From 2009.igem.org

(Difference between revisions)

Latest revision as of 16:35, 20 November 2009

Materials & Methods

Kits

Kit	supplier

CompactPrep Plasmid Maxi Kit	QIAGEN
High Pure PCR Template Preparation Kit	Roche
HISpeed Plasmid Maxi Kit	QIAGEN
QIAprep Spin Mini Kit	QIAGEN
QIAquick Gel Extraction Kit	QIAGEN
QIAquick PCR Purification Kit	QIAGEN
RNeasy Plant Mini Kit	QIAGEN
QuantiTect Probe RT-PCR Kit	QIAGEN
SensiMix One-Step Kit	Quantace
QuikChange XL Site-Directed Mutagenesis Kit	Strategene

[Back]

Marker

Marker	supplier
GeneRuler™ High Range DNA Ladder	MBI Fermentas
GeneRuler™ 1kb DNA Ladder Mix	MBI Fermentas

[Back]

Enzymes

Enzym	supplier
Pfu DNA polymerase	Stratagene
Phusion DNA polymerase, Mastermix 2x	Finnzymes
Taq DNA polymerase	MBI Fermentas
T4 DNA ligase	MBI Fermentas / New England Biolabs

[Back]

Restriction Enzymes

Enzym	supplier
BclI	MBI Fermentas
EcoRI	New England Biolabs
HindIII	New England Biolabs
MfeI	New England Biolabs
NheI	New England Biolabs
NotI	New England Biolabs
PstI	New England Biolabs
ScaI	New England Biolabs
SpeI	New England Biolabs
SspI	New England Biolabs
SphI	New England Biolabs
XbaI	New England Biolabs

[Back]

Bacteria

E.coli strain	usage	reference
DH5a	amplification of plasmids	Invitrogen
SCS110	amplification of unmethylated plasmids	Stratagene

[Back]

Bacteria Growth Media

Luria Broth (LB)

10 g/L tryptone
5 g/L yeast extract
10 g/L NaCl

Antibiotic	concentration
Ampicillin	100 mg/ml
Kanamycin	50 mg/ml

[Back]

Eucaryotic cell lines

MCF-7
HeLa
U2-OS

[Back]

Cell Culture Media

DMEM+++

DMEM
1% L-Glutamine
1% Pen/Strep
10% FCS

DMEM++

DMEM
1% L-Glutamin
1% Pen/Strep
1% non-essential aminoacids

Zeocin-Medium

DMEM+++
100 µl/ml Zeocin

Hygromycin-Medium

DMEM+++
200 µl/ml Hygromycin

Minimal Medium

2,1 g/l NaHCO₃
1µM CaCl₂
10 µM Hepes-Buffer [1]
1 % Pen/Strep
Krebs-Henseleit-Buffer (Sigma-Aldrich [http://www.sigmaaldrich.com/etc/medialib/docs/Sigma/Product_Information_Sheet/1/k3753pis.Par.0001.File.tmp/k3753pis.pdf])

[Back]

Oligos

We used [http://www.lablife.org LabLife], a great, non-commercial lab management resource for lab management and especially for keeping track of Oligos we used. All Oligos therefore are numbered, and all Notebook entries describing PCR reactions refer to a certain number of Oligo. A complete list of all Oligos we had in our lab can be downloaded as comma-separated values; find below a list of more interesting oligos we used for RA-PCR and LAM-PCR.

Oligos used for RA-PCR

Name	Sequence
Stop 5'	CAGTACTAGTGGGTGACGGGTTCA
Stop 3'	TGACAAGCTTAGTGAACCCGTCACCC
Sp1 responsive (general transactivator)	GCGATCGGCAGATCAGGGGCGGGGCGGGTGACGGGTTCA
Ap1 responsive (general transactivator)	GCGATCGGCAGATCATGACTCAGGGTGACGGGTTCA
CREB responsive (general transactivator)	GCGATCGGCAGATCABNBVNTGACGTCAGGGTGACGGGTTCA
NFY responsive (general transactivator)	GCGATCGGCAGATCANNCCAATNNGGGTGACGGGTTCA
Spacer forward	GCGATCGGCAGATCANNNNNNNNNNGGGTGACGGGTTCA
Spacer reverse	TGATCTGCCGATCGCNNNNNNNNNNTGAACCCGTCACCC
AHR responsive, forwards	GCGATCGGCAGATCACCYCNRRSTNGCGTGASAGGGTGACGGGTTCA
AHR responsive, reverse	TGATCTGCCGATCGCASAGTGCGNTSRRNCYCCTGAACCCGTCACCC
Estrogen Receptor responsive, forward v 1	GCGATCGGCAGATCAGGTCACTGTGACCGGGTGACGGGTTCA
Estrogen Receptor responsive, forward v 2	GCGATCGGCAGATCARGNCANNNTGACCYGGGTGACGGGTTCA
Estrogen Receptor responsive, reverse	TGATCTGCCGATCGCCCAGTGTCACTGGTGAACCCGTCACCC
HIF responsive, forward v 1	GCGATCGGCAGATCATCTGTACGTGACCACAGGGTGACGGGTTCA
HIF responsive, forward v 2	GCGATCGGCAGATCAGTCTACGTGCGGACGGGTGACGGGTTCA
NFκB responsive, forward v 1	GCGATCGGCAGATCAGGGGACTTTGCCGGGTGACGGGTTCA
NFκB responsive, forward v 2	GCGATCGGCAGATCAGGGGRWYYCCCGGGTGACGGGTTCA
NFκB responsive, reverse	TGATCTGCCGATCGCCCGTTTCAGGGGTGAACCCGTCACCC
p53 responsive, forward	GCGATCGGCAGATCAGAACATGTCCAAGCATGCTGGGGTGACGGGTTCA
PPARγ responsive, reverse	TGATCTGCCGATCGCHACTGGAAACTGGRRTGAACCCGTCACCC
PPARγ responsive, forward	GCGATCGGCAGATCARRGGTCAAAGGTCAHGGGTGACGGGTTCA
SREBP responsive, forward	GCGATCGGCAGATCAKATCACCCCACGGGTGACGGGTTCA
SREBP responsive, reverse	TGATCTGCCGATCGCCACCCCACTAKTGAACCCGTCACCC
p53 reverse	TGATCTGCCGATCGCGTCGTACGAACCTGTACAAGTGAACCCGTCACCC
HIF reverse	TGATCTGCCGATCGCGATCCGTCGTGCATCAGTGTGAACCCGTCACC

