Team:LCG-UNAM-Mexico:Journals:Uriel

Objectives

July 30, 2009

Primers for P2 cox and ogr genes arrived so we can start to construct the phage production system control.

To attain control of phage production we are going to put under an IPTG inducible promoter the genes that codify for the principal regulators of the morphopoietic genes.

The genes that codify for this regulators are going to be amplified via colony PCR from the E. coli C-177 strain, which has a lysogenic form of phage P2. The primers that we are using amplify the genes with its WT RBS's and also introduce an extra stop codon as required by the standardization protocol and also de suffix and prefix iGEM sequences.

It is known that C-1a strain neither has a cox gene nor an [http://partsregistry.org/Part:BBa_K242001 ogr] gene while K-12 strain contain a copy of [http://partsregistry.org/Part:BBa_K242001 ogr] in its genome. We have performed a colony PCR over the next strains, looking for [http://partsregistry.org/Part:BBa_K242001 ogr] and [http://partsregistry.org/Part:BBa_K242002 cox].

Genes:

[http://partsregistry.org/Part:BBa_K242001 ogr]
[http://partsregistry.org/Part:BBa_K242002 cox]

Strains:

       C-1a
       C-117
       DH5alpha

July 31, 2009

Colony PCR is going to be done with strain C-1a and C-117 as a control DH5alpha which has 17, we are going to confirm that C-1a doesn't has a P2 by means of PCR for P2 cox and ogr genes.

Primers:

>for_pre+rbs+cox_P2
 
 GTTTCTTCGAATTCGCGGCCGCTTCTAGGGGGCTAGAGGACGACATGAG

>rev_suf+dSTOP+cox_P2
 
 GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAACGTGGTTCACCGAGAC

Strains were platted on June 19, 2009 and were maintained at 4ºC and also a glycerol stock was created for C-1a and C-117. With a wood stick bacteria was taken and inoculated in LB without any selection.

The inoculated medium was incubated at 37ºC 250 rpm. for 1 hr. and then centrifuged at maximum speed with a tabletop centrifuge, supernatant was discarded and 200 µL of Tris-EDTA 10/1-NaCl 10mM added. The samples were heated over 10 min at 95ºC and then centrifuged again 2 min. 10µL of supernatant were taken for the PCR.

PCR Reaction:

   Water         24µL
   Buffer 10x    5µL
   MgCl2 50mM    2.5µL
   dNTP's 0.4mM  3.5µL
   Taq           1µL
   primer up     2.5µL
   primer low    2.5µL
   DNA           10µL
   Total         50µL

PCR results:
 
	Control		-
	C-117/[http://partsregistry.org/Part:BBa_K242001 ogr]	+
	C-1a/[http://partsregistry.org/Part:BBa_K242001 ogr]	-
	DH5alpha/[http://partsregistry.org/Part:BBa_K242001 ogr]	+
	C-117/[http://partsregistry.org/Part:BBa_K242002 cox]	+
	C-1a/[http://partsregistry.org/Part:BBa_K242002 cox]	-
	DH5alpha/[http://partsregistry.org/Part:BBa_K242002 cox]	-

The PCR's were consistent with previous results in literature. For example ogr was positive for DH5alpha which is a derivative from K-12 and we could not obtain PCR products from C-1a. C-117 which has P2 in lysogenic state gave use positive PCR products for [http://partsregistry.org/Part:BBa_K242001 ogr] and [http://partsregistry.org/Part:BBa_K242002 cox].

August 3, 2009

We prepared overnights of DH5alpha which contain the BioBricks [http://partsregistry.org/Part:pSB1AK3 pSB1AK3] and [http://partsregistry.org/Part:pSB1T3 pSB1T3] the selective medium was 50µL/mL Kanamycin and 20µL/mL Tetracycline respectively

August 4, 2009

We redo the colony PCR for ogr and [http://partsregistry.org/Part:BBa_K242002 cox] only using the C-117 strain. The PCR products were purified using the High Pure PCR Product Roche's Purification Kit and also plasmidic DNA was purified from the last overnights using the High Pure Plasmid Roche's Isolation Kit. The plasmids that were purified are going to used to add a double terminator sequence to [http://partsregistry.org/Part:BBa_K242001 ogr] and clone [http://partsregistry.org/Part:BBa_K242002 cox] for future manipulations.

