User contributions
From 2009.igem.org
(Latest | Earliest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)
- 15:22, 14 September 2009 (diff | hist) Team:Warsaw/test komorka
- 15:20, 14 September 2009 (diff | hist) N Team:Warsaw/test komorka (New page: {{Warhead1}} <html> <style> #gmap {display:block; width:714px; height:651px; background:url(https://static.igem.org/mediawiki/2009/6/67/Blacknwhite.png); position:relative; margin:0 auto 2em ...)
- 15:19, 14 September 2009 (diff | hist) N File:Kom8.png (top)
- 15:18, 14 September 2009 (diff | hist) N File:Kom7.png (top)
- 15:17, 14 September 2009 (diff | hist) N File:Kom6.png (top)
- 15:15, 14 September 2009 (diff | hist) N File:Kom4.png (top)
- 14:49, 14 September 2009 (diff | hist) N File:Kom2.png
- 14:49, 14 September 2009 (diff | hist) N File:Kom1.png
- 14:45, 14 September 2009 (diff | hist) N File:3.png
- 14:29, 14 September 2009 (diff | hist) N File:5.png
- 14:27, 14 September 2009 (diff | hist) N File:Blacknwhite.png
- 15:08, 11 September 2009 (diff | hist) Team:Warsaw/Project/detailed
- 13:37, 11 September 2009 (diff | hist) Team:Warsaw/Project/theory
- 12:49, 11 September 2009 (diff | hist) Team:Warsaw/Glossary
- 12:31, 11 September 2009 (diff | hist) Team:Warsaw/Project/introduction
- 12:14, 11 September 2009 (diff | hist) Team:Warsaw
- 23:01, 10 September 2009 (diff | hist) N Team:Warsaw/Notebook/toc (New page: {{WarHead1}} Table of Contents<br/> (or short description of what are we trying to do) 1. Cloning of natural bricks: * PhoP/PhoQ operon + mgtc promoter * Mitochondrium-targeting sequence...) (top)
- 17:04, 9 September 2009 (diff | hist) Team:Warsaw
- 12:41, 6 September 2009 (diff | hist) Team:Warsaw/Team
- 15:04, 4 September 2009 (diff | hist) Team:Warsaw
- 15:02, 4 September 2009 (diff | hist) N File:CLONTECH LOGO CapCMYK small.jpg (top)
- 15:01, 4 September 2009 (diff | hist) Team:Warsaw/sponsors
- 08:04, 3 September 2009 (diff | hist) Team:Warsaw
- 08:03, 3 September 2009 (diff | hist) Team:Warsaw
- 18:11, 26 August 2009 (diff | hist) Team:Warsaw
- 18:10, 26 August 2009 (diff | hist) Team:Warsaw
- 08:49, 20 August 2009 (diff | hist) Team:Warsaw/Calendar-Main/19 August 2009
- 11:50, 19 August 2009 (diff | hist) Team:Warsaw/Calendar-Main/17 August 2009
- 11:47, 19 August 2009 (diff | hist) Team:Warsaw/Calendar-Main/18 August 2009
- 15:52, 16 August 2009 (diff | hist) m Team:Warsaw/Glossary
- 15:51, 16 August 2009 (diff | hist) Team:Warsaw/Glossary
- 15:39, 16 August 2009 (diff | hist) Team:Warsaw/Project/detailed
- 14:13, 14 August 2009 (diff | hist) m Template:WarNotebook
- 20:56, 13 August 2009 (diff | hist) N Team:Warsaw/Notebook/phoP (New page: {{WarHead1}} ==Preparation of PhoP/PhoQ (BBa_xxxxxx) brick== Persons responsible: Kamila, etc Notebook entries: # [https://2009.igem.org/Team:Warsaw/Calendar-Main/29_April_2009] # [http...) (top)
- 20:38, 13 August 2009 (diff | hist) Template:WarNotebook (Undo revision 45844 by Smaegol (Talk))
- 20:37, 13 August 2009 (diff | hist) Template:WarNotebook (Replacing page with '{{WarHead1}}')
- 19:58, 13 August 2009 (diff | hist) Team:Warsaw/Calendar-Main/2 August 2009
- 19:55, 13 August 2009 (diff | hist) Team:Warsaw/Calendar-Main/3 August 2009
- 19:23, 13 August 2009 (diff | hist) Team:Warsaw/Calendar-Main/11 August 2009
- 19:03, 13 August 2009 (diff | hist) Team:Warsaw/Calendar-Main/13 August 2009
- 19:00, 13 August 2009 (diff | hist) N Team:Warsaw/Primers (New page: {{WarHead1}} <html> <br> <h1>Primers</h1> <h2>cloning primers</h2> <h4>cloning primers</h4> <pre> <a name="croboxF">croboxF</a> 5' ATCTAGATACCTCTGGCGGTGATACTAGTGT 3' <a name="crob...)
