"
Team:KULeuven/Lab/Blue Light Receptor
From 2009.igem.org
(Difference between revisions)
(→Steps) |
(→Steps) |
||
| Line 25: | Line 25: | ||
# *PCR reaction to purify suspected promoter region. | # *PCR reaction to purify suspected promoter region. | ||
*Probably has a promoter, RBS and SpeI restriction site. | *Probably has a promoter, RBS and SpeI restriction site. | ||
| - | + | partial digestion with SpeI. | |
*After, run agarose gel to identify the correctly cut sequence and then perform a gel extraction. | *After, run agarose gel to identify the correctly cut sequence and then perform a gel extraction. | ||
*cut with EcoRI. | *cut with EcoRI. | ||
| - | + | *cut GFP with EcoRI and XbaI. | |
*Couple PCR fragment to GFP. | *Couple PCR fragment to GFP. | ||
*measure reactivity of the promoter. | *measure reactivity of the promoter. | ||
| - | + | *cut vector with SpeI and use klenow to create blunt ends. then ligate together. | |
*use initial primers to recreate restriction sites and to select correctly ligated sequences. | *use initial primers to recreate restriction sites and to select correctly ligated sequences. | ||
*link to GFP to check the activity of the sequence. | *link to GFP to check the activity of the sequence. | ||
| - | + | *“cleaning” region to strictly promoter. | |
*Cutting in different pieces and measuring the GFP activity: | *Cutting in different pieces and measuring the GFP activity: | ||
a. Same reverse primer, shortening through forward primer. | a. Same reverse primer, shortening through forward primer. | ||
Revision as of 13:11, 27 July 2009
Contents |
Planning
Goal
Purifying the promoter region of the blue light receptor from E. Coli. This region needs to be ‘cleaned’ and possible restriction sites mutated out. After a biobrick can be made.
required
- e coli stam ( MC4100)
- Primers (1) for PCR: already ordered (nummers: 2171 (FP) - 2172 (RP))
- Primers (2) for ‘cleaning’ region
- Primers (3) for biobrick (nog te maken)
- GFP with RBS and Terminator sequence
Where from
- Strain: from lab
- Primers: self made and ordered
for PCR
Forward: CATCAT GAATTCGCGGCCGCTTCTAGAG TTT GAC AGG TTC GTC GTC
Reverse: CTGCAGCGGCCGCTACTAGTA CCT CTG TTA AAA ATG TTA ATC AAT GTT AAG
for ‘cleaning’
for biobrick
only when actual promoter is known
- the GFP (BBa_E0240)came from the freezer (-80)at the lab
Steps
- *PCR reaction to purify suspected promoter region.
*Probably has a promoter, RBS and SpeI restriction site.
partial digestion with SpeI.
*After, run agarose gel to identify the correctly cut sequence and then perform a gel extraction. *cut with EcoRI.
- cut GFP with EcoRI and XbaI.
*Couple PCR fragment to GFP. *measure reactivity of the promoter.
- cut vector with SpeI and use klenow to create blunt ends. then ligate together.
*use initial primers to recreate restriction sites and to select correctly ligated sequences. *link to GFP to check the activity of the sequence.
- “cleaning” region to strictly promoter.
*Cutting in different pieces and measuring the GFP activity: a. Same reverse primer, shortening through forward primer. b. Once there is no activity anymore with forward primer, keep it constant and shorten reverse inkorten c. Once promoter found: updating those primers with a pre en suffix to make a biobrick out of the promoter
important
following conditions need to be kept in account:
- for growth of the bacteria: 37°C
- for expression of the genes regulated by ycgF/E system: 16°C
- at 16°C: expression will start after 50h and a very slow reversion to the ground state of ycgF
- working with a colony in the dark and one in light so that the effects of cold temperature on the gene expression pattern can be calculated out.
- blue light does NOT induce stress and cell death in E. Coli
- to monitor growth of the cells, measurement at OD 578 can be used
