Team:LCG-UNAM-Mexico:Journals:Uriel
From 2009.igem.org
(Difference between revisions)
(→August 18, 2009) |
(→References) |
||
(182 intermediate revisions not shown) | |||
Line 1: | Line 1: | ||
{{Template:LCG_top_Netscape}}<!--Do not remove the first and last lines in this page!--> | {{Template:LCG_top_Netscape}}<!--Do not remove the first and last lines in this page!--> | ||
- | |||
- | |||
- | |||
+ | == '''Uriel's lab journal''' == | ||
+ | == '''Objectives''' == | ||
- | + | Construction of the phage production control system. | |
+ | |||
+ | In order to produce a grate amount of [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains P4] phage particles that has our death system, we want to avoid the natural | ||
+ | early lysis that occur when WT [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains P4] and [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains P2] interact. This avoidance will be achieved by taking the control of the | ||
+ | two major regulators of [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains P2] morphopoietic genes. The control systems that is going to be implemented is constituted | ||
+ | by a promoter inducible by IPTG in conjunction with transactivators [http://partsregistry.org/Part:BBa_K242002 cox] and [http://partsregistry.org/Part:BBa_K242001 ogr] from phage [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains P2]. All this will | ||
+ | allow us to grow bacteria in grate quantities and induce lysis when ever we want and as a consequence the | ||
+ | production of grate amounts of [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains P4] phage. | ||
+ | |||
+ | Qualitative characterization of the [http://partsregistry.org/Part:BBa_K242100 multipromoter]. | ||
+ | |||
+ | The multipromoter that we have designed has the capacity to respond specifically to T3/T7 RNA polymerases | ||
+ | so if one or both polymarease are presente in the cell the genes downstream of this promoter will be active. | ||
+ | A first characterization approach is the introduction of a plasmid carring our promoter in the E. coli strain | ||
+ | BL21(DE3)pLysS that has a T7 RNA polymerase inducible by IPTG | ||
+ | |||
+ | == July 30, 2009 == | ||
+ | |||
+ | '''Primers for P2 [http://partsregistry.org/Part:BBa_K242002 cox] and [http://partsregistry.org/Part:BBa_K242001 ogr] genes arrived so we can start to construct the phage production system control.''' | ||
To attain control of phage production we are going to put under | To attain control of phage production we are going to put under | ||
an IPTG inducible promoter the genes that codify for the | an IPTG inducible promoter the genes that codify for the | ||
- | principal regulators of the morphopoietic genes. | + | principal regulators of the morphopoietic genes and delete genes that doesn't belongs to the morphopoietic group |
+ | this part will be done by [[Team:LCG-UNAM-Mexico/Team/Laura|Laura Gomez]]. | ||
- | The genes that codify for this regulators are going to be amplified via colony PCR from the E. coli C-177 strain, which | + | The genes that codify for this regulators are going to be amplified via colony PCR from the E. coli [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains C-177] strain, which |
- | has a lysogenic form of phage P2. The primers | + | has a lysogenic form of phage [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains P2]. The primers |
that we are using amplify the genes with its WT RBS's and also introduce an extra stop codon as required by the standardization | that we are using amplify the genes with its WT RBS's and also introduce an extra stop codon as required by the standardization | ||
protocol and also de suffix and prefix iGEM sequences. | protocol and also de suffix and prefix iGEM sequences. | ||
- | It is known that C-1a strain neither has a cox gene nor [http://partsregistry.org/Part:BBa_K242001 ogr] gene while K-12 strain | + | It is known that [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains C-1a] strain neither has a [http://partsregistry.org/Part:BBa_K242002 cox] gene nor an [http://partsregistry.org/Part:BBa_K242001 ogr] gene while [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains C-1a K-12] strain |
contain a copy of [http://partsregistry.org/Part:BBa_K242001 ogr] in its genome. We have performed a colony PCR over the | contain a copy of [http://partsregistry.org/Part:BBa_K242001 ogr] in its genome. We have performed a colony PCR over the | ||
- | next strains, looking for ogr and [http://partsregistry.org/Part:BBa_K242002 cox]. | + | next strains, looking for [http://partsregistry.org/Part:BBa_K242001 ogr] and [http://partsregistry.org/Part:BBa_K242002 cox]. |
Genes: | Genes: | ||
Line 30: | Line 48: | ||
Strains: | Strains: | ||
- | C-1a | + | [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains C-1a] |
- | C-117 | + | [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains C-117] |
- | DH5alpha | + | [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains DH5alpha] |
+ | == July 31, 2009 == | ||