- 17:59, 13 August 2009 (diff | hist) Team:Warsaw/Glossary
- 17:48, 13 August 2009 (diff | hist) Team:Warsaw/Team/Miecznikowa
- 17:48, 13 August 2009 (diff | hist) Template:WarFoot1 (top)
- 17:47, 13 August 2009 (diff | hist) File:Portret.jpg (uploaded a new version of "Image:Portret.jpg") (top)
- 17:47, 13 August 2009 (diff | hist) File:Kama igem.jpg (uploaded a new version of "Image:Kama igem.jpg") (top)
- 17:46, 13 August 2009 (diff | hist) File:IMG 1656igem.jpg (uploaded a new version of "Image:IMG 1656igem.jpg") (top)
- 17:38, 13 August 2009 (diff | hist) m Team:Warsaw
- 17:36, 13 August 2009 (diff | hist) Team:Warsaw
- 17:25, 13 August 2009 (diff | hist) Team:Warsaw
- 16:10, 13 August 2009 (diff | hist) Team:Warsaw/Project/theory
- 16:03, 13 August 2009 (diff | hist) N Team:Warsaw/Glossary (New page: {{WarHead1}} __NOTOC__ ==Glossary== ====apoptosis==== <div class="glossary_text">Apoptosis is a natural process of programmed cell death. Apoptosis can be induced by many factors and it...)
- 15:57, 13 August 2009 (diff | hist) Template:WarHead4
- 15:57, 13 August 2009 (diff | hist) Template:WarHead4
- 15:49, 13 August 2009 (diff | hist) Template:WarHead4
- 15:28, 13 August 2009 (diff | hist) File:Stepien fotos 2005 009.jpg (uploaded a new version of "Image:Stepien fotos 2005 009.jpg") (top)
- 15:22, 13 August 2009 (diff | hist) Template:WarFoot1
- 14:54, 13 August 2009 (diff | hist) File:War header3.jpg (uploaded a new version of "Image:War header3.jpg") (top)
- 13:24, 13 August 2009 (diff | hist) Template:WarNotebook (Undo revision 45259 by Smaegol (Talk))
- 13:07, 13 August 2009 (diff | hist) Team:Warsaw/Parts (Replacing page with '{{WarHead1}} Our parts can be found [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2009&group=Warsaw here] {{WarFoot1}}')
- 13:01, 13 August 2009 (diff | hist) Team:Warsaw
- 13:01, 13 August 2009 (diff | hist) Template:WarHead4
- 12:59, 13 August 2009 (diff | hist) Team:Warsaw/sponsors
- 12:59, 13 August 2009 (diff | hist) Team:Warsaw
- 12:55, 13 August 2009 (diff | hist) Template:WarFoot1
- 12:54, 13 August 2009 (diff | hist) Template:WarFoot1
- 12:54, 13 August 2009 (diff | hist) Template:WarFoot1
- 12:50, 13 August 2009 (diff | hist) Template:WarFoot1
- 12:49, 13 August 2009 (diff | hist) Template:WarFoot1
- 12:48, 13 August 2009 (diff | hist) Template:WarNotebook
- 12:29, 13 August 2009 (diff | hist) Template:WarNotebook
- 12:29, 13 August 2009 (diff | hist) Template:WarHead (top)
- 12:26, 13 August 2009 (diff | hist) Template:WarNotebookEnd
- 12:25, 13 August 2009 (diff | hist) Template:WarNotebookEnd
- 12:22, 13 August 2009 (diff | hist) Template:WarHead4
- 12:19, 13 August 2009 (diff | hist) Template:WarNotebook
