_K243000) after the other parts, again assembly standard 25, we
performed test restriction digests cutting out the insert to confirm its size. These digests showed that the
plasmid
became even smaller as it would be without an insertion (pEX: ~ 4,5kbp
and after
test digestion ~ 2,2kbp). The insert should have a size of about 1.9 kbp but was found to be only about 900 bp (Fig. 3). The sequencing did not work either.
Most likely, the active Fok did
cut the plasmid
and promoted deletion of the Fok gene, which gave such mutated cells a
significant
growth advantage. After we encountered these problems, we decided to order the 36GS-linker (GSAT
Linker:
BBa_K243029) as gene synthesis.
5´-GAGCTCGAATTCGCGGCCGCTTCTAGATGGCCGGCGGTGGTTCTGCCGGTGGCTCCGGTTCTGGCTCCAGCGGTGGCAGCTCTGGTGCGTCCGGCACGGG
TACTGCGGGTGGCACTGGCAGCGGTTCCGGTACTGGCTCTGGCACCGGTAATACTAGTAGCGGCCGCTGCAGGGTACC-3´
This
time the order was well planned but, unfortunately, it
took over 4 weeks for the synthesis and delivery, and the genes arrived too
late. Once
again we have to make all the cloning steps. As of mid October 2009, the
project
is still in progress.