- | + | Colony PCR is going to be done with strain [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains C-1a] and [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains C-117] as a control [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains DH5alpha] which has 17, we are going | |
+ | to confirm that [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains C-1a] doesn't has a [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains P2] by means of PCR for [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains P2] [http://partsregistry.org/Part:BBa_K242002 cox] and [http://partsregistry.org/Part:BBa_K242001 ogr] genes. | ||
+ | Primers: | ||
+ | |||
+ | Cox: | ||
+ | |||
+ | >for_pre+rbs+cox_P2 | ||
+ | |||
+ | GTTTCTTCGAATTCGCGGCCGCTTCTAGGGGGCTAGAGGACGACATGAG | ||
+ | |||
+ | >rev_suf+dSTOP+cox_P2 | ||
+ | |||
+ | GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAACGTGGTTCACCGAGAC | ||
+ | |||
+ | Ogr: | ||
+ | |||
+ | >Forward_OGR | ||
+ | |||
+ | GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCCGGAAGAGGTGCTCGCGATG | ||
+ | |||
+ | >Reverse_OGR | ||
+ | |||
+ | GTTTCTTCCTGCAGCGGCCGCTACTAGTATTA,TTACATCCACATAATTTGCTGCCC | ||
+ | |||
+ | Expected Regions: | ||
+ | |||
+ | Cox: | ||
+ | |||
+ | [[Image:Cox.jpg|800px]] | ||
+ | |||
+ | |||
+ | Ogr: | ||
+ | |||
+ | [[Image:Ogr.jpg|800px]] | ||
+ | |||
+ | Strains were platted on June 19, 2009 and were maintained at 4ºC and also a glycerol stock was created for | ||
+ | [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains C-1a] and [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains C-117]. With a wood stick bacteria was taken and inoculated in LB without any selection. | ||
+ | |||
+ | The inoculated medium was incubated at 37ºC 250 rpm. for 1 hr. and then centrifuged at maximum speed with | ||
+ | a tabletop centrifuge, supernatant was discarded and 200 µL of Tris-EDTA 10/1-NaCl 10mM added. The samples | ||
+ | were heated over 10 min at 95ºC and then centrifuged again 2 min. 10µL of supernatant were taken for the PCR. | ||
+ | |||
+ | |||
+ | PCR Reaction: | ||
+ | |||
+ | Water 24µL | ||
+ | Buffer 10x 5µL | ||
+ | MgCl2 50mM 2.5µL | ||
+ | dNTP's 0.4mM 3.5µL | ||
+ | Taq 1µL | ||
+ | primer up 2.5µL | ||
+ | primer low 2.5µL | ||
+ | DNA 10µL | ||
+ | Total 50µL | ||
Line 42: | Line 114: | ||
Control - | Control - | ||
- | C-117/[http://partsregistry.org/Part:BBa_K242001 ogr] + | + | [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains C-117]/[http://partsregistry.org/Part:BBa_K242001 ogr] + |
- | C-1a/[http://partsregistry.org/Part:BBa_K242001 ogr] - | + | [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains C-1a]/[http://partsregistry.org/Part:BBa_K242001 ogr] - |
- | DH5alpha/[http://partsregistry.org/Part:BBa_K242001 ogr] + | + | [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains DH5alpha]/[http://partsregistry.org/Part:BBa_K242001 ogr] + |
- | C-117/[http://partsregistry.org/Part:BBa_K242002 cox] + | + | [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains C-117]/[http://partsregistry.org/Part:BBa_K242002 cox] + |
- | C-1a/[http://partsregistry.org/Part:BBa_K242002 cox] - | + | [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains C-1a]/[http://partsregistry.org/Part:BBa_K242002 cox] - |
- | DH5alpha/[http://partsregistry.org/Part:BBa_K242002 cox] - | + | [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains DH5alpha]/[http://partsregistry.org/Part:BBa_K242002 cox] - |
The PCR's were consistent with previous results in literature. For example | The PCR's were consistent with previous results in literature. For example | ||
- | ogr was positive for DH5alpha which is a derivative from K-12 and we could | + | [http://partsregistry.org/Part:BBa_K242001 ogr] was positive for [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains DH5alpha] which is a derivative from [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains K-12] and we could |
- | not obtain PCR products from C-1a. C-117 which has P2 in lysogenic state gave use positive PCR products for ogr and [http://partsregistry.org/Part:BBa_K242002 cox]. | + | not obtain PCR products from [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains C-1a]. [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains C-117] which has [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains P2] in lysogenic state gave use positive PCR products for [http://partsregistry.org/Part:BBa_K242001 ogr] and [http://partsregistry.org/Part:BBa_K242002 cox]. |
== August 3, 2009 == | == August 3, 2009 == | ||
- | We prepared overnights of DH5alpha which contain the BioBricks | + | We prepared overnights of DH5alpha which contain the BioBricks [http://partsregistry.org/Part:pSB1AK3 pSB1AK3] and [http://partsregistry.org/Part:pSB1T3 pSB1T3] |
the selective medium was 50µL/mL Kanamycin and 20µL/mL Tetracycline respectively | the selective medium was 50µL/mL Kanamycin and 20µL/mL Tetracycline respectively | ||
Line 62: | Line 134: | ||
== August 4, 2009 == | == August 4, 2009 == | ||
+ | [[Image:5-ago-dr para ligar.jpg|200px]] | ||
- | We redo the colony PCR for ogr and cox only using the C-117 strain. The PCR | + | We redo the colony PCR for [http://partsregistry.org/Part:BBa_K242001 ogr] and [http://partsregistry.org/Part:BBa_K242002 cox] only using the [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains C-117] strain. The PCR |
