"
Team:Valencia/Parts
From 2009.igem.org
(→Preparing inserts) |
(→Preparing inserts) |
||
| Line 2: | Line 2: | ||
| - | == | + | == '''Preparing inserts''' == |
Total DNA was extracted from our yeast strains.<br> | Total DNA was extracted from our yeast strains.<br> | ||
| Line 51: | Line 51: | ||
(We used the same MWM)<br> | (We used the same MWM)<br> | ||
| + | Amplicon has 600 pb's. | ||
We used wt 1 microlitre of PCR amplification product (career 1) to build the AEQ BioBrick.<br> | We used wt 1 microlitre of PCR amplification product (career 1) to build the AEQ BioBrick.<br> | ||
Revision as of 15:22, 10 October 2009
Preparing inserts
Total DNA was extracted from our yeast strains.
AEQ was amplified by PCR using oligonucleotides matching the sequence and bearing the appropriate Biobrick prefix and suffix.
And our oligos (EcoRI and XbaI sites in bold) were:
Forward: 5'gaattcgcggccgcttctagatgaccagcgaccaatactc 3’
Reverse: 5’tactagtagcggccgctgcagttaggggacagctccaccg 3’
PCR was conducted as follows:
- A first denaturation cycle
- 94º 3min
Followed by 30 amplification cycles:
- 94º 30s
55º 1min
72º 1min
And a final extension step:
- 72º 7min
Results:
1 = wt (1 microlitre)
2 = wt (2 microlitres)
3 = Cch1 (1 microlitre)
4 = Mid1 (1 microlitre)
5 = Negative Control
6 = Possitive Control
(We used the same MWM)
Amplicon has 600 pb's.
We used wt 1 microlitre of PCR amplification product (career 1) to build the AEQ BioBrick.
Amplicons were digested (H buffer) with EcoRI y XbaI.
Preparing vectors
Competent cells were transformed with:
Plasmids were extracted (High pure miniprep plasmid isolation kit ROCHE)
Plasmid were digested with EcoRI and XbaI
Ligating Biobricks into plasmids
Both plasmids and inserts were run into 0.8% 0.5X TBE agarose gels and DNA bands excised with a clean scalpel. DNA was extracted from agarose blocks (ultra clean gel spin, DNA purification Kit, MO BIO laboratories).
T4 Ligase was used to ligate inserts and vectors for 1 h at room temperature (2X quick buffer was used).
Competent cells were transformed and resulting colonies (Amp LB) screened with Fw and Rv primers to confirm the presence of inserts.
pSB1AK3 containing UCP-1, 175-deleted and 76-deleted were sent to the Registry