Oligos for LAM-PCR

Name	Sequence
LAMPCR9_1 (biotinylated)	AATACCGCGCCACATAGCAG
LAMPCR9_2 (biotinylated)	TTCTTCGGGGCGAAAACTCT
LAMPCR9_3 (biotinylated)	CACTCGTGCACCCAACTGAT
LAMPCR9_4	TCTGGGTGAGCAAAAACAGGA

Oligos for real-time RT-PCR

Name	Sequence
GAPDH_forward_primer	GGTATCGTGGAAGGACTCATGACC
GAPDH_reverse_primer	GATGACCTTGCCCACAGCCTTG
GAPDH_probe	CTCTCCAGAACATCATCCCTGCCTCTAC
G6PD_forward_primer	GAGTCCTGCATGAGCCAGATAGG
G6PD_reverse_primer	GCACCATGAGGTTCTGCACCATC
G6PD_probe	ACCAGATCTACCGCATCGACCACTACCT
18s_rRNA_forward_primer	GGCCCTGTAATTGGAATGAGTCCAC
18s_rRNA_reverse_primer	GCTCCCAAGATCCAACTACGAGCTT
18s_rRNA_probe	CAGCAGCCGCGGTAATTCCAGCTCC
G2TUB_forward_primer	TTCTACCAGGCAGACGATGAGCAC
G2TUB_reverse_primer	CCCAGTTGTTGCCAGCTCCTC
G2TUB_probe	CTGCTGGACTTGGAACCCCGGGTG
bACT_forward_primer	CAGGCACCAGGGCGTGATGG
bACT_reverse_primer	CTCCATGTCGTCCCAGTTGGTG
bACT_probe	AGGATTCCTATGTGGGCGACGAGGC
eGFP_forward_primer	CGACCACATGAAGCAGCACGAC
eGFP_reverse_primer	CGATGCCCTTCAGCTCGATGC
eGFP_probe	AGGCTACGTCCAGGAGCGCACCATC
mCherry_forward_primer	CAAGTGGGAGCGCGTGATGAAC
mCherry_reverse_primer	CCAGCCCATGGTCTTCTTCTGC
mCherry_probe	TGACCGTGACCCAGGACTCCTCCC

[Back]

Plasmids

The following is a list of all used plasmids. Some of them are just working plasmids, others are of greater value for our project. The latter are bold in the table.