products were purified using the High Pure PCR Product Roche's Purification Kit and also plasmidic DNA was | products were purified using the High Pure PCR Product Roche's Purification Kit and also plasmidic DNA was | ||
purified from the last overnights using the High Pure Plasmid Roche's Isolation Kit. The plasmids that were purified | purified from the last overnights using the High Pure Plasmid Roche's Isolation Kit. The plasmids that were purified | ||
- | are going to used to add a double terminator sequence to ogr and clone [http://partsregistry.org/Part:BBa_K242002 cox] for future manipulations. | + | are going to used to add a double terminator sequence to [http://partsregistry.org/Part:BBa_K242001 ogr] and clone [http://partsregistry.org/Part:BBa_K242002 cox] for future manipulations. |
1) [http://partsregistry.org/Part:BBa_K242001 ogr] EcoRI/SpeI | 1) [http://partsregistry.org/Part:BBa_K242001 ogr] EcoRI/SpeI | ||
Line 81: | Line 154: | ||
Total 20µL | Total 20µL | ||
- | Vectors that will be use for cloning were | + | Vectors that will be use for cloning were dephosphorylated with Antarctic Phosphatase |
to avoid as much as possible false positives and also screening to many colonies. | to avoid as much as possible false positives and also screening to many colonies. | ||
Line 102: | Line 175: | ||
Parts were ligated in the following way: | Parts were ligated in the following way: | ||
- | 1) ogr+[http://partsregistry.org/Part:BBa_B0015 BBa_B0015]+ | + | 1) [http://partsregistry.org/Part:BBa_K242001 ogr]+[http://partsregistry.org/Part:BBa_B0015 BBa_B0015]+[http://partsregistry.org/Part:pSB1T3 pSB1T3] |
- | 2) [http://partsregistry.org/Part:BBa_K242002 cox]+ | + | 2) [http://partsregistry.org/Part:BBa_K242002 cox]+[http://partsregistry.org/Part:pSB1T3 pSB1T3] |
Ligation Reactions: | Ligation Reactions: | ||
Line 111: | Line 184: | ||
Buffer 4µL | Buffer 4µL | ||
Ligase 1µL | Ligase 1µL | ||
- | + | [http://partsregistry.org/Part:pSB1T3 pSB1T3] 2µL | |
[http://partsregistry.org/Part:BBa_K242001 ogr] 6µL | [http://partsregistry.org/Part:BBa_K242001 ogr] 6µL | ||
[http://partsregistry.org/Part:BBa_B0015 BBa_B0015] 7µL | [http://partsregistry.org/Part:BBa_B0015 BBa_B0015] 7µL | ||
Line 121: | Line 194: | ||
Buffer 4µL | Buffer 4µL | ||
Ligase 1µL | Ligase 1µL | ||
- | + | [http://partsregistry.org/Part:pSB1T3 pSB1T3] 3µL | |
[http://partsregistry.org/Part:BBa_K242002 cox] 6µL | [http://partsregistry.org/Part:BBa_K242002 cox] 6µL | ||
Weter 6µL | Weter 6µL | ||
Line 128: | Line 201: | ||
The las reaction gave as a result the next parts: | The las reaction gave as a result the next parts: | ||
- | 1)[http://partsregistry.org/Part:BBa_K242001 ogr]+ | + | 1)[http://partsregistry.org/Part:BBa_K242001 ogr]+[http://partsregistry.org/Part:BBa_B0015 BBa_B0015]+[http://partsregistry.org/Part:pSB1T3 pSB1T3] |
- | 2)[http://partsregistry.org/Part:BBa_K242002 cox]+ | + | 2)[http://partsregistry.org/Part:BBa_K242002 cox]+[http://partsregistry.org/Part:pSB1T3 pSB1T3] |
- | DH5alpha competent cells were transformed and platted on LB Agar with appropriate selection, for both constructions this selection was Tetracycline. | + | [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains DH5alpha] competent cells were transformed and platted on LB Agar with appropriate selection, for both constructions this selection was Tetracycline. |
== August 6, 2009 == | == August 6, 2009 == | ||
- | The [http://partsregistry.org/Part:BBa_K242001 ogr] PCR product was cut with EbaI/PstI and cloned in | + | The [http://partsregistry.org/Part:BBa_K242001 ogr] PCR product was cut with EbaI/PstI and cloned in [http://partsregistry.org/Part:pSB1T3 pSB1T3] that was digested with the same enzymes and dephosphorylated as mentioned earlier. |
And then we performed a ligation reaction. The resulting BioBrick was named I-09#021. | And then we performed a ligation reaction. The resulting BioBrick was named I-09#021. | ||
Line 151: | Line 224: | ||
A 1% agarose gel was prepared and run 1 hr. 85 V. to see the | A 1% agarose gel was prepared and run 1 hr. 85 V. to see the | ||
insert and plasmid concentration. Unfortunately we loose our | insert and plasmid concentration. Unfortunately we loose our | ||
- | ogr's PCR product so we performed a new PCR only for this gene. | + | [http://partsregistry.org/Part:BBa_K242001 ogr's] PCR product so we performed a new PCR only for this gene. |
Line 157: | Line 230: | ||
- | The PCR for ogr was done using the DNA from strain C-117. | + | The PCR for [http://partsregistry.org/Part:BBa_K242001 ogr] was done using the DNA from strain [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains C-117]. |
PCR Reaction: | PCR Reaction: | ||
- | + | ||
Water 23µL | Water 23µL | ||
Buffer 5µL | Buffer 5µL | ||
Line 169: | Line 242: | ||
DNA 10µL | DNA 10µL | ||
Total 50µL | Total 50µL | ||
- | + | ||
- | + | [[Image:7ago-ogr-pcr-c117.jpg|300px]] | |
+ | PCR: | ||
+ | |||
1) Control + | 1) Control + | ||
2) C-117/[http://partsregistry.org/Part:BBa_K242001 ogr] + | 2) C-117/[http://partsregistry.org/Part:BBa_K242001 ogr] + | ||