- 12:04, 13 August 2009 (diff | hist) Template:WarHead4
- 17:35, 11 August 2009 (diff | hist) File:War header3.jpg (uploaded a new version of "Image:War header3.jpg")
- 17:33, 11 August 2009 (diff | hist) Template:WarHead4
- 17:23, 11 August 2009 (diff | hist) N File:War header3.jpg
- 17:12, 11 August 2009 (diff | hist) Template:WarHead4
- 17:12, 11 August 2009 (diff | hist) File:Spacer.jpg (uploaded a new version of "Image:Spacer.jpg") (top)
- 17:03, 11 August 2009 (diff | hist) N File:Spacer.jpg
- 16:59, 11 August 2009 (diff | hist) File:War header2.jpg (uploaded a new version of "Image:War header2.jpg") (top)
- 16:57, 11 August 2009 (diff | hist) Template:WarHead4
- 16:56, 11 August 2009 (diff | hist) File:War header2.jpg (uploaded a new version of "Image:War header2.jpg")
- 16:55, 11 August 2009 (diff | hist) File:War header2.jpg (uploaded a new version of "Image:War header2.jpg")
- 16:37, 11 August 2009 (diff | hist) File:War header2.jpg (uploaded a new version of "Image:War header2.jpg")
- 16:33, 11 August 2009 (diff | hist) N File:War header2.jpg
- 22:31, 6 August 2009 (diff | hist) Team:Warsaw/Notebook/toctest (top)
- 22:30, 6 August 2009 (diff | hist) N Team:Warsaw/Notebook/toctest (New page: {{{WarHead1}} ==Lab work - detailed plan and its execution== ====My idea is....==== Here should be placed sth like schema describing what are we doing, step by step... # Brainstorming ...)
- 07:12, 23 July 2009 (diff | hist) Template:WarHead
- 07:10, 23 July 2009 (diff | hist) Team:Warsaw
- 07:07, 23 July 2009 (diff | hist) N File:Eurx.jpg (top)
- 07:26, 22 July 2009 (diff | hist) Team:Warsaw/Notebook
- 23:10, 21 July 2009 (diff | hist) Template:WarHead4
- 23:07, 21 July 2009 (diff | hist) Team:Warsaw/Team/Supervisors
- 22:32, 21 July 2009 (diff | hist) Team:Warsaw/test2 (top)
- 22:32, 21 July 2009 (diff | hist) Team:Warsaw/test2
- 22:28, 21 July 2009 (diff | hist) N Team:Warsaw/Contact (New page: {{WarHead1}} ==Contact== You can contact us at [mailto:igem2009.warsaw@gmail.com igem2009.warsaw@gmail.com]. We are open for any comments or questions. This e-mail address is also ready...) (top)
- 22:24, 21 July 2009 (diff | hist) Template:WarHead4
- 22:20, 21 July 2009 (diff | hist) N Team:Warsaw/Resources (New page: {{WarHead1}} ==Resources== This is the place when we place different resources connected with our project. It can include some DNA sequences (like primers, vectors, parts, etc) or other t...)
- 22:18, 21 July 2009 (diff | hist) N Team:Warsaw/protocols (New page: {{WarHead1}} ==Lab protocols== __TOC__ ==introduction== Here is the place for the all protocols used by the Warsaw Team during the iGEM 2009. Feel free to add yours. Please be sure to ...)