Plasmid Abbreviation	plasmid name	insert	remarks	resistance
P1	pcDNA5/FRT			Ampicillin/Hygromycin
P2	pEGFP template			Ampicillin
P3	mcherry template			Kanamycin
P4	mcherry ΔPstI			Kanamycin (?)
P5	pcDNA5/FRT ΔPstI			Ampicillin/Hygromycin
P6	pcDNA5/FRT ΔPstI/ΔEcoRI		negative control for measurements	Ampicillin/Hygromycin
P7	pcDNA5/FRT ΔPstI/ΔEcoRI unmethylated	-	transformed in SC110	Ampicillin/Hygromycin
P8	Part:BBa_E0040	E0040 (GFPmut3B)	does not seem to work in eukaryotes	Ampicillin
P9	pFRT/lacZeo	-	plasmid was stably integrated in cell lines and used for stable integration of constructs	Ampicillin/Zeocin
P10	pcDNA5/FRT ΔPstI/ΔEcoRI EGFP	EGFP (from pEGFP-N1)		Ampicillin/Hygromycin
P11	pcDNA5/FRT ΔPstI/ΔEcoRI mcherry JeT	mCherry, Jet promoter		Ampicillin/Hygromycin
P12	pcDNA5/FRT ΔPstI/ΔEcoRI mcherry Min	mCherry, Min promoter		Ampicillin/Hygromycin
P13	pcDNA5/FRT ΔPstI/ΔEcoRI GFPb3mut	E0040 (GFPmut3B)		Ampicillin/Hygromycin
P23	psB1A3 - Registry	J04450 (RFP device)	backbone used for creation of BBb submission plasmid	Ampicillin
P27	pEGFP-N1	EGFP	preliminary (+) control for transfection	Kanamycin
P29	pSB1A3 - Registry	P1010		Ampicillin
P30	pcDNA5/FRT ΔPstI/ΔEcoRI GFP Min	GFP, Min promoter		Ampicillin/Hygromycin
P31	pcDNA5/FRT ΔPstI/ΔEcoRI GFP BBbJeT	GFP, standardized JeT promoter		Ampicillin/Hygromycin
P32	CFP_emp_cytosole	CFP, cytosole localization signal	template	Kanamycin
P33	YFP_emp_cytosole	YFP, cytosole localization signal	template	Kanamycin
P34	YFP_GPI_PM	YFP, PM localization signal	template	Kanamycin/Neomycine
P35	CFP_GPI_PM	CFP, PM localization signal	template	Kanamycin/Neomycine
P36	YFP_Sar1_ER	YFP, ER localization signal	template	Kanamycin
P37	CFP_Sar1_ER	CFP, ER localization signal	template	Kanamycin
P38	EBFP_NLS_nucleus	EBFP, nuclear localization signal	template	Kanamycin
P39	eYFP_NLS-cas8_nucleus	EYFP, nuclear localization signal	template	Kanamycin
P40	mCherry_H2B_nucleus	mCherry, nuclear localization signal	template	Kanamycin
P41	eYFP_H2B_nucleus	EYFP, nuclear localization signal	template	Kanamycin
P42	GFP_myrpalm_PM	GFP, PM localization signal	template	Kanamycin
P43	mCherry_myrpalm_PM	mCherry, PM localization signal	template	Kanamycin
P44	GFP_mitomeet_Mitochondria	GFP, mitochondrial localization signal	template	Kanamycin
P45	pOG44	FLP	contains FLP enzymes that is used for stable integration of pcDNA5/FRT derived plasmids at FRT sites in the genome	Ampicillin
P46	Oakes NFkB	5x NFκB responsive element	backbone: pGL3	Ampicillin
P47	Oakes NFAT	NFAT RE	backbone: pGL4	Ampicillin
P48	p31_cmv_core_Jet_prox	CMV core promoter, JeT proximal promoter	standardized (BBb) fused promoter	Ampicillin/Hygromycin
P49	BBb_JeT pSB1A3	standardized JeT promoter	backbone: pSB1A3; our very first plasmid to be send to the registry!	Ampicillin
P51	pcDNA5/FRT ΔPstI/ΔEcoRI BBbJeT	standardized JeT promoter		Ampicillin/Hygromycin
P52	hsp70-EGFP	EGFP, hsp70 promoter	natural heat sensitive promoter	Kanamycin
P53	pcDNA/FRT ΔPstI/ΔEcoRI BBbCMV	standardized CMV promoter		Ampicillin/Hygromycin
P55	pcDNA5/FRT ΔPstI/ΔEcoRI GFP_BBbCMV	GFP with standardized CMV promoter	exactly the same plasmid as P31 except for the promoter	Ampicillin/Hygromycin
P56	p31 CYP1A1	GFP, CYP1A1 promoter	natural promoter	Ampicillin/Hygromycin
P57	pcDNA/FRT ΔPstI/ΔEcoRI mCherry_BBbJeT	mCherry with standardized JeT promoter	same plasmid as P31 except for fluorescent protein; used for cotransfection for measurements	Ampicillin/Hygromycin
P58	intron in submission plasmid			Ampicillin

[Back]

Instruments

The following is a list of all used Instruments.

Instrument	Name	Manufactor
Table Centrifuge	Microfuge® 18 Centrifuge	Beckman Coulter^TM
Table Centrifuge	MicrofugeR 22® Centrifuge	Beckman Coulter^TM
Centrifuge	Allegra X-12	Beckman Coulter^TM
Shaker	VORTEXGENIER 2	Scientific Industries, SI^TM
Heating plate (magnet stirrer)	MR Hei-Standard	Heidolph
Heatblock	QBD4	Grant
Heatblock (shakeing function)	Thermomixer comfort	Eppendorf
PCR-machine	MyCycler^TM thermo cycler	BioRad
UV-chamber	Transluminator	Vilber Lourmat
Scale (fine)	Pioneer^TM PA114C	OHAUS
Scale	Pioneer^TM PA4101C	OHAUS
Fridge	KTP 1750 Premium	Liebherr
Freezer	GP 1366 Premium	Liebherr
-86 Freezer	-86°C Ultralow Freezer	NUAIRE^TM
Hood	Tischabzug	Wesemann® Laboreinrichtung
Draw-off pump	Vacuhand control	Vacubrand
Incubator	HT Multitron Version 2	INFORS
Incubator (cell culture)	HERAcell 150	Thermo electron coorperation
Hood (cell culture)	HERAsafe	Thermo electron coorperation
Plate reader	Infinite M200	TECAN
FACS	Cytomics FC 500 MPL	Beckman Coulter^TM
Microscope	CKX41	Olympus
Computer		Sun Microsystems
UV/Visivle Spectrometer	Ultrospec 3300 pro	Amersham Biosciences
Photometer	NanoDrop® ND-1000 Spectrophotometer	peQLab Biotechnologie GmbH
Photometer	NanoVue^TM	General Electric
Ice Machine	MF22	SCOTSMAN®
Gel electrophoresis chamber	Mupid®-One	Advance
pipetting robot	QIAcube^TM	QIAGEN
Wide field microscope	Nikon Eclipse 90i	Nikon
PCR machine	MyCycler thermal cycler	BIO-RAD
Real-time PCR machine	StepOnePlus^TM Real-time PCR System	Applied Biosystems^TM

[Back]

Lab material

The following is a list of the used Lab material.