       1) [http://partsregistry.org/Part:BBa_K242001 ogr] EcoRI/SpeI
       2) [http://partsregistry.org/Part:BBa_K242002 cox] EcoRI/PstI
       3) [http://partsregistry.org/Part:BBa_B0015 BBa_B0015] EcoRI/XbaI (plasmid [http://partsregistry.org/Part:pSB1AK3 pSB1AK3])
       4) [http://partsregistry.org/Part:BBa_J04450 BBa_J04450] EcoRI/PstI (plasmid [http://partsregistry.org/Part:pSB1T3 pSB1T3])

Restriction Reactions:

	DNA	10µL
	Ezimas	.5µL each one  
	Buffer	2µL
	Water	7µL
	Total	20µL

Vectors that will be use for cloning were dephosphorylated with Antarctic Phosphatase to avoid as much as possible false positives and also screening to many colonies.

 Dephosphorylation Reaction:

	Plasmid		20µL
	Buffer		3µL
	Enzyme		1µL
	Water		6µL
	Total		30µL
	
    Incubation conditions:

	1) 15 min --> 37ºC
	2) 5 min  --> 65ºC

Parts were ligated in the following way:

	1) [http://partsregistry.org/Part:BBa_K242001 ogr]+[http://partsregistry.org/Part:BBa_B0015 BBa_B0015]+[http://partsregistry.org/Part:pSB1T3 pSB1T3]
	2) [http://partsregistry.org/Part:BBa_K242002 cox]+[http://partsregistry.org/Part:pSB1T3 pSB1T3]

Ligation Reactions:

	1)

	Buffer	4µL
	Ligase	1µL
	[http://partsregistry.org/Part:pSB1T3 pSB1T3]	2µL
	[http://partsregistry.org/Part:BBa_K242001 ogr]	6µL
	[http://partsregistry.org/Part:BBa_B0015 BBa_B0015]	7µL
	Weter	0µL
	Total	20µL

	2)

	Buffer	4µL
	Ligase	1µL
	[http://partsregistry.org/Part:pSB1T3 pSB1T3]	3µL
	[http://partsregistry.org/Part:BBa_K242002 cox]	6µL
	Weter	6µL
	Total	20µL

The las reaction gave as a result the next parts:

       1)[http://partsregistry.org/Part:BBa_K242001 ogr]+I-09#005+[http://partsregistry.org/Part:pSB1T3 pSB1T3] --> I-09#023  
       2)[http://partsregistry.org/Part:BBa_K242002 cox]+[http://partsregistry.org/Part:pSB1T3 pSB1T3] --> I-09#022 

DH5alpha competent cells were transformed and platted on LB Agar with appropriate selection, for both constructions this selection was Tetracycline.

August 6, 2009

The [http://partsregistry.org/Part:BBa_K242001 ogr] PCR product was cut with EbaI/PstI and cloned in [http://partsregistry.org/Part:pSB1T3 pSB1T3] that was digested with the same enzymes and dephosphorylated as mentioned earlier. And then we performed a ligation reaction. The resulting BioBrick was named I-09#021.

	1) [http://partsregistry.org/Part:BBa_K242001 ogr] EcoRI/PstI

Restriction Reaction:

	DNA	10µL
	Ezimas	.5µL 
	Buffer	2µL
	Water	7µL
	Total	20µL

A 1% agarose gel was prepared and run 1 hr. 85 V. to see the insert and plasmid concentration. Unfortunately we loose our ogr's PCR product so we performed a new PCR only for this gene.

August 7, 2009

The PCR for ogr was done using the DNA from strain C-117.

PCR Reaction:

	Water 	23µL
	Buffer	5µL
	MgCl2	2.5µL
	dNTPs 	.5	each
	Taq/pol	1µL
	Oligo	2.5	each
	DNA	10µL
	Total	50µL

PCR:
	
	1) Control	+
	2) C-117/[http://partsregistry.org/Part:BBa_K242001 ogr]	+
	3) C-117/[http://partsregistry.org/Part:BBa_K242001 ogr]	+
	4) C-117/[http://partsregistry.org/Part:BBa_K242001 ogr]	+
	5) C-117/[http://partsregistry.org/Part:BBa_K242001 ogr]	+
	

An Agarose gel was run and we find that one of our reactants was contaminated because our negative control was positive that PCR is going to be repeated but with different reactants

August 10, 2009

We are going to change the PCR reagents because we don't know if they are contaminated and perform the next PCR reaction.