Line 179: | Line 254: | ||
An Agarose gel was run and we find that one of our reactants was contaminated because our negative control was positive | An Agarose gel was run and we find that one of our reactants was contaminated because our negative control was positive | ||
- | that PCR is going to be repeated but with different reactants | + | that PCR is going to be repeated but with different reactants |
- | + | ||
== August 10, 2009 == | == August 10, 2009 == | ||
+ | We are going to change the PCR reagents because we don't know if they are contaminated and perform the next | ||
+ | PCR reaction. | ||
- | The PCR for ogr was done again and everything looked OK so we purified the PCR | + | Reagents to be changed: |
- | + | ||
+ | 1)primers for [http://partsregistry.org/Part:BBa_K242002 cox] and [http://partsregistry.org/Part:BBa_K242001 ogr] | ||
+ | 2)buffer 10X | ||
+ | 3)MgCl2 | ||
+ | |||
+ | I'm going to do again the PCR for [http://partsregistry.org/Part:BBa_K242001 ogr] and [http://partsregistry.org/Part:BBa_K242002 cox] only from [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains C-117] and as a control [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains C-1a] and [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains DH5alpha] the former control neither has a [http://partsregistry.org/Part:BBa_K242002 cox] gene nor an [http://partsregistry.org/Part:BBa_K242001 ogr] gene. | ||
+ | |||
+ | PCR Reactions: 1) 2) 3) 4) 5) 6) 7) 8) 9) 10) | ||
+ | |||
+ | Water 23µL + + + + + + + + + + | ||
+ | Buffer 10X 5µL + + + + + + + + + + | ||
+ | MgCl2 2.5µL + + + + + + + + + + | ||
+ | dNTP's 3.5µL + + + + + + + + + + | ||
+ | Taq 1µL + + + + + + + + + + | ||
+ | primer fw 2.5µL + + + + + + + + + + | ||
+ | primer rev 2.5µL + + + + + + + + + + | ||
+ | DNA tamplate 10µL - - + + + + + + + + | ||
+ | |||
+ | 1)control for [http://partsregistry.org/Part:BBa_K242002 cox] only primers | ||
+ | 2)control for [http://partsregistry.org/Part:BBa_K242001 ogr] only primers | ||
+ | 3)control for [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains DH5alpha] [http://partsregistry.org/Part:BBa_K242001 ogr] it must be positive | ||
+ | 4)control for [http://partsregistry.org/Part:BBa_K242001 ogr] & [http://partsregistry.org/Part:BBa_K242002 cox] with strain [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains C-1a] it must be negative | ||
+ | 5-7)PCR of interest positive for [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains C-117] [http://partsregistry.org/Part:BBa_K242001 ogr] gene | ||
+ | 8-10)PCR of interest positive for [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains C-117] [http://partsregistry.org/Part:BBa_K242002 cox] gene | ||
+ | |||
+ | == August 11, 2009 == | ||
+ | |||
+ | [[Image:11ago-ligscion5-6--18-otros uriel.jpg|400px]] | ||
+ | |||
+ | The PCR for [http://partsregistry.org/Part:BBa_K242001 ogr] was done again and everything looked OK so we purified the PCR | ||
+ | products with the High Pure PCR Product Roche's Purification Kit. An Agarose gel | ||
was run to see how much DNA was lost during the purification procedure and | was run to see how much DNA was lost during the purification procedure and | ||
the using this information to add the right amount of restriction enzymes. | the using this information to add the right amount of restriction enzymes. | ||
- | 14 | + | The first three lanes are [http://partsregistry.org/Part:BBa_K242002 cox], [http://partsregistry.org/Part:BBa_K242001 ogr] and [http://partsregistry.org/Part:BBa_K242001 ogr]+[http://partsregistry.org/Part:BBa_B0015 BBa_B0015] amplified using the prefix and suffix |
+ | primer for these genes | ||
+ | |||
+ | == Agust 13, 2009 == | ||
+ | |||
+ | Plasmid 18 was dephosphorylated because we are going to insert in it the [http://partsregistry.org/Part:BBa_K242001 ogr] product that was amplified yesterday. | ||
+ | |||
+ | Dephosphorylation Reaction: | ||
+ | |||
+ | Plasmid 20µL | ||
+ | Buffer 3µL | ||
+ | Enzyme 1µL | ||
+ | Water 6µL | ||
+ | |||
+ | Incubation: | ||
+ | |||
+ | 1)15 min --> 37ºC | ||
+ | 2)5 min --> 65ºC | ||
+ | |||
+ | This plasmid that is going to be ligated with [http://partsregistry.org/Part:BBa_K242001 ogr] is digested EcoRI/PstI. | ||
+ | |||
+ | [http://partsregistry.org/Part:BBa_K242002 cox] was cut with EcoRI/SpeI and the plasmid that contain [http://partsregistry.org/Part:BBa_K242001 ogr]+[http://partsregistry.org/Part:BBa_B0015 BBa_B0015] with EcoRI/XbaI because we are | ||
+ | going to insert [http://partsregistry.org/Part:BBa_K242002 cox] into this plasmid in order to concatenate [http://partsregistry.org/Part:BBa_K242002 cox]+[http://partsregistry.org/Part:BBa_K242001 ogr]+BBa_B0015. | ||
+ | |||
+ | [[Image:14ago09-ogrEP-18EP-coxES-12EX.jpg|300px]] | ||
+ | |||
+ | == August 14, 2009 == | ||
- | Vector | + | Vector [http://partsregistry.org/Part:pSB1T3 pSB1T3] was dephosphorylated and again a 1% Agarose gel was run with the vector and |
- | the ogr PCR product to check concentrations and posterior to this a ligation reaction was | + | the [http://partsregistry.org/Part:BBa_K242001 ogr] PCR product to check concentrations and posterior to this a ligation reaction was |