Material	Name	Manufactor
Bottle 50 ml, 100 ml, 200 ml, 500 ml, 1000 ml	Schott Duran	Schott
Beaker 50 ml, 100 ml, 200 ml, 500 ml 1000 ml	-	Simax
Conical flask 500 ml, 1000 ml, 100 ml	FB33141, FB33142, FB33139	Fischerbrand
Conical flask 300 ml	-	Simax
Single channel pipet	Pipetman® P2, P20, P200, P1000	Gilson
Multichannel pipet	Research® Multikanal	Eppendorf
Multistep pipet	e10, e120, e1000, e5000	Biohit
Pipet	accu-jet® pro	Brand
PCR-tubes	PCR softtubes	Biozym
Microcentrifuge tubes	safe-lock-tubes 2 ml/1,5 ml	Eppendorf
Centrifugetubes	BD Falcon^TM 15 ml /50 ml	BD Biosciences
PCR 8-strips	Tube Strips, CLR	Biorad
Serological Pipet	5 ml, 10 ml, 25 ml	BD Labware
Gloves	Latex Medical Examination Gloves (S,M,L)	Blossom
Nitrile Gloves	Freeform^TM SE Examination Gloves (S,M,L)	MICROFLEX®
Filtertips	Extended length Filtertips	Starlab
Pipettips	TipOne®	Starlab
Counting Chamber	Neubauer	Brand
Inoculating loop	-	nunc^TM
Disposal bags	-	Plastibrand®
Flasks	Tissue Culture Flasks	TPP®
Plate	Microplates for life science Research	PerkinElmer^TM
IBD	Lab-Tek®	nunc^TM
6/16-Well plates	Nunclon^TM Surface	nunc^TM

[Back]

Methods

General Methods

Transformation of Bacteria

For enrichment of vectors, E. coli DH5α were used. For the transformation 100 µl of the competent cells were thawed on ice and 50 – 400 ng DNA solution added (depending on the concentration of the DNA solution). After a 30-60 minute incubation on ice, cells were made permeable for the DNA by heat shocking for 45 seconds at 42 °C and a further 3 minute incubation on ice. The samples were than rescued by adding 500 µl preheated antibiotic free LB-medium and incubated for one hour at 37 °C while shaking for induction of the antibiotic resistance. The selection for plasmid containing and therefore antibiotic resistant bacteria was conducted by plating them on antibiotic containing LB-agar plates.

Glycerol stock

To store bacteria for long term glycerol stocks were used. Therefore 1 ml of an over night culture were added to 150 µl of 80 % Glycerol into a cryo tube, vortexed and incubated at room temperature for 30 min. Afterwards the glycerole stock was stored at -80 °C.

Isolation of plasmid DNA by alkaline lysis (mini and maxiprep)

For analysis of ligations and transformations QIAprep Spin Kits (Qiagen, Hilden) were used following the manufacturer instructions. For miniprep a single colony was picked from a LB-agar plate or glycerol stock was used to inoculate 5 ml LB-medium with appropriate antibiotic for selection (100 µg/µl ampicillin, 50 µg/µl kanamycin, 35 µg/µl chloramphenicol). Bacteria were grown over night at 37 °C while shaking (200 rpm). By using 4 ml over night culture with this kit the yield was around 6-10 µg. For maxipreps the Qiagen CompactPrep Plasmid Maxi Kit was used following the instructions given by the instruction manual. In this case 250 ml LB-medium were inoculated and used for preparation of plasmid DNA. The routinely yield was 300-400 µg plasmid DNA. Purity and amount of DNA was analysed using a NanoDrop.

Preparing chemically competent cells

First, a 20 ml over night culture was inoculated in antibiotic free LB medium from a fresh single colony and transferred into 400 ml antibiotic free LB medium the next day. This culture was incubated at 37 °C while shacking until an OD600 of 0.5 – 0.6 was achieved. The culture was than cooled down on ice, centrifuged (8 min, 4 °C, 3500 rpm), the supernatant discarded and the pellet resuspended in 10 ml 100 mM CaCl₂. After addition of further 190 ml 100 mM CaCl₂ the suspension was incubated on ice for 30 min. The suspension was than again centrifuged (8 min, 4 °C, 3500 rpm), the supernatant discarded, the pellet resuspended in 20 ml 82.5 mM CaCl₂ with 17.5 % glycerol and aliquoted. The aliquots were flash frozen in liquid nitrogen and than stored at -80 °C until usage.

Ligation

Standard Ligation Protocol

T4 ligase joins the 5' phosphate and the 3'-hydroxyl groups of DOUBLE stranded DNA molecules. First step for ligation is to estimate the vector and insert concentrations:if insert is from PCR, assume that 50% is recovered, typically 5 mg, and resuspended in 10 ml of H₂0; same with vector, assume half is recovered in purification/precipitation and resuspend in 10-20 ml of H₂0 if it is not re-suspended already. Second step is to plan control reactions: One reaction with no insert, one reaction with no vector (if enough insert is available). Then Molar Ratio of Insert to Vector is determined where a ratio of Insert:Vector 3:1 (100-150ng Vector DNA) is tried to be achieved. After this, ligation mixure is setup in the following way:

10X Ligase buffer (Promega #M1801)
1 ml T4 Ligase (Promega #M1801, 3 U/ml)
Bring volume to 10 (or 20 see note below) ml with nuclease-free water.
If doing a blunt-end ligation, it may be needed to add PEG (up to 15%) to increase the efficiency.

Samples are incubated according to the guidelines below

Incubate sticky end ligation reactions at room temperature for 3 hours (or at 4 to 8 °C, overnight).
Incubate blunt-end ligation reactions at 17 °C for 4 to 18 hours.

After incubation the ligase is heat inactivated by placing tube in 65 °C water bath for 10 minutes. 2 ml of the ligation mixture is used for transformation. Transformed cells are plated on selective media and incubated overnight.