August 11, 2009

The PCR for ogr was done again and everything looked OK so we purified the PCR products with the High Pure PCR Product Roche's Purification Kit. An Agarose gel was run to see how much DNA was lost during the purification procedure and the using this information to add the right amount of restriction enzymes.

The first three lanes are cox, ogr and ogr+ter amplified using the prefix and suffix primer for these genes

Agust 13, 2009

Plasmid 18 was dephosphorylated because we are going to insert in it the ogr product that was amplified yesterday.

Dephosphorylation Reaction:

  Plasmid    20µL
  Buffer     3µL
  Enzyme     1µL
  Water      6µL
    
    Incubation:

    1)15 min --> 37ºC
    2)5 min  --> 65ºC

This plasmid that is going to be ligated with ogr is digested EcoRI/PstI.

cox was cut with EcoRI/SpeI and the plasmid that contain ogr+ter with EcoRI/XbaI because we are going to insert cox into this plasmid in order to concatenate cox+ogr+ter.

August 14, 2009

Vector [http://partsregistry.org/Part:pSB1T3 pSB1T3] was dephosphorylated and again a 1% Agarose gel was run with the vector and the ogr PCR product to check concentrations and posterior to this a ligation reaction was performed.

The Ligase enzyme that we are using is T4 DNA ligase from New England Biolabs which has the following reaction conditions

10 min at 23ºC and for inactivation incubate 20 min at 70ºC

Ligation Reaction:

	T4 Ligase	1µL
	Buffer		2µL
	[http://partsregistry.org/Part:BBa_K242001 ogr]		2µL
	[http://partsregistry.org/Part:pSB1T3 pSB1T3]		5µL
	Water		10µL
	Total		20µL

Once the ligation reaction finished we transformed DH5alpha competent cells and platted them on selective medium.

August 18, 2009

We started to prepare glycerol for the BrioBricks and Strains that we have finished to store them at -70ºC.

The [http://partsregistry.org/Part:BBa_R0010 BBa_R0010]/[http://partsregistry.org/Part:pSB1A2 pSB1A2] which has an IPTG inducible promoter is going to be purified and digested to put under the control of this promoter the construction [http://partsregistry.org/Part:BBa_K242002 cox]+[http://partsregistry.org/Part:BBa_K242001 ogr]+[http://partsregistry.org/Part:BBa_B0015 BBa_B0015].

The plasmid was digested with SpeI/PstI and the insert with XbaI/PstI.

To construct cox+[http://partsregistry.org/Part:BBa_K242001 ogr]+[http://partsregistry.org/Part:BBa_B0015 BBa_B0015] we took cox that was in [http://partsregistry.org/Part:pSB1T3 pSB1T3] and [http://partsregistry.org/Part:BBa_K242001 ogr]+[http://partsregistry.org/Part:BBa_B0015 BBa_B0015] also in [http://partsregistry.org/Part:pSB1T3 pSB1T3] and perform the following reactions:

Restriction Reaction:
					       Resistance
	[http://partsregistry.org/Part:pSB1T3 pSB1T3]+[http://partsregistry.org/Part:BBa_K242001 ogr]+[http://partsregistry.org/Part:BBa_B0015 BBa_B0015]	XbaI/PstI	  Tet
	[http://partsregistry.org/Part:pSB1T3 pSB1T3]+[http://partsregistry.org/Part:BBa_K242002 cox]	        EcoRI/SpeI	  Tet
	[http://partsregistry.org/Part:pSB1C3 pSB1C3]		        EcoRI/PstI	  Cm

We expect white colonies and resistant to Cm because [http://partsregistry.org/Part:pSB1C3 pSB1C3] has cloned an RFP protein that is expressed constitutively.

August 20, 2009

We performed restriction reactions with different colonies that carry the same plasmid to perform parallel constructions to avoid the case where a mutation could arise over one of the constructions leading this to the need of doing again the whole construction from a previous step.