performed. | performed. | ||
Line 205: | Line 337: | ||
Buffer 2µL | Buffer 2µL | ||
[http://partsregistry.org/Part:BBa_K242001 ogr] 2µL | [http://partsregistry.org/Part:BBa_K242001 ogr] 2µL | ||
- | + | [http://partsregistry.org/Part:pSB1T3 pSB1T3] 5µL | |
Water 10µL | Water 10µL | ||
Total 20µL | Total 20µL | ||
- | Once the ligation reaction finished we transformed DH5alpha competent cells and platted them on selective medium. | + | Once the ligation reaction finished we transformed [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains DH5alpha] competent cells and platted them on selective medium. |
Line 217: | Line 349: | ||
We started to prepare glycerol for the BrioBricks and Strains that we have finished to store them at -70ºC. | We started to prepare glycerol for the BrioBricks and Strains that we have finished to store them at -70ºC. | ||
- | The | + | The [http://partsregistry.org/Part:BBa_R0010 BBa_R0010]/[http://partsregistry.org/Part:pSB1A2 pSB1A2] which has an IPTG inducible promoter is going to be purified and digested to put under |
- | the control of | + | the control of this promoter the construction [http://partsregistry.org/Part:BBa_K242002 cox]+[http://partsregistry.org/Part:BBa_K242001 ogr]+[http://partsregistry.org/Part:BBa_B0015 BBa_B0015]. |
The plasmid was digested with SpeI/PstI and the insert with XbaI/PstI. | The plasmid was digested with SpeI/PstI and the insert with XbaI/PstI. | ||
- | To construct cox+[http://partsregistry.org/Part:BBa_K242001 ogr]+[http://partsregistry.org/Part:BBa_B0015 BBa_B0015] we took cox that was in | + | To construct [http://partsregistry.org/Part:BBa_K242002 cox]+[http://partsregistry.org/Part:BBa_K242001 ogr]+[http://partsregistry.org/Part:BBa_B0015 BBa_B0015] we took [http://partsregistry.org/Part:BBa_K242002 cox] that was in [http://partsregistry.org/Part:pSB1T3 pSB1T3] and [http://partsregistry.org/Part:BBa_K242001 ogr]+[http://partsregistry.org/Part:BBa_B0015 BBa_B0015] also in [http://partsregistry.org/Part:pSB1T3 pSB1T3] |
and perform the following reactions: | and perform the following reactions: | ||
Restriction Reaction: | Restriction Reaction: | ||
- | + | Resistance | |
- | + | [http://partsregistry.org/Part:pSB1T3 pSB1T3]+[http://partsregistry.org/Part:BBa_K242001 ogr]+[http://partsregistry.org/Part:BBa_B0015 BBa_B0015] XbaI/PstI Tet | |
- | + | [http://partsregistry.org/Part:pSB1T3 pSB1T3]+[http://partsregistry.org/Part:BBa_K242002 cox] EcoRI/SpeI Tet | |
- | + | [http://partsregistry.org/Part:pSB1C3 pSB1C3] EcoRI/PstI Cm | |
- | We expect white colonies and resistant to Cm because | + | We expect white colonies and resistant to Cm because [http://partsregistry.org/Part:pSB1C3 pSB1C3] has cloned an RFP protein that |
is expressed constitutively. | is expressed constitutively. | ||
Line 241: | Line 373: | ||
leading this to the need of doing again the whole construction from a previous step. | leading this to the need of doing again the whole construction from a previous step. | ||
- | DH5alpha strains that contain the listed plasmids below were grown in selective media and plasmid | + | [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains DH5alpha] strains that contain the listed plasmids below were grown in selective media and plasmid |
purification was performed and afterwards it was digested. | purification was performed and afterwards it was digested. | ||
+ | |||
+ | |||
Plasmids: | Plasmids: | ||
- | 1) | + | 1) ogr XbaI/PstI |
- | 2) | + | 2) ogr+pSB1CB XbaI/PstI |
- | 3) | + | 3) ogr+pSB1CB EcoRI/PstI |
- | 4) | + | 4) ogr+pSB1CB EcoRI/PstI |
- | 5) | + | 5) ogr+pSB1CB EcoRI/PstI |
- | 6) | + | 6) BBa_J04450 EcoRI/PstI |
- | 7) | + | 7) ogr+BBa_PB1005 EcoRI/PstI |
- | 8) | + | 8) BBa_J04450 EcoRI/PstI |
+ | 9) cox | ||
Restriction Reactions: | Restriction Reactions: | ||
Line 264: | Line 399: | ||
Total 40µL | Total 40µL | ||
- | == August | + | == August 21, 2009 == |
An 1% Agarose gel was run for 1hr. at 85 V. | An 1% Agarose gel was run for 1hr. at 85 V. | ||
- | With this gel was confirmed that ogr is cloned in | + | With this gel was confirmed that [http://partsregistry.org/Part:BBa_K242001 ogr] is cloned in [http://partsregistry.org/Part:pSB1T3 pSB1T3] and now we can make a glycerol for this strain. |
- | + | [[Image:21-08-09--ogrpcr-4xogr+18-17-cox-17-ogr+ter.jpg|200px ]] | |
- | The | + | First nine lanes interest. |
+ | |||
+ | == 24 Ago 2009 == | ||
+ | |||
+ | The pSB1C3 was dephosphorylated with antarctic phosphate | ||
Dephospohrialtion Reaction: | Dephospohrialtion Reaction: | ||
Line 288: | Line 427: | ||
2) 5 min --> 65ºC | 2) 5 min --> 65ºC | ||
- | After plasmid dephosphorialtion we are going to perform a ligation reaction between | + | After plasmid dephosphorialtion we are going to perform a ligation reaction between cox and ogr+BBa_0015 |
== August 25, 2009 == | == August 25, 2009 == | ||
Line 304: | Line 443: | ||
Water 9µL | Water 9µL | ||
Total 20µL | Total 20µL | ||
- | + | ||
Incubation: | Incubation: | ||
Line 316: | Line 455: | ||
- | We platted DH5alpha transformed cells over selective medium and incubate the plates overnight at 37ºC. | + | We platted [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains DH5alpha] transformed cells over selective medium and incubate the plates overnight at 37ºC. |