- 22:15, 21 July 2009 (diff | hist) Template:WarHead4
- 22:15, 21 July 2009 (diff | hist) Team:Warsaw/Notebook
- 22:14, 21 July 2009 (diff | hist) Template:WarHead4
- 22:11, 21 July 2009 (diff | hist) Team:Warsaw/Modelling/Apoptosis
- 22:10, 21 July 2009 (diff | hist) Team:Warsaw/Team/Supervisors
- 22:10, 21 July 2009 (diff | hist) Team:Warsaw/Team/Miecznikowa
- 22:09, 21 July 2009 (diff | hist) Team:Warsaw/Team/Pawinskiego
- 22:09, 21 July 2009 (diff | hist) Team:Warsaw/Team/Pawinskiego
- 22:00, 21 July 2009 (diff | hist) Team:Warsaw/Team/Pawinskiego
- 22:00, 21 July 2009 (diff | hist) Team:Warsaw/Team/Miecznikowa
- 22:00, 21 July 2009 (diff | hist) Team:Warsaw/Team/Supervisors
- 21:57, 21 July 2009 (diff | hist) Template:WarHead4
- 21:51, 21 July 2009 (diff | hist) Template:WarHead4
- 21:50, 21 July 2009 (diff | hist) N Team:Warsaw/Modelling/Apoptosis (New page: {{WarHead1}} Ania is person responsible for modelling in our team. She will post some text here ASAP. {{WarFoot1}})
- 21:49, 21 July 2009 (diff | hist) N Team:Warsaw/Bibliography (New page: {{WarHead1}} ==REFERENCES== #Bielecki J, Youngman P, Connelly P, Portnoy DA. Bacillus subtilis expressing a haemolysin gene from Listeria monocytogenes can grow in mammalian cells. Nature...)
- 21:48, 21 July 2009 (diff | hist) N Team:Warsaw/Project/detailed (New page: {{WarHead1}} ==Detailed research project== __TOC__ ===Introduction=== Fig 1. The overview of the system.<br> Fig 1. The overview of the system. Gene regulatory network ...)
- 21:43, 21 July 2009 (diff | hist) N Team:Warsaw/Project/theory (New page: {{WarHead1}} ==Theoretical basis== __TOC__ ===Entrance of bacteria into eukaryotic cells=== Many bacterial species are able to invade an eukaryotic cell. One of the crucial proteins for ...)
- 21:43, 21 July 2009 (diff | hist) Template:WarHead4
- 21:41, 21 July 2009 (diff | hist) Team:Warsaw/Project/introduction
- 21:39, 21 July 2009 (diff | hist) Template:WarHead4
- 21:37, 21 July 2009 (diff | hist) Template:WarHead4
- 21:36, 21 July 2009 (diff | hist) Team:Warsaw/Project/introduction
- 21:36, 21 July 2009 (diff | hist) Template:WarHead4
- 21:34, 21 July 2009 (diff | hist) Template:WarFoot1
- 21:33, 21 July 2009 (diff | hist) Template:WarFoot1
- 21:33, 21 July 2009 (diff | hist) Template:WarFoot1
- 21:32, 21 July 2009 (diff | hist) Template:WarFoot1
- 21:32, 21 July 2009 (diff | hist) Template:WarHead4
- 21:28, 21 July 2009 (diff | hist) Template:WarHead4
- 21:28, 21 July 2009 (diff | hist) Template:WarHead4
- 21:24, 21 July 2009 (diff | hist) Template:WarHead4
- 21:24, 21 July 2009 (diff | hist) Template:WarHead4
- 21:21, 21 July 2009 (diff | hist) Template:WarHead4 (Undo revision 24804 by Smaegol (Talk))
- 21:21, 21 July 2009 (diff | hist) Template:WarHead4
- 21:19, 21 July 2009 (diff | hist) Template:WarHead4
- 21:18, 21 July 2009 (diff | hist) Template:WarFoot1
- 21:17, 21 July 2009 (diff | hist) Template:WarHead4
- 21:16, 21 July 2009 (diff | hist) Template:WarHead4
- 21:15, 21 July 2009 (diff | hist) N Team:Warsaw/Project/introduction (New page: {{WarHead1}} ==Aims of the project== One of the most important challenges in the field of modern medicine is to invent the efficacious anticancer therapy. The gene therapy appears to be th...)
