Team:Valencia/Parts

From 2009.igem.org

(Difference between revisions)
(→Preparing vectors)
 
(19 intermediate revisions not shown)
Line 1: Line 1:
-
{{Template:Valencia09iGEM2}}
+
{{Template:Valencia09iGEM23}}
 +
<html>
 +
<style>
 +
#content{
 +
          height: 1550px;
 +
        }
 +
</style>
 +
</html>
 +
<div align="justify" style="position:relative; margin-top:-250px; margin-left:190px; width:700px; color:black; font-size:10pt; font-family: Verdana">
 +
<br>
-
== '''Preparing inserts''' ==  
+
=Our BioBricks=
 +
<br>
 +
We have contributed to the Registry with [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2009&group=Valencia&Done=1 a set of parts], but one of them outstands all the others: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K222000 aequorin]. This reporter protein needs a prosthetic group, coelenterazine, and citoplasmic Ca<sup>2+</sup> to work. This means that light is only emitted whenever the researcher uses coelenterazine and whenever there is a media full of Ca<sup>2+</sup>. There are some works that use aequorin to sense Ca<sup>2+</sup>, but we have tamed the protein to emit light whenever we want with the activation through electric current.
-
Total DNA was extracted from our yeast strains.<br>
+
A thorough characterization has been made and can be found either at the [https://2009.igem.org/Team:Valencia/Parts/Characterization corresponding page] in this wiki or at the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K222000 Registry].
-
AEQ was amplified by PCR using oligonucleotides matching the sequence and bearing the appropriate Biobrick prefix and suffix.<br>
+
-
 
+
Additionally, we have used a collection of knock outs in order to have genetic negative control that help us confirm that the light effect is not an artifact.
-
 
+
<br>
-
 
+
<br>
-
And our oligos (EcoRI and XbaI sites in bold) were:<br>
+
<center>[http://partsregistry.org/wiki/index.php?title=Part:BBa_K222000 https://static.igem.org/mediawiki/2009/3/35/Aequorin.GIF]
-
Forward: 5'gaattcgcggccgcttctagatgaccagcgaccaatactc 3’<br>
+
<br>
-
Reverse: 5’tactagtagcggccgctgcagttaggggacagctccaccg 3’<br>
+
a 3D model of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K222000 aequorin], our outstanding BioBrick contribution to the Registry.
-
 
+
</center>
-
 
+
-
 
+
-
+
-
 
+
-
PCR was conducted as follows:<br>
+
-
 
+
-
<ol>A first denaturation cycle
+
-
+
-
<ol>94º 3min</ol>
+
-
 
+
-
Followed by 30 amplification cycles:
+
-
 
+
-
<ol>94º 30s<br>
+
-
 
+
-
55º 1min<br>
+
-
 
+
-
72º 1min<br></ol>
+
-
 
+
-
And a final extension step:
+
-
 
+
-
<ol>72º 7min</ol>
+
-
</ol>
+
-
 
+
-
 
+
-
 
+
-
[[Image:Gelaeq.JPG]]
+
-
 
+
-
'''Results:'''<br>
+
-
 
+
-
1 = wt (1 microlitre)<br>
+
-
2 = wt (2 microlitres)<br>
+
-
3 = Cch1 (1 microlitre)<br>
+
-
4 = Mid1 (1 microlitre)<br>
+
-
5 = Negative Control<br>
+
-
6 = Possitive Control<br>
+
-
(We used the same MWM)<br>
+
-
 
+
-
Amplicon has 600 pb's.
+
-
We used wt 1 microlitre of PCR amplification product (career 1) to build the AEQ BioBrick.<br>  
+
-
 
+
-
Firstly, we purified the DNA from the agarosa (ultra clean gel spin, DNA purification Kit, MO BIO laboratories). Later, amplicons were digested (H buffer) with EcoRI y XbaI.<br>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
==='''Preparing vectors'''===
+
-
+
-
Competent cells were transformed with pSB1A3 with the J04450 insert (present in the kit plate 1, hole 1K from the 2009 plasmid backbone distribution kit). We used the transformation protocol of XL1-Gold Ultracompetent Cells of..... We selected transformed cells in a LB + ampicillin medium plaques.  <br>
+
-
 
+
-
The following day, we selected red colonies, those that had the plasmid, and plasmids were extracted with the High pure miniprep plasmid isolation kit (ROCHE) <br>
+
-
Plasmid were digested with EcoRI and XbaI, in the same way we digested PCR result.<br>
+
-
 
+
-
===Ligating Biobricks into plasmids===
+
-
 
+
-
Both plasmids and inserts were run into 0.8% 0.5X TBE agarose gels and DNA bands excised with a clean scalpel. DNA was extracted from agarose blocks (ultra clean gel spin, DNA purification Kit, MO BIO laboratories).<br>
+
-
T4 Ligase was used to ligate inserts and vectors for 1 h at room temperature (2X quick buffer was used).<br>
+
-
Competent cells were transformed and resulting colonies (Amp LB) screened with Fw and Rv primers to confirm the presence of inserts. <br>
+
-
pSB1AK3 containing UCP-1, 175-deleted and 76-deleted were sent to the Registry <br>
+

Latest revision as of 23:24, 21 October 2009



Our BioBricks


We have contributed to the Registry with [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2009&group=Valencia&Done=1 a set of parts], but one of them outstands all the others: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K222000 aequorin]. This reporter protein needs a prosthetic group, coelenterazine, and citoplasmic Ca2+ to work. This means that light is only emitted whenever the researcher uses coelenterazine and whenever there is a media full of Ca2+. There are some works that use aequorin to sense Ca2+, but we have tamed the protein to emit light whenever we want with the activation through electric current.

A thorough characterization has been made and can be found either at the corresponding page in this wiki or at the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K222000 Registry].

Additionally, we have used a collection of knock outs in order to have genetic negative control that help us confirm that the light effect is not an artifact.

[http://partsregistry.org/wiki/index.php?title=Part:BBa_K222000 Aequorin.GIF]


a 3D model of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K222000 aequorin], our outstanding BioBrick contribution to the Registry.

Retrieved from "http://2009.igem.org/Team:Valencia/Parts"