+ | == August 27, 2009 == | ||
+ | Plasmid extraction | ||
+ | |||
+ | [[Image:3x024-pcrcontrol-x007.jpg|250px]] | ||
== August 29, 2009 == | == August 29, 2009 == | ||
Line 342: | Line 485: | ||
We run a 1% Agarose gel at 85 V. 1hr | We run a 1% Agarose gel at 85 V. 1hr | ||
- | + | [[Image:Ogr+ter-cox-17dfos.jpg|250px]] | |
- | + | ||
+ | Unfortunately [http://partsregistry.org/Part:BBa_K242002 cox]+[http://partsregistry.org/Part:BBa_K242001 ogr]+BBa_B0015 cloning by fusing [http://partsregistry.org/Part:BBa_K242002 cox] and [http://partsregistry.org/Part:BBa_K242001 ogr]+BBa_B0015 in another plasmid | ||
+ | didn't work out. We will try to repeat the procedure to see if we are luckier. | ||
== September 7, 2009 == | == September 7, 2009 == | ||
- | Again we dephophorylated vector I-09#017 to ligate it with cox and ogr+ | + | Again we dephophorylated vector I-09#017 to ligate it with [http://partsregistry.org/Part:BBa_K242002 cox] and [http://partsregistry.org/Part:BBa_K242001 ogr]+BBa_B0015 and then perform a transformation |
Dephosphorylation Reaction: | Dephosphorylation Reaction: | ||
Line 386: | Line 530: | ||
- | We platted DH5alpha transformed cells over selective medium and | + | We platted DH5alpha transformed cells over selective medium and incubated overnight at 37ºC. |
- | == September 11, | + | == September 11, 2009 == |
+ | [[Image:Ligacion-cox+ogr+ter.jpg|400px]] [[Image:18cox+ogr+tercontinuacion.jpg|161px]] | ||
Colony PCR reactions were done with selected colonies that resulted from the last transformation | Colony PCR reactions were done with selected colonies that resulted from the last transformation | ||
- | the resulting and tow of the twenty-one looked like they contained [http://partsregistry.org/Part:BBa_K242002 cox]+[http://partsregistry.org/Part:BBa_K242001 ogr]+[http://partsregistry.org/Part:BBa_B0015 BBa_B0015] verification | + | the resulting and tow of the twenty-one looked like they contained [http://partsregistry.org/Part:BBa_K242002 cox]+[http://partsregistry.org/Part:BBa_K242001 ogr]+[http://partsregistry.org/Part:BBa_B0015 BBa_B0015] verification |
- | a restriction assay was done and. | + | with a restriction assay was done and also [http://partsregistry.org/Part:BBa_K242001 ogr]+BBa_B0015+18 was purified and opened digested with EcoRI/PstI to be prepared |
+ | in case last ligation don't work. | ||
+ | |||
+ | |||
+ | == September 15, 2009 == | ||
+ | |||
+ | The ligation didn't work, I planned to follow a different strategy first purify the [http://partsregistry.org/Part:BBa_K242002 cox] fragment using Low melt point Agarose, we are using this procedure because the plasmido that contain [http://partsregistry.org/Part:BBa_K242002 cox] is the samen as the one that has [http://partsregistry.org/Part:BBa_K242001 ogr]+BBa_B0015 and | ||
+ | as a consequence the same antibiotic resistance gene, so by separating the DNA by electrophoresis we can take apart [http://partsregistry.org/Part:BBa_K242002 cox] gene and the ligated in to the dephoshorylated plasmid [http://partsregistry.org/Part:BBa_K242001 ogr]+BBa_B0015 that was digested EcoRI/XbaI, the resultin plasmid will be [http://partsregistry.org/Part:BBa_K242002 cox]+[http://partsregistry.org/Part:BBa_K242001 ogr]+BBa_B0015. | ||
+ | |||
+ | == September 22, 2009 == | ||
+ | |||
+ | Band purification: | ||
+ | |||
+ | Quiagen gel exration kit was used for this. | ||
+ | |||
+ | An 1% Low melt point agarose gel was loaded with the sample that contained [http://partsregistry.org/Part:BBa_K242002 cox]+18, the gel was stained with ethdium | ||
+ | bromaid and saw with a transluminator. Once we saw our band it was cut from the gel and transferred to an 1.5 mL tube | ||
+ | and weighted (0.13g) in the kit protocol they propose an equivalences of buffer 100mg~100µL so we have to add 3 volumes | ||
+ | of each 130µL of buffer and follow the kit protocol. | ||
+ | |||
+ | == September 23, 2009 == | ||
+ | |||
+ | A ligation is going to be done with [http://partsregistry.org/Part:BBa_K242002 cox] and [http://partsregistry.org/Part:BBa_K242001 ogr]+BBa_B0015, [http://partsregistry.org/Part:BBa_K242001 ogr]+BBa_B0015+18 was dephosphorylated and [http://partsregistry.org/Part:BBa_K242002 cox] was purified via gel. As a control we will try to religate the dephosphorylated plasmid, the same plasmid not dephosphorylated and a uncut plasmid | ||
+ | which must transform because was not digested. | ||
+ | |||
+ | Ligation Reaction: | ||
+ | |||
+ | T4 ligase 1µL | ||
+ | Buffer 2µL | ||
+ | [http://partsregistry.org/Part:BBa_K242001 ogr]+BBa_B0015 2µL | ||
+ | [http://partsregistry.org/Part:BBa_K242002 cox] 5µL | ||
+ | Water 10µL | ||
+ | Total 20µL | ||
+ | |||
+ | Controls: | ||
+ | |||
+ | 1)dephosphorylated plasmid 2)non-dephosphorylated | ||
+ | |||
+ | T4 ligase 1µL T4 ligase 1µL | ||
+ | Buffer 2µL Buffer 2µL | ||
+ | Plasmid 2µL Plasmid 2µL | ||
+ | Water 15µL Water 15µL | ||
+ | Total 20µL Total 20µL | ||
+ | |||
+ | Incubation: | ||
+ | |||
+ | 1)10 min --> 25ºC | ||
+ | 2)20 min --> 65ºC | ||