- 21:14, 21 July 2009 (diff | hist) Template:WarFoot1
- 21:14, 21 July 2009 (diff | hist) Template:WarHead4
- 21:12, 21 July 2009 (diff | hist) Template:WarFoot1
- 21:10, 21 July 2009 (diff | hist) Template:WarFoot1
- 21:09, 21 July 2009 (diff | hist) Team:Warsaw/Team
- 20:34, 21 July 2009 (diff | hist) Template:WarFoot1
- 20:31, 21 July 2009 (diff | hist) N Template:WarFoot1 (New page: </div> <div id="footer" style="align:center;"> ---- (C) iGEM 2009 Warsaw Team </div>)
- 20:27, 21 July 2009 (diff | hist) Team:Warsaw/Project (top)
- 19:32, 21 July 2009 (diff | hist) Team:Warsaw/Team/Miecznikowa
- 19:31, 21 July 2009 (diff | hist) Team:Warsaw/Team
- 19:30, 21 July 2009 (diff | hist) Team:Warsaw/Team
- 19:12, 21 July 2009 (diff | hist) N Team:Warsaw/Team/Pawinskiego (New page: {{WarHead1}} __NOTOC__ ==Pawinskiego group== <div style="text-align: justify;">We are working at the Institute of Biochemistry and Biophysics PAS building, in the laboratory equiped by th...)
- 19:12, 21 July 2009 (diff | hist) Template:WarHead4
- 19:11, 21 July 2009 (diff | hist) Template:WarHead4
- 16:52, 21 July 2009 (diff | hist) Team:Warsaw/Team/Miecznikowa
- 16:50, 21 July 2009 (diff | hist) Template:WarHead4
- 16:50, 21 July 2009 (diff | hist) Team:Warsaw/Team/Miecznikowa
- 16:49, 21 July 2009 (diff | hist) N Team:Warsaw/Team/Miecznikowa (New page: {{WarHead1}} ==Miecznikowa group== We are working at the Faculty of Biology building, in the laboratory equiped by the Department of Virology and Department of Applied Microbiology. Our wo...)
- 16:02, 21 July 2009 (diff | hist) Template:WarHead4
- 16:02, 21 July 2009 (diff | hist) Template:WarHead4
- 15:59, 21 July 2009 (diff | hist) Template:WarHead4
- 15:58, 21 July 2009 (diff | hist) Template:WarHead4
- 15:57, 21 July 2009 (diff | hist) N Team:Warsaw/Team/Supervisors (New page: {{WarHead1}} __NOTOC__ ==Instructors and Advisors== <html><img src="https://static.igem.org/mediawiki/2008/1/1c/Prof.Jacek_Bielecki.gif" alt="Prof. Jacek Bielecki" width="200" height="205" align...)
- 07:57, 21 July 2009 (diff | hist) Template:WarHead4
- 07:48, 21 July 2009 (diff | hist) Template:WarHead4
- 07:47, 21 July 2009 (diff | hist) Template:WarHead4
- 07:45, 21 July 2009 (diff | hist) Template:WarHead4
- 06:42, 21 July 2009 (diff | hist) Template:WarHead4
- 01:43, 21 July 2009 (diff | hist) Template:WarHead4
- 01:40, 21 July 2009 (diff | hist) Template:WarHead4
- 01:40, 21 July 2009 (diff | hist) N Team:Warsaw/test2 (New page: {{WarHead1}} __NOTOC__ ==A novel vector for delivery of DNA and proteins to the cytoplasm of cancer cells== ===NEWS=== ====21.07.2009==== Currently, besides hard-working in the lab, we ...)
