"
Team:Valencia/Parts
From 2009.igem.org
(→Preparing inserts) |
(→Preparing inserts) |
||
| Line 6: | Line 6: | ||
Total DNA was extracted from our yeast strains.<br> | Total DNA was extracted from our yeast strains.<br> | ||
AEQ was amplified by PCR using oligonucleotides matching the sequence and bearing the appropriate Biobrick prefix and suffix.<br> | AEQ was amplified by PCR using oligonucleotides matching the sequence and bearing the appropriate Biobrick prefix and suffix.<br> | ||
| + | |||
| + | |||
Firstly, aequorin sequence is:<br> | Firstly, aequorin sequence is:<br> | ||
| + | |||
1 atgaccagcg accaatactc agtcaagctt acatcagact tcgacaaccc aagatggatt<br> | 1 atgaccagcg accaatactc agtcaagctt acatcagact tcgacaaccc aagatggatt<br> | ||
61 ggacgacaca agcatatgtt caatttcctt gatgtcaacc acaatggaaa aatctctctt<br> | 61 ggacgacaca agcatatgtt caatttcctt gatgtcaacc acaatggaaa aatctctctt<br> | ||
| Line 18: | Line 21: | ||
481 attgatgaaa gtggacaact cgatgttgat gagatgacaa gacaacattt aggattttgg<br> | 481 attgatgaaa gtggacaact cgatgttgat gagatgacaa gacaacattt aggattttgg<br> | ||
541 tacaccatgg atcctgcttg cgaaaagctc tacggtggag ctgtccccta a<br> | 541 tacaccatgg atcctgcttg cgaaaagctc tacggtggag ctgtccccta a<br> | ||
| + | |||
Revision as of 14:58, 5 October 2009
Preparing inserts
Total DNA was extracted from our yeast strains.
AEQ was amplified by PCR using oligonucleotides matching the sequence and bearing the appropriate Biobrick prefix and suffix.
Firstly, aequorin sequence is:
1 atgaccagcg accaatactc agtcaagctt acatcagact tcgacaaccc aagatggatt
61 ggacgacaca agcatatgtt caatttcctt gatgtcaacc acaatggaaa aatctctctt
121 gacgagatgg tctacaaggc atctgatatt gtcatcaata accttggagc aacacctgag
181 caagccaaac gacacaaaga tgctgtagga gccttcttcg gaggagctgg aatgaaatat
241 ggtgtggaaa ctgattggcc tgcatacatt gaaggatgga aaaaattggc tactgatgaa
301 ttggagaaat acgccaaaaa cgaaccaacg ctcatccgta tatggggtga tgctttgttt
361 gatatcgttg acaaagatca aaatggagct attacactgg atgaatggaa agcatacacc
421 aaagctgctg gtatcatcca atcatcagaa gattgcgagg aaacatccag agtgtgcgat
481 attgatgaaa gtggacaact cgatgttgat gagatgacaa gacaacattt aggattttgg
541 tacaccatgg atcctgcttg cgaaaagctc tacggtggag ctgtccccta a
And our oligos (EcoRI and XbaI sites in bold) were:
Forward: 5'gaattcgcggccgcttctagatgaccagcg 3’
Reverse: 5’tactagtagcggccgctgcagttaggggac 3’
PCR was conducted as follows:
- A first denaturation cycle
- 94º 3'
Followed by 30 amplification cycles:
- 94º 30
55º 1'
72º 1'
And a final extension step:
- 72º 7'
Results:
1 = wt (1 microlitre)
2 = wt (2 microlitres)
3 = Cch1 (1 microlitre)
4 = Mid1 (1 microlitre)
5 = Negative Control
6 = Possitive Control
(We used the same MWM)
We used wt 1 microlitre of PCR amplification product (career 1) to build the AEQ BioBrick.
Amplicons were digested (H buffer) with EcoRI y XbaI.