+ | |||
+ | [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains DH5alpha] competent cells were transformed and platted over selective media in this case Tet. | ||
+ | |||
+ | == September 24, 2009 == | ||
+ | |||
+ | All controls resulted as expected so the must probable is that we achieved to ligate [http://partsregistry.org/Part:BBa_K242002 cox] with [http://partsregistry.org/Part:BBa_K242001 ogr]+BBa_B0015+18 | ||
+ | I prepared overnights to extract plasmid tomorrow and perform a restriction assay to see if we have the fragment | ||
+ | of interest. | ||
+ | |||
+ | [[Image:Cox+ogr+ter4.JPG|230px]] | ||
+ | |||
+ | == September 25, 2009 == | ||
+ | |||
+ | To check last ligations a restriction assay is going to be done in a way that allows us to do the next | ||
+ | ligation and finish the phage production control system. | ||
+ | |||
+ | Restriction Reactions: | ||
+ | |||
+ | 1)XbaI/PstI [http://partsregistry.org/Part:BBa_K242002 cox]+18 2)XbaI/PstI [http://partsregistry.org/Part:BBa_K242002 cox]+[http://partsregistry.org/Part:BBa_K242001 ogr]+BBa_B0015 colonies[1-6] | ||
+ | Buffer 2 2µL Buffer2 2µL | ||
+ | BSA 0.2µL BSA 0.2µL | ||
+ | Water 6.8µL Water 6.8µL | ||
+ | DNA 10µL DNA 10µL | ||
+ | Enzyme 0.5µL each(X/P) Enzyme 0.5µL each(X/P) | ||
+ | Total 20µl Total 20µL | ||
+ | |||
+ | |||
+ | [[Image:Gel resuelto.JPG|240px]] | ||
+ | |||
+ | As the image show on the first 7 lanes we were able to ligate [http://partsregistry.org/Part:BBa_K242002 cox] with [http://partsregistry.org/Part:BBa_K242001 ogr]+BBa_B0015+18 every of the | ||
+ | selected clones has the [http://partsregistry.org/Part:BBa_K242002 cox] insert so this procedure was faster than the fisr that we tried to use | ||
+ | the only thing is that you need to purify the insert via an Agarose gel and the ligate it to the | ||
+ | plasmid of interest. | ||
+ | |||
+ | We are ready for the last step, we are going to add the IPTG inducible promoter to get the following structure. | ||
+ | |||
+ | '''iptg+cox+ogr+ter''' | ||
+ | |||
+ | The second lane sample was selected for ligation with IPTG | ||
+ | |||
+ | Ligation Reaction: | ||
+ | |||
+ | T4 ligase 1µL | ||
+ | Buffer 2µL | ||
+ | [http://partsregistry.org/Part:BBa_K242002 cox]+[http://partsregistry.org/Part:BBa_K242001 ogr]+BBa_B0015 5µL | ||
+ | iptg 5µL | ||
+ | Water 10µL | ||
+ | Total 20µL | ||
+ | |||
+ | DH5alpha competent cells were transformed and platted over LB Amp100 and incubate at 37ºC | ||
+ | |||
+ | == September 28, 2009 == | ||
+ | |||
+ | Controls were inconsistent in particular the re-ligation of dephosphorylated plasmid which gave | ||
+ | the same amount of colonies compared with ligation of [http://partsregistry.org/Part:BBa_K242002 cox]+[http://partsregistry.org/Part:BBa_K242001 ogr]+BBa_B0015 and 12 so we are going to | ||
+ | re-dephosphorylate the vector 12 and perform a new ligation reaction. | ||
+ | |||
+ | Dephosphorylation Reaction: | ||
+ | |||
+ | Plasmid 10µL | ||
+ | Buffer 3µL | ||
+ | Enzyme 1µL | ||
+ | Water 16µL | ||
+ | Total 30µL | ||
+ | |||
+ | Incubation | ||
+ | 1)10 min --> 25ºC | ||
+ | 2)20 min --> 65ºC | ||
+ | |||
+ | A 1% agarose gel was run to see the concetration of the plasmid and the insert, this to put | ||
+ | the right amounts of insert and plasmid. | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | The samples that we are looking on the gel correspon to [http://partsregistry.org/Part:BBa_K242002 cox]+[http://partsregistry.org/Part:BBa_K242001 ogr]+[http://partsregistry.org/Part:BBa_B0015 BBa_B0015]+18 digested with XbaI/SpeI and 12 | ||
+ | |||
+ | Once we checked concetrations we can do the ligation reaction. | ||
+ | |||
+ | Ligation Reaction: | ||
+ | |||
+ | T4 ligase 1µL | ||
+ | Buffer 2µL | ||
+ | [http://partsregistry.org/Part:BBa_K242002 cox]+[http://partsregistry.org/Part:BBa_K242001 ogr]+[http://partsregistry.org/Part:BBa_B0015 BBa_B0015] 12µL | ||
+ | 12 4µL | ||
+ | Water 1µL | ||
+ | Total 30µL | ||
+ | |||
+ | [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains DH5alpha] competent cells were transformed on LB agar Amp100 and incubated overnight 37ºC | ||
+ | |||
+ | == September 29, 2009 == | ||
+ | |||
+ | Four colonies were selected an re-platted and also liquid 5 mL of LB was inoculated to prepare cultures | ||
+ | for plasmid extraction. | ||
+ | |||
+ | == September 30, 2009 == | ||
+ | |||
+ | An 1% Agarose gel was run to check concentrations for restriction assays and by this be able to know if we have | ||
+ | the fragment we are interested. | ||
+ | |||
+ | The four plasmids were digested EcoRI/PstI | ||
+ | |||
+ | Restriction Reactions: | ||
+ | |||
+ | Buffer 2µL | ||
+ | BSA 0.2µL | ||
+ | DNA 10µL | ||
+ | Enzyme 1µL each EcoRI/PstI | ||
+ | Water 5.8µL | ||
+ | |||
+ | [[Image:12oct09-iptg-cox+ogr+ter-final.jpg|200px]] | ||
+ | |||
+ | The insert looks shifted upwards but a little amount so we didn't achieve to ligate the iptg to [http://partsregistry.org/Part:BBa_K242002 cox]+[http://partsregistry.org/Part:BBa_K242001 ogr]+[http://partsregistry.org/Part:BBa_B0015 BBa_B0015] | ||
+ | this is strange because the plasmid maintained its size so the promoter is not there.I've checked the plasmid size an it is 2079 bp so the plasmid doesn't has the promoter. | ||