DH5alpha strains that contain the listed plasmids below were grown in selective media and plasmid purification was performed and afterwards it was digested.

Plasmids:
	
	1) I-09#023.1	XbaI/PstI
	2) I-09#022.1	XbaI/PstI
	3) I-09#017.1	EcoRI/PstI
	4) I-09#017.2	EcoRI/PstI
	5) I-09#021.1	EcoRI/PstI
	6) I-09#021.2	EcoRI/PstI
	7) I-09#021.3	EcoRI/PstI
	8) I-09#021.4	EcoRI/PstI

Restriction Reactions:
	
	Buffer		4µL
 	BSA		.4µL
	DNA		25µL
 	Enzyme		2µL	each
	Water		6.6µL
	Total		40µL

August 21, 2009

An 1% Agarose gel was run for 1hr. at 85 V.

With this gel was confirmed that ogr is cloned in [http://partsregistry.org/Part:pSB1T3 pSB1T3] and now we can make a glycerol for this strain.

24 Ago 2009

The I-09#017 was dephosphorylated with antarctic phosphate

Dephospohrialtion Reaction:

	Plasmid		20µL
	Buffer		3µL
	Enzyme		1µL
	Water		6µL
	Total		30µL

	Incubation:
	
		1) 15 min ––> 37ºC
		2) 5 min --> 65ºC

After plasmid dephosphorialtion we are going to perform a ligation reaction between I-09#022.1 and I-09#023.1

August 25, 2009

Again an Agarose was run 1hr. at 85 V. to se the relative concentration of each sample that is going to be use for the ligation reaction.

Ligation Reaction:

	T4-ligase	 1µL
	Buffer		2µL
	#023.1		3µL
	#022.1		3µL
	#017.1		2µL
	Water		9µL
	Total		20µL

	Incubation:

		1) 10 min. --> 20ºC-25ºC
		2) 20 min. --> 65ºC

	Controls:

		1) Vector without dephosphorylation 
		2) Dephosphorilated vector without insert
	

We platted DH5alpha transformed cells over selective medium and incubate the plates overnight at 37ºC.

August 29, 2009

From ligation and transformation on Ago 25 a restriction analysis form tree selected proteins.

We are going to cut the purified plasmid from transformed cells in the following way:

	1) I-09#012	SpeI/PstI
	2) I-09#24.1	XbaI/PstI
	3) I-09#24.2	XbaI/PstI
	4) I-09#24.3	XbaI/PstI

Restriction Reaction:

	Buffer 		4µL
	BSA		0.4µL
	Enzyme		2µL each 
	DNA		25µL
	Total		40µL

We run a 1% Agarose gel at 85 V. 1hr

Unfortunately cox+ogr+ter cloning by fusing cox and ogr+ter in another plasmid didn't work out. We will try to repeat the procedure to see if we are luckier.

September 7, 2009

Again we dephophorylated vector I-09#017 to ligate it with cox and ogr+ter and then perform a transformation

Dephosphorylation Reaction:

	Plasmid		20µL
	Buffer		3µL
	Enzyme		1µL
	Water		6µL
	Total		30µL
	
    Incubation conditions:

	1) 15 min --> 37ºC
	2) 5 min  --> 65ºC

Ligation Reaction:

       T4-ligase	 1µL
       Buffer		2µL
       #023.1		3µL
       #022.1		3µL
       #017.1		2µL
       Water		9µL
       Total		20µL

    Incubation conditions:

       1) 10 min. --> 20ºC-25ºC
       2) 20 min. --> 65ºC

    Controls:

       1) Vector without dephosphorylation 
       2) Dephosphorilated vector

We platted DH5alpha transformed cells over selective medium and incubated overnight at 37ºC.

September 11, 2009

Colony PCR reactions were done with selected colonies that resulted from the last transformation the resulting and tow of the twenty-one looked like they contained [http://partsregistry.org/Part:BBa_K242002 cox]+[http://partsregistry.org/Part:BBa_K242001 ogr]+[http://partsregistry.org/Part:BBa_B0015 BBa_B0015] verification with a restriction assay was done and also ogr+ter+18 was purified and opened digested with EcoRI/PstI to be prepared in case last ligation don't work.