Site-directed mutagenesis

For removal of unwanted Restriction Sites, a PCR-based site direct mutagenesis protocol was adapted from [http://www.stratagene.com/manuals/200518.pdf Stratgene]. Oligos were designed to have a high (>78°C) T_m by applying the formula The following scheme was used for pipetting:


1 µl template (10 ng)
1 µl primer 1 (25µM)
1 µl primer 2 (25µM)
25 µl Mastermix 2x (Phusion)
22 µl dH2O

The PCR procedure was as follows:

Initial denaturation, 1 cycle
- 95 °C, 30 sec
Amplification, 16 cycles
- denaturation 95 °C, 50 sec
- annealing, 60 °C, 50 sec
- extension, 72 °C, 40sec/kb + 30sec
Final Extension,1 cycle
- 72 °C, 5 – 10 min
4 °C hold, forever

After completion, 1 µL of DpnI (NEB) was added and the mix was incubated for 1h at 37°C. Then, DH5alpha cells were transformed as described above.

DNA synthesis

Oligos were designed using [http://baderlab.bme.jhu.edu/gd/ GeneDesign]. 15Bp were chosen as an overhang and 56 °C as an annealing temperature. Oligos were ordered at a concentration of 100 µM. 1:10 dilutions of the first and last oligo were prepared. Then, all oligos (including first and last) were pooled at 1 µl each. Water was added to 10x the original volume. (So if a gene is synthesized from x = 14 oligos, water was added to 10*x = 140 µl). This pool was then diluted 1:10. x µl of the dilution were put into a PCR reaction with 25 µl Phusion master mix and 25-x µl water. PCR was conducted as following:

Initial denaturation, 1 cycle
- 95 °C, 5 min
Amplification, 7 cycles
- denaturation 95 °C, 30 sec
- annealing, 58 °C, 30 sec
- extension, 72 °C, 1 minute
4 °C hold, forever

Afterwards, 1 µl of the 1:10 dilutions of the innermost and outermost primer were added. The same PCR protocol was then repeated, but with 25 instead of 7 cycles. PCR products were run on a 2% agarose gel and gel purified.

Purification of DNA from PCR reactions

PCR products were purified by the QIAquick PCR Purification Kit from Qiagen following the instructions of the Qiagen Handbook. To check the purity and amount of extracted DNA an aliquot was analysed using a NanoDrop.

Enzymatic hydrolysis of DNA by restriction enzymes

Restriction digest Restriction digest of DNA was used for analysis of purified DNA form mini or maxiprep or for isolation of specific DNA fragments for further cloning. Analytical digestions were routinely conducted in 20 µl volume,preparative digestions were routinely conducted in 50 µl volume. In all digestions a minimum of 2 Units restriction enzyme(s) was used per microgram DNA. Optimised buffer conditions were secured by using NEB buffer system. The final reaction volume was achieved by adding H₂O_dest. The sample was incubated at optimal temperature for the restriction enzyme(s) (usually 37 °C). Analysis and preparation of DNA were either done by gelelectrophoreses (loading dye was added to the samples and they were loaded on a agarose gel) or alternatively PCR Purification (PCR Purification QIAquick Kit from Qiagen)

Phosphatasing with Shrimp Alkaline Phosphatase SAP is used for Dephosphorylation of 5'-ends of DNA in Restriction Enzyme Reaction. After restriction digest 1 unit of SAP is added for every 1 pmol of DNA ends (about 1 μg of a 3 kb plasmid) and incubated at 37°C for 30-60 min. The reaction is stopped by heating at 65°C for 15 min (this completely inactivates SAP) The minimum effective amount of SAP for dephosphorylation of 1 pmol of DNA termini in 1 hr at 37°C is:

0.05 units for 5'-protruding termini
0.05 units for blunt termini
0.1 units for 5'-recessed termini

Agarose gel electrophoresis for separating DNA

In the agarose gel electrophoresis a mixture of DNA fragments with different sizes are separated in an electrical field by their size. This is achieved by moving the negatively charged DNA through an agarose matrix while shorter fragments will run faster. The size of the pores can be controlled by agarose concentration. The higher the agarose concentration the smaller the pores are and the smaller fragments can be separated. Agarose concentrations between 0.7 and 1.5 % agarose in 0.5x TE buffer were used. The agarose was dissolved completely by heating up and 0.1 µg/ml ethidium bromide was added. The DNA fragments were separated using a constant voltage between 80 and 130 V. Under UV light (λ = 254 nm) DNA is visible through the unspecific intercalated ethidium bromide and can be documented or cut out and extracted from the gel.

Isolation of DNA fragments from an agarose gel

Plasmid DNA and DNA fragments were extracted using the Gel Extraction Kit from Qiagen following the manufacture instructions. To check the purity and amount of extracted DNA an aliquot was analysed using a NanoDrop.

[Back]

Cell Culture

Splitting cells

Cultures of HeLa, MCF7 and U2OS cells are splitted 1:10 every 3-4 days or 1:3 every day: DMEM+++ (see Material) covering the cells is removed and the cells are washed with 3 ml PBS. The PBS is removed after the washing step and 3 ml of trypsin are added to the flask; almost all of the Trypsin is removed again until the cells are only slightly covered with Trypsin. The trypsinized cells are then incubated for 5 min at 37 °C and 5% CO₂. After this incubation time, the cells are detached from the bottom and the flask is filled with 5 ml of DMEM+++. Cells are resuspended in medium by pipetting up and down. To achieve a diluton of 1:10, 0,5 ml of the suspension is transferred to another flask and 5 ml of DMEM+++ are added. This dilution is then incubated for 3-4 days at 37°C and 5% CO₂. The rest of the cell suspension (about 4 ml) is transferred to a 50 ml falcon tube and the same volume of DMEM+++ is added to the falcon. 9,6 µl of this dilution are transferred to a counting chamber and the number of cells is determined (x*10⁴).