- 01:39, 21 July 2009 (diff | hist) Template:WarHead4 (Undo revision 24007 by Smaegol (Talk))
- 01:35, 21 July 2009 (diff | hist) Template:WarHead4
- 01:23, 21 July 2009 (diff | hist) Template:WarHead4
- 01:21, 21 July 2009 (diff | hist) m Template:WarHead4
- 01:20, 21 July 2009 (diff | hist) Template:WarHead4
- 01:14, 21 July 2009 (diff | hist) Template:WarHead4
- 01:07, 21 July 2009 (diff | hist) Team:Warsaw/Team
- 01:06, 21 July 2009 (diff | hist) Template:WarHead4
- 01:04, 21 July 2009 (diff | hist) Team:Warsaw/Project
- 01:01, 21 July 2009 (diff | hist) Team:Warsaw/Team
- 01:00, 21 July 2009 (diff | hist) Template:WarHead4
- 00:59, 21 July 2009 (diff | hist) Template:WarHead4
- 00:17, 21 July 2009 (diff | hist) File:War header 1.jpg (uploaded a new version of "Image:War header 1.jpg") (top)
- 00:14, 21 July 2009 (diff | hist) File:War header 1.jpg (uploaded a new version of "Image:War header 1.jpg")
- 00:12, 21 July 2009 (diff | hist) File:War header 1.jpg (uploaded a new version of "Image:War header 1.jpg")
- 00:04, 21 July 2009 (diff | hist) N File:War header 1.jpg
- 18:18, 20 July 2009 (diff | hist) Template:WarHead4
- 17:07, 20 July 2009 (diff | hist) N File:Warsaw logo.jpg (top)
- 10:30, 18 July 2009 (diff | hist) Wiki/Team:Warsaw/primers (top)
- 10:30, 18 July 2009 (diff | hist) Wiki/Team:Warsaw/primers
- 10:26, 18 July 2009 (diff | hist) Wiki/Team:Warsaw/primers
- 10:13, 18 July 2009 (diff | hist) Team:Warsaw/sponsors
- 18:07, 17 July 2009 (diff | hist) Team:Warsaw
- 18:06, 17 July 2009 (diff | hist) Team:Warsaw
- 18:02, 17 July 2009 (diff | hist) N Team:Warsaw/sponsors (New page: {{WarHead}} ==Sponsors== Currently we are supported by: # [http://www.uw.edu.pl/en University of Warsaw], including * [http://www.biol.uw.edu.pl/_2008eng Faculty of Biology] * [http://ww...)
- 16:28, 16 July 2009 (diff | hist) Wiki/Team:Warsaw/igem team.htm
- 16:26, 16 July 2009 (diff | hist) N File:Jarek.jpg (top)
- 23:08, 15 July 2009 (diff | hist) Team:Warsaw/Team
- 23:07, 15 July 2009 (diff | hist) N Template:WarHead4 (New page: 965px {|style="background-color:#72a94e;" cellpadding="5" cellspacing="10" width="100%" align="center" !Main page ![[Team:Warsaw/Team|The...)
- 22:16, 15 July 2009 (diff | hist) N File:Header Franka.jpg (top)
- 22:14, 15 July 2009 (diff | hist) Team:Warsaw/Team
- 11:50, 12 July 2009 (diff | hist) Wiki/Team:Warsaw/protocols
- 11:46, 12 July 2009 (diff | hist) Wiki/Team:Warsaw/igem notebook.htm (Undo revision 18546 by Olchowik (Talk))
- 11:41, 12 July 2009 (diff | hist) Wiki/Team:Warsaw/protocols
- 11:32, 12 July 2009 (diff | hist) Wiki/Team:Warsaw/protocols
- 11:30, 12 July 2009 (diff | hist) Wiki/Team:Warsaw/protocols
- 11:29, 12 July 2009 (diff | hist) Wiki/Team:Warsaw/protocols
- 11:25, 12 July 2009 (diff | hist) N Wiki/Team:Warsaw/protocols (New page: {{WarHead}} ==Lab protocols== Here is the place for the all protocols used by the Warsaw Team during the iGEM 2009. Feel free to add yours. Please be sure to use the <pre> {{Anchor|na...)
- 11:03, 12 July 2009 (diff | hist) Template:WarNotebookEnd
- 11:01, 12 July 2009 (diff | hist) Template:WarNotebookEnd
- 09:19, 12 July 2009 (diff | hist) Team:Warsaw/Calendar-Main/11 July 2009
- 18:28, 11 July 2009 (diff | hist) Team:Warsaw/Calendar-Main/10 July 2009
- 15:46, 10 July 2009 (diff | hist) N Team:Warsaw/Calendar-Main/10 July 2009 (New page: {{WarNotebook}} <!-- do not edit above me! --> ==Team meeting== # presentations of work did by both groups during last week (given by Ania and Kuba) # presentation of methods used by tea...)