+ | |||
+ | Going back further when I digested for the first time plasmid [http://partsregistry.org/Part:pSB1A2 pSB1A2] I did it with SpeI/PstI to allow | ||
+ | promoter to be at the beginning of the construction.The insert [http://partsregistry.org/Part:BBa_K242002 cox]+[http://partsregistry.org/Part:BBa_K242001 ogr]+[http://partsregistry.org/Part:BBa_B0015 BBa_B0015] was digested XbaI/PstI so I think the unique alternative is that promoter ipteg wasn't | ||
+ | in the plasmid. | ||
+ | |||
+ | In this circumstance we can only say that we changed [http://partsregistry.org/Part:BBa_K242002 cox]+[http://partsregistry.org/Part:BBa_K242001 ogr]+[http://partsregistry.org/Part:BBa_B0015 BBa_B0015] from plasmid [http://partsregistry.org/Part:pSB1T3 pSB1T3] to [http://partsregistry.org/Part:pSB1A212 pSB1A212] that is resitantant to | ||
+ | Amp. | ||
+ | |||
+ | == October 5, 2009 == | ||
+ | |||
+ | To test for the activity of the [http://partsregistry.org/Part:BBa_K242100 multipromoter] that we designed and synthesized, we are going to | ||
+ | transform E. coli [https://2009.igem.org/Team:LCG-UNAM-Mexico/Resources/Strains#Expression_Strains BL21(DE3)plysS] from novagen. This strain uses a T7 phage polymerase that is controlled thorough Lac promoter. The multipromoter is composed of T7 & T3 promoters, we expect that our construction will respond to IPTG. | ||
+ | |||
+ | The IPTG preparation protocol we used is discribed [http://openwetware.org/wiki/IPTG HERE!!!] | ||
+ | |||
+ | Transformed cells were platted on LB medium with Kn and IPTG .5 mM and expect that the colonies will fluoresce | ||
+ | and could be seeing with a transluminator. | ||
+ | |||
+ | == Octuber 6, 2009 == | ||
+ | |||
+ | We took a look to the LB Agar plates with a transluminator at a wavelength of 395nm but because we didn't have a | ||
+ | filter for GFP emitting wavelength we couldn't discriminate for our wavelength of interest. | ||
+ | |||
+ | We are going to try other approach this time with a microscope more suitable to see GFP. | ||
+ | |||
+ | == October 7, 2009 == | ||
+ | |||
+ | REGISTRY SITE FOR [http://partsregistry.org/wiki/index.php?title=Part:BBa_K242101 MULTIPROMOTER] BBa_K242101 | ||
+ | |||
+ | m stands for multipromoter !! | ||
+ | |||
+ | Cultures were prepared as follows: | ||
+ | |||
+ | BL21/m+ BL21/m+ BL21/m- | ||
+ | 100 mL LB + + + | ||
+ | 100 µL Kan 30 µg/µL + + - | ||
+ | 100 µL Cam 20 µg/µL + + + | ||
+ | 10 µL IPTG 1M + - + | ||
+ | |||
+ | |||
+ | For the induction of protein production we started our culture at .1 abs 620nm in 100mL LB and waited until it reached 0.35 abs 620 nm then we added IPTG to a final concentration of 0.1mM and then we leave the culture media for four | ||
+ | hours. | ||
+ | |||
+ | 5mL of each culture were centrifuged at max speed and the supernatant was discarded. We prepared our samples | ||
+ | to see them. Using a microscope with suitable filters and light to see GFP we compared the cultures between them | ||
+ | |||
+ | Results: | ||
+ | Bl21/m+ Bl21/m+ Bl21/m- | ||
+ | IPTG + - + | ||
+ | ++++ ++ - Fluorescence | ||
+ | |||
+ | [[Image:Gfp multi.JPG |280px]] | ||
+ | |||
+ | In frame is BL21/multipromoter with IPTG inducer at 100X. Unfortunately the microscope and camera were not suitable to check in full detail BL21/m- IPTG+, which gave no fluorescence, and Bl21/multipromoter IPTG-, which presented a diminished fluorescence. | ||
+ | |||
+ | This results support the functioning of multipromoter for T7 polymerase. | ||
+ | |||
+ | Great NEWS!!! our promoter worked for T7 RNA polymerase | ||
+ | |||
+ | For future experiments to get a better characterization look result site. | ||
+ | |||
+ | == October 20, 2009 == | ||
+ | |||
+ | I prepared cultures to purify plasmid that contains the parts that we are planning to send to the registry. | ||
+ | |||
+ | Part List: | ||
+ | [http://partsregistry.org/Part:BBa_K242002 cox] | ||
+ | [http://partsregistry.org/Part:BBa_K242001 ogr] | ||
+ | [http://partsregistry.org/Part:BBa_K242001 ogr]+[http://partsregistry.org/Part:BBa_K242002 cox]+[http://partsregistry.org/Part:BBa_B0015 BBa_B0015] | ||
+ | [http://partsregistry.org/Part:BBa_K242100 multipromoter] | ||
+ | |||
+ | Three overnights for [http://partsregistry.org/Part:BBa_K242100 multipromoter] testing were prepared, one would be induced by IPTG, other not and the latter is a BL21 strain that doesn't have the construction but will be grown with IPTG. | ||
+ | |||
+ | == October 21, 2009 == | ||
+ | |||
+ | Preparation of parts for sending them to the registry!!! | ||
+ | |||
+ | |||
+ | =References= | ||
+ | |||
+ | To see all the literature that we used to develop the construction of control system pleas visit | ||
+ | references site and look for ogr, cox, P2 and P4 papers [https://2009.igem.org/Team:LCG-UNAM-Mexico/Description#References References]. | ||
- | |||
<!--Do not remove the first and last lines in this page!-->{{Template:LCG_bottom_Netscape}} | <!--Do not remove the first and last lines in this page!-->{{Template:LCG_bottom_Netscape}} |
Latest revision as of 03:48, 22 October 2009