Note 1: HeLa and U2-OS seem to grow faster than MCF-7; check notebook for information on splitting ratios

Transfection of Mammalian cells

1.Fugene (Roche) 10⁵ cells were moved to 6-well plates. 2,5 ml of DMEM medium plus addiditives were added. The following day, 97 µl pure DMEM was incubated for 5 minutes with 3 µl Fugene6 reagent at room temperature. Afterwards, the mixture was added dropwise to 500 ng of plasmid and allowed to incubate for 15 minutes at RT. The mixture was then added dropwise to the cells. Cells were incubated for 24 hours without selection pressure, afterwards, medium was changed and Zeocin was added to a concentration of 350 ng/ml.

2. Effectene Transfection (Qiagen) Move x (for apropriate amounts see table below) cells to 6-well plates/ LabTek 8 chamber and add 2 ml/0,5 ml DMEM+++. Incubate over night at 37 °C and 5 % CO₂.The following day, dilute x µg of DNA in Buffer EC to a total volume of x µl (note: Yara just adds 100 µl/50 µl). Add x µl of Enhancer and mix by tapping the tube (or vortex for 1 sec). Incubate for 2-5 min at RT. Add x µl of Effectene Transfection reagent to the DNA-Enhancer Mixture. Mix by tapping the tube (or vortexing for 10 s or pipetting up and down 5 times). Incubate samples for 5- 10 min at RT to allow for transfection-complex formation. While complex formation takes place, aspire medium and add x ml of fresh growth medium. After incubation time add the transfection -complexes drop-wise to the cells on the well. Gently swirl the plate to ensure uniform distribution of the complexes.

transient transfection: remove Effectene-DNA complexes after 6-18 hours, wash cells 1x with sterile PBS, add fresh medium. Incubate cells with the complexes under normal growth conditions for an appropriate time for expression.
stable transfection: change medium after 24 hours (wash with PBS); check confluency after 48 hours - (if required) split to 25 % confluency, add fresh medium and incubate 2-3 hours until cells have attached to culture dish. Then, remove medium and add fresh DMEM+++/Zeocin.

Culture format	Number of cells	DNA [µg]	Enhancer [µl]	Final Volume of DNA in Buffer EC [µl]	Effectene reagent [µl]	Volume of Medium to add to cells [µl]
96-well	10⁴	0,1	0,8	30	2,5	100
Ibidi	1,5*10⁴	0,15	1,2	50	4	200-250
24-well	4*10⁴	0,2	1,6	60	5,0	700
6-well	10⁵	0,4	3,2	100	10	2000

Freeze cells

Cells to be frozen should be confluent, but not too dense. Medium covering the cells is removed and cells are washed once with PBS. Afterwards cells are rinsed with 3 ml Trypsin; Trypsin is removed until the cells are only slightly covered (about 1 ml) and cells are incubated for about 5 min. After incubation, cells are resuspended in medium (at least about 4-5 times as much as Trypsin to inactivate that; used 5 ml). The suspension is transferred to 15 ml falcon and centrifuged at 2000 rpm for 3-5 minutes. The supernatant is discarded and the remaining pellet is resuspended in DMEM+++ (here: 7,5 ml for 5 aliquots, 1,5 ml each). 1,5 ml of the suspension is distributed into freezer vials. After adding of 150 µl DMSO to each vial, cells are put on ice and stored at -80 °C.

Picking cells with cloning disks

Foci of cells, which were under selection pressure (zeocin) are marked on the bottom of the petri dish (use pen from underneath the microscope). As many cloning disks as foci available are prepared by incubating them 3-5 minutes in trypsin (in a petri dish). Medium covering the cells is removed and cells are washed with PBS. PBS is removed till the cells are only slightly covered with it. The cloning disks are placed on the previousely marked spots and incubated for 3 minutes at 37 °C. During incubation a 96-well plate is prepared with 0,7 ml DMEM+++/Zeocin per well. The clonig disks are picked up with pressure (or swipe a little) to remove the entire foci off the plate and the cloning disk is transferred to the 96-well plate (one disk per well). Medium is pipetted up and down to loosen the cells from the cloning disks.

Fix cells for microscopy

The medium is removed from the cells on cover slips. 500 µl of 4% Paraformaldehyde (in PBS) is added to the cells and incubated for 10 minutes. PFA is taken off and cells are washed with 500 µl of PBS. Slides are labeled and a small drop of fluoromount is added with a pipet tip. Cover slips are washed in dH₂0, by picking them up with tweezers and dipping them into the water. Afterwards cover slips are dried with filter paper without the paper touching the cover slip side containing the cells. Cover slips are layed down on the drop of fluoromount with the cells facing downwards. Fixed cells are dried overnight and can then be used for fluorescence microscopy.

Induction

To induce the respective pathways specifically, we searched literature and used knowledge of groups working with the drugs. The following table is an overview of the pathways, the used drugs and the conditions for activation.