- 23:06, 7 July 2009 (diff | hist) Team:Warsaw/Calendar-Main/29 June 2009
- 23:05, 7 July 2009 (diff | hist) Team:Warsaw/Calendar-Main/29 June 2009
- 21:49, 7 July 2009 (diff | hist) Team:Warsaw/Calendar-Main/2 July 2009
- 22:24, 6 July 2009 (diff | hist) Team:Warsaw/Calendar-Main/6 July 2009
- 22:21, 6 July 2009 (diff | hist) Team:Warsaw/Calendar-Main/6 July 2009
- 22:18, 6 July 2009 (diff | hist) Team:Warsaw/Calendar-Main/6 July 2009
- 19:56, 6 July 2009 (diff | hist) N Team:Warsaw/Calendar-Main/6 July 2009 (New page: {{WarNotebook}} <!-- do not edit above me! --> ==Informal meeting concerning important issues of the Project== Today in the evening we met in the lab located on Pawinskiego street to, du...)
- 21:07, 5 July 2009 (diff | hist) Team:Warsaw
- 21:06, 5 July 2009 (diff | hist) Team:Warsaw
- 15:24, 4 July 2009 (diff | hist) Wiki/Team:Warsaw/igem team.htm
- 21:48, 2 July 2009 (diff | hist) m Wiki/Team:Warsaw/igem project.htm (top)
- 21:44, 2 July 2009 (diff | hist) m Wiki/Team:Warsaw/igem project.htm
- 21:43, 2 July 2009 (diff | hist) Wiki/Team:Warsaw/igem project.htm
- 21:43, 2 July 2009 (diff | hist) m Wiki/Team:Warsaw/igem project.htm
- 21:40, 2 July 2009 (diff | hist) Wiki/Team:Warsaw/igem project.htm
- 07:36, 29 June 2009 (diff | hist) Wiki/Team:Warsaw/igem project.htm
- 07:03, 29 June 2009 (diff | hist) Wiki/Team:Warsaw/igem team.htm
- 22:18, 28 June 2009 (diff | hist) N Team:Warsaw/Calendar-Main/26 June 2009 (New page: {{WarNotebook}} <!-- do not edit above me! --> <html> <h3>Team meeting</h3> <br><br> <p> During this meeting Michael and Pawel presented what they did learned during the Spring Workshop ...) (top)
- 12:11, 28 June 2009 (diff | hist) Team:Warsaw/Calendar-Main/23 June 2009
- 23:04, 27 June 2009 (diff | hist) Wiki/Team:Warsaw/igem team.htm
- 23:01, 27 June 2009 (diff | hist) Wiki/Team:Warsaw/igem team.htm
- 20:38, 27 June 2009 (diff | hist) Wiki/Team:Warsaw/igem team.htm
- 20:36, 27 June 2009 (diff | hist) Wiki/Team:Warsaw/igem team.htm
- 20:21, 27 June 2009 (diff | hist) N File:Warsaw team1.jpg (top)
- 19:43, 27 June 2009 (diff | hist) Team:Warsaw
- 19:35, 27 June 2009 (diff | hist) Wiki/Team:Warsaw/igem team.htm
- 19:35, 27 June 2009 (diff | hist) Wiki/Team:Warsaw/igem team.htm
- 17:15, 27 June 2009 (diff | hist) Wiki/Team:Warsaw/igem team.htm
- 13:09, 27 June 2009 (diff | hist) Wiki/Team:Warsaw/igem team.htm
- 22:26, 25 June 2009 (diff | hist) Wiki/Team:Warsaw/igem team.htm
- 13:32, 20 June 2009 (diff | hist) N User:Smaegol (New page: <html> <table> <tr> <td align="center" valign="top"><img src="https://static.igem.org/mediawiki/2008/6/61/Pawel_Krawczyk.gif" alt="Paweł Krawczyk" width="154" height="205" /></td> ...) (top)
- 22:54, 18 May 2009 (diff | hist) Wiki/Team:Warsaw/igem team.htm
- 12:49, 6 May 2009 (diff | hist) Team:Warsaw
- 17:12, 5 May 2009 (diff | hist) Team:Warsaw/test
(Latest | Earliest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)