Revision as of 13:15, 27 July 2009

Planning

Goal

Purifying the promoter region of the blue light receptor from E. Coli. This region needs to be ‘cleaned’ and possible restriction sites mutated out. After a biobrick can be made.

required

e coli stam ( MC4100)
Primers (1) for PCR: already ordered (nummers: 2171 (FP) - 2172 (RP))
Primers (2) for ‘cleaning’ region
Primers (3) for biobrick (nog te maken)
GFP with RBS and Terminator sequence

Where from

Strain: from lab
Primers: self made and ordered

  for PCR
     Forward:  CATCAT GAATTCGCGGCCGCTTCTAGAG  TTT GAC AGG TTC GTC GTC
     Reverse: CTGCAGCGGCCGCTACTAGTA   CCT CTG TTA AAA ATG TTA ATC AAT GTT AAG 
  for ‘cleaning’ 
  for biobrick
     only when actual promoter is known

the GFP (BBa_E0240)came from the freezer (-80)at the lab

Steps

PCR reaction to purify suspected promoter region.

 Probably has a promoter, RBS and SpeI restriction site.

partial digestion with SpeI.

 After, run agarose gel to identify the correctly cut sequence and then perform a gel extraction.
 cut with EcoRI.

cut GFP with EcoRI and XbaI.

 Couple PCR fragment to GFP. 
 measure reactivity of the promoter.

cut vector with SpeI and use klenow to create blunt ends. then ligate together.

 use initial primers to recreate restriction sites and to select correctly ligated sequences. 
 link to GFP to check the activity of the sequence.

“cleaning” region to strictly promoter.

 Cutting in different pieces and measuring the GFP activity: 
   a.	Same reverse primer, shortening through forward primer.
   b.	Once there is no activity anymore with forward primer, keep it constant and shorten reverse inkorten
   c.	Once promoter found: updating those primers with a pre en suffix to make a biobrick out of the promoter

important

following conditions need to be kept in account:

for growth of the bacteria: 37°C
for expression of the genes regulated by ycgF/E system: 16°C
at 16°C: expression will start after 50h and a very slow reversion to the ground state of ycgF
working with a colony in the dark and one in light so that the effects of cold temperature on the gene expression pattern can be calculated out.
blue light does NOT induce stress and cell death in E. Coli
to monitor growth of the cells, measurement at OD 578 can be used

@@ Line 23: / Line 23: @@
 ==Steps==
-# *PCR reaction to purify suspected promoter region.
+# PCR reaction to purify suspected promoter region.
-   *Probably has a promoter, RBS and SpeI restriction site.
+   Probably has a promoter, RBS and SpeI restriction site.
-partial digestion with SpeI.
+# partial digestion with SpeI.
-   *After, run agarose gel to identify the correctly cut sequence and then perform a gel extraction.
+   After, run agarose gel to identify the correctly cut sequence and then perform a gel extraction.
-   *cut with EcoRI.
+   cut with EcoRI.
-*cut GFP with EcoRI and XbaI.
+# cut GFP with EcoRI and XbaI.
-   *Couple PCR fragment to GFP.
+   Couple PCR fragment to GFP.
-   *measure reactivity of the promoter.
+   measure reactivity of the promoter.
-*cut vector with SpeI and use klenow to create blunt ends. then ligate together.
+# cut vector with SpeI and use klenow to create blunt ends. then ligate together.
-   *use initial primers to recreate restriction sites and to select correctly ligated sequences.
+   use initial primers to recreate restriction sites and to select correctly ligated sequences.
-   *link to GFP to check the activity of the sequence.
+   link to GFP to check the activity of the sequence.
-*“cleaning” region to strictly promoter.
+# “cleaning” region to strictly promoter.
-   *Cutting in different pieces and measuring the GFP activity:
+   Cutting in different pieces and measuring the GFP activity:
      a.	Same reverse primer, shortening through forward primer.
      b.	Once there is no activity anymore with forward primer, keep it constant and shorten reverse inkorten

Team:KULeuven/Lab/Blue Light Receptor

From 2009.igem.org