Pathway	mode	cell type	drug	stock concentration	dilution	final concentration	medium	time to leave on cells	remarks
HIF [1]	activator	MCF-7	[http://www.sigmaaldrich.com/catalog/ProductDetail.do?D7=0&N5=Product%20No.%7CBRAND_KEY&N4=D9533%7CSIGMA&N25=0&QS=ON&F=SPEC DFO]	50 mM	1:500	100 μM	minimal medium	24 h	together with HIF-bag
	inhibitor	MCF-7	Everolimus		1:500 000		minimal medium	24 h	without HIF-bag
SREBP [2], [8] [9]	activator	HeLa	Lipid-depleted-Serum (LDS)	-	0,5%	-	DMEM++	2-3 days	put on cells after transfection and put back on after 3 h with HPCD
	activator	HeLa	[http://www.sigmaaldrich.com/catalog/ProductDetail.do?D7=0&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&N4=H107%7CSIGMA&N25=0&QS=ON&F=SPEC HPCD]	500 mg/ml	1:100	500 μg/ml	DMEM++ with LDS	3 h	add after cells were 2-3 days in DMEM++ +LDS
	inhibitor	HeLa	[http://www.sigmaaldrich.com/catalog/ProductDetail.do?D7=0&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&N4=C8667%7CSIGMA&N25=0&QS=ON&F=SPEC Cholesterol]	10 mg/ml	1:1000	10 μg/ml	DMEM+++	2-3 days
	inhibitor	HeLa	[http://www.sigmaaldrich.com/catalog/ProductDetail.do?D7=0&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&N4=L7914%7CSIGMA&N25=0&QS=ON&F=SPEC LDL]	0,5 mg/ml	1:50	10 μg/ml	DMEM+++	2-3 days	got LDL from Jessica Schilde -> self-made in Runz' lab
NFκB[1] [10]	activator	U2-OS	[http://www.sigmaaldrich.com/catalog/ProductDetail.do?N4=T0157%7CSIGMA&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&F=SPEC&lang=null%3E TNFα]	2,5 mM	1:1000	2,5 μM	DMEM++	10 h
p53 [1],[5]	activator	MCF-7	[http://www.sigmaaldrich.com/catalog/ProductDetail.do?D7=0&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&N4=C9911%7CSIGMA&N25=0&QS=ON&F=SPEC Camptothecin]	2 mM	1:1000	2 μM	minimal medium	12 h
	inhibitor	MCF-7	[http://www.sigmaaldrich.com/catalog/ProductDetail.do?D7=0&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&N4=P4359%7CSIGMA&N25=0&QS=ON&F=SPEC Pifithrin-α]	2 mM	1:1000	2 μM	minimal medium	12 h
AHR [6]	activator	HeLa	[http://www.sigmaaldrich.com/catalog/ProductDetail.do?N4=B1760%7CSIGMA&N5=Product%20No.%7CBRAND_KEY&F=SPEC Benzo-a-pyrene]	100 mM	1:10 000	10 μM	DMEM+++	18 h
	activator	MCF-7	[http://www.sigmaaldrich.com/catalog/ProductDetail.do?lang=en&N4=48599%7CSUPELCO&N5=SEARCH_CONCAT_PNO%6CBRAND_KEY&F=SPEC TCDD]		1:3000		DMEM++	48 h
PPARγ [3],[4]	activator	U2-OS	[http://www.sigmaaldrich.com/catalog/ProductDetail.do?N4=88405X%7CFLUKA&N5=Product%20No.%7CBRAND_KEY&F=SPEC 2,4-Thiazolidinedione]	500 mM	1:100 000	5 μM	DMEM+++	60 h
Estrogen receptor	activator	MCF-7	[http://www.sigmaaldrich.com/catalog/ProductDetail.do?N4=E8875%7CSIGMA&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&F=SPEC β-Estradiol]	100 mM	1:10 000 000	10 μM	DMEM++	24 h	keep cells with DMEM++ for 24 h after transfections, then add drug
VDR [7]	activator	MCF-7	[http://www.sigmaaldrich.com/catalog/ProductDetail.do?D7=0&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&N4=D1530%7CSIGMA&N25=0&QS=ON&F=SPEC Vitamine D3]	100 μM	1:1000/ 1:10000	100 nM/ 1 nM	DMEM+++	24 h, 48 h, 72 h, 96 h	TECAN read every 24 hours -> see induction: FACS
c-Jun [1]	activator	HeLa	EGF	100μg/mL	1:1000	100ng/mL	DMEM+++	3h	after 3 h, EGF was removed and FACS measurement was carried out another 4 hours later

[Back]

RA-PCR

For a RA-PCR protocol, please refer to Project page

We used the following Oligo concentrations:

p53	NFκB II	HIF	Activator Mix
6µL p53 (O.91) 5µL p53 reverse (O.188) 1µL random (O.56) 1µL Activator Mix 0.8µL Stop 5 new (O.187) 0.8µL Stop 3 (O.58)	3µL NFkB-1 (O.93) 3µL NFκB-2 (O.94) 4µL NFκB-rev (O.194) 3µL Random (O.56) 2µL Activator Mix 0.8µL Stop 5 new (O.187) 0.8µL Stop 3 (O.58)	2,5µL HIF-1 (O.53) 2,5µL HIF-2 (O.54) 1µL CREB(O.89) 3µL HIF-rev (O.189) 3µL Random (O.56) 1µL Stop 5 new (O.187) 1µL Stop 3 (O.58) .2µL each Ap1, Sp1 (O.55, O.57)	2µL each Ap1, Sp1, CREB (O.55, O.57, O.89) 1µL each NFY, Empty (O.90, O.95) Water to 30µL
SREBP	AHR	pPARγ	Estrogen receptor
5µL SREBP (O.208) 4µL SREBP reverse (O.209) 1µL Sp1 (O.57) 2µL random (O.56) 1µL Activator Mix 0.8µL Stop 5 new (O.187) 0.8µL Stop 3 (O.58)	5µL AHR (O.212) 4µL AHR reverse (O.213) 2µL random (O.56) 1,5µL Activator Mix 0.8µL Stop 5 new (O.187) 0.8µL Stop 3 (O.58)	5µL pPARγ (O.210) 4µL pPARγ reverse (O.211) 2µL random (O.56) 1,5µL Activator Mix 0.8µL Stop 5 new (O.187) 0.8µL Stop 3 (O.58)	5µL Estrogen receptor (O.210) 4µL Estrogen receptor reverse (O.211) 2µL random (O.56) 1,5µL Activator Mix 0.8µL Stop 5 new (O.187) 0.8µL Stop 3 (O.58)

