"
Team:Valencia/Parts
From 2009.igem.org
(→Preparing inserts) |
|||
| Line 6: | Line 6: | ||
Total DNA was extracted from our yeast strains.<br> | Total DNA was extracted from our yeast strains.<br> | ||
AEQ was amplified by PCR using oligonucleotides matching the sequence and bearing the appropriate Biobrick prefix and suffix.<br> | AEQ was amplified by PCR using oligonucleotides matching the sequence and bearing the appropriate Biobrick prefix and suffix.<br> | ||
| + | |||
| + | Firstly, aequorin sequence is:<br> | ||
| + | 1 atgaccagcg accaatactc agtcaagctt acatcagact tcgacaaccc aagatggatt<br> | ||
| + | 61 ggacgacaca agcatatgtt caatttcctt gatgtcaacc acaatggaaa aatctctctt<br> | ||
| + | 121 gacgagatgg tctacaaggc atctgatatt gtcatcaata accttggagc aacacctgag<br> | ||
| + | 181 caagccaaac gacacaaaga tgctgtagga gccttcttcg gaggagctgg aatgaaatat<br> | ||
| + | 241 ggtgtggaaa ctgattggcc tgcatacatt gaaggatgga aaaaattggc tactgatgaa<br> | ||
| + | 301 ttggagaaat acgccaaaaa cgaaccaacg ctcatccgta tatggggtga tgctttgttt<br> | ||
| + | 361 gatatcgttg acaaagatca aaatggagct attacactgg atgaatggaa agcatacacc<br> | ||
| + | 421 aaagctgctg gtatcatcca atcatcagaa gattgcgagg aaacatccag agtgtgcgat<br> | ||
| + | 481 attgatgaaa gtggacaact cgatgttgat gagatgacaa gacaacattt aggattttgg<br> | ||
| + | 541 tacaccatgg atcctgcttg cgaaaagctc tacggtggag ctgtccccta a<br> | ||
| + | |||
| + | |||
| + | And our oligos (EcoRI and XbaI sites in bold) were:<br> | ||
| + | Forward: 5'gaattcgcggccgcttctagatgaccagcg 3’<br> | ||
| + | Reverse: 5’tactagtagcggccgctgcagttaggggac 3’<br> | ||
| - | |||
| - | |||
| - | |||
| Line 19: | Line 33: | ||
Followed by 30 amplification cycles: | Followed by 30 amplification cycles: | ||
<ol>94º 30'' | <ol>94º 30'' | ||
| - | + | 55º 1' | |
72º 1'</ol> | 72º 1'</ol> | ||
And a final extension step: | And a final extension step: | ||
| - | <ol>72º | + | <ol>72º 7'</ol> |
</ol> | </ol> | ||
| Line 29: | Line 43: | ||
[[Image:.jpg]]<br> | [[Image:.jpg]]<br> | ||
| - | + | ||
| - | Amplicons were digested (H buffer) with EcoRI y | + | 1 = wt (1 microlitre)<br> |
| + | 2 = wt (2 microlitres)<br> | ||
| + | 3 = Cch1 (1 microlitre)<br> | ||
| + | 4 = Mid1 (1 microlitre)<br> | ||
| + | 5 = Negative Control<br> | ||
| + | 6 = Possitive Control<br> | ||
| + | (We used the same MWM)<br> | ||
| + | |||
| + | We used wt 1 microlitre of PCR amplification product (career 1) to build the AEQ BioBrick.<br> | ||
| + | |||
| + | Amplicons were digested (H buffer) with EcoRI y XbaI.<br> | ||
Revision as of 14:57, 5 October 2009
Preparing inserts
Total DNA was extracted from our yeast strains.
AEQ was amplified by PCR using oligonucleotides matching the sequence and bearing the appropriate Biobrick prefix and suffix.
Firstly, aequorin sequence is:
1 atgaccagcg accaatactc agtcaagctt acatcagact tcgacaaccc aagatggatt
61 ggacgacaca agcatatgtt caatttcctt gatgtcaacc acaatggaaa aatctctctt
121 gacgagatgg tctacaaggc atctgatatt gtcatcaata accttggagc aacacctgag
181 caagccaaac gacacaaaga tgctgtagga gccttcttcg gaggagctgg aatgaaatat
241 ggtgtggaaa ctgattggcc tgcatacatt gaaggatgga aaaaattggc tactgatgaa
301 ttggagaaat acgccaaaaa cgaaccaacg ctcatccgta tatggggtga tgctttgttt
361 gatatcgttg acaaagatca aaatggagct attacactgg atgaatggaa agcatacacc
421 aaagctgctg gtatcatcca atcatcagaa gattgcgagg aaacatccag agtgtgcgat
481 attgatgaaa gtggacaact cgatgttgat gagatgacaa gacaacattt aggattttgg
541 tacaccatgg atcctgcttg cgaaaagctc tacggtggag ctgtccccta a
And our oligos (EcoRI and XbaI sites in bold) were:
Forward: 5'gaattcgcggccgcttctagatgaccagcg 3’
Reverse: 5’tactagtagcggccgctgcagttaggggac 3’
PCR was conducted as follows:
- A first denaturation cycle
- 94º 3'
Followed by 30 amplification cycles:
- 94º 30
55º 1'
72º 1'
And a final extension step:
- 72º 7'
Results:
1 = wt (1 microlitre)
2 = wt (2 microlitres)
3 = Cch1 (1 microlitre)
4 = Mid1 (1 microlitre)
5 = Negative Control
6 = Possitive Control
(We used the same MWM)
We used wt 1 microlitre of PCR amplification product (career 1) to build the AEQ BioBrick.
Amplicons were digested (H buffer) with EcoRI y XbaI.