[Back]

Measurement and Screening

Screening by TECAN

Cells were grown in black 96 well plates (PerkinElmer) and induced as described for the various pathways. Outer wells were left free. After induction, media was removed and replaced by PBS. Fluorescence was then measured using a TECAN infiniteM200 automated plate reader (excitation = 488 nm, emission=518 nm). In order to account for variations in cell number, cells were stained by [http://www.sigmaaldrich.com/etc/medialib/docs/Sigma/Product_Information_Sheet/b2261pis.Par.0001.File.tmp/b2261pis.pdf Hoechst 33342 dye] . PBS was removed and replaced by PBS containing Hoechst 33342 dye at a concentration of 1µg/mL. Cells were allowed to incubate at room temperature for 30 minutes. Afterwards, medium was replaced by PBS again and fluorescence (excitation = 355nm, emission=455nm) was measured again by TECAN. Fluoresence values from the first reading were divided by fluorescence values of the second reading and multiplied by the lowest value of the second reading. Clones showing induction were considered further.

Flow Cytometry (FC)

Before preparing samples for flow cytometry the flow cytometer has to be turned on at least 20 min before the run. Samples are then prepared in the following way (this is for a 96 well plate): As much DMEM+++ as possible is removed from the cells. 60 µl Trypsin are added and the cells are incubated at 37 C for 10-15 min. Then, 160 µl of 1xPBS + 1% BSA are added. Samples are now ready for FC. At the FC the correct plate format is chosen. The plate is placed in the machine and the lid is taken off. When starting the flow cytometry measurement we first adjusted the gates and the background signal to the negative control. Measurement parameters such as plateformat, wells, and the desired protocol are chosen from the list. Volume and Mix iterations are are also chosen and saved as... .The discriminator is set to increase the threshold(2-10). The measurement is started with forward vs. side scatter in order to find cells. When cells are found, a gate (line) is added around the cells or cell candidates. Selected cells are then measured. Cells were prepared in 96-well format with 10^4 cells/well and transfected with the promoter of interest and if necessary induction drug was added for inducible promoters.

Microscopy/ Image Analysis

Microscopy images of our samples fixed with 4% formaldehyde were taken using the Nikon Eclipse 90i upright automated widefield microscope in the Nikon Imaging Center at the University of Heidelberg. Each image was taken in the GFP and mCherry channel and the exposure time had to be adjusted for over- or underexposed images. The conversion factor was experimentally determined by imaging a fluorescent plate with exposure time varying from 10 to 70 ms (the estimated range of our promoters) and plotting the mean grey values of these images versus time. A linear relationship between the exposure times and grey values was observed for this time frame and the conversion factor was determined to be 0.998. For image analysis we used the ImageJ (Image Processing and Analysis in Java) software measuring the mean grey values of each cell containing the promoter of interest. ImageJ is an open source software developed at the National Institutes of Health (http://rsbweb.nih.gov/ij/). The measurement is performed by setting the boundaries around the cells using the threshold in the mCherry image and generating a mask that is then applied to the image of the GFP channel in the following steps:

Open image and select split channels
Select mCherry image (all images should be 8-bit)
Go to Image> Adjust> Threshold
Set lower bar to maximum and adjust upper bar so that the cells are still visible
Remove unwanted spots such as dead cell using the drawing tools
Apply the threshold (image should appear in all white now with black spots indicating the cells)
Go to Process> Math> Divide and divide the image by 255 (image should be all white now)
Next go to Process> Image Calculator and multiply the GFP channel with the mCherry channel pictures.
Now select the result image and adjust the threshold so that the lower bar is set to the maximum (255) and the upper bar is set to 1 (only GFP containing cells should be visible through the mask)
Go to Analyze> Set Measurement and make sure the measurement is limited to the threshold and the result image of the multiplication is selected.
Go to Analyze> Measure.
Mean grey values should show up in the 'Results' window

Alternatively the images can be analyzed using the ROI manager where the cell have to be selected by hand using the drawing tools and added to the ROI list. In comparison the threshold method is much quicker and the results are comparable. We preselect the mCherry positive cells which are very likely to contain GFP. The mean grey values of 5-10 images per sample were averaged and adjusted to the same exposure time. The results were given in REU relative to JeT, which was always prepared as a reference sample for each measurement.

Real-time RT-PCR

Cells were collected as a pellet. Cell number must excede 1*10⁵cells/tube and no more than 6*10⁶/tube due to column capacity. In order to obtain reliable results and reduce the variance during the extraction, reverse transcription and PCR, we did the measurement for each promoter with 12 replicates from an identical sample. Resuspend the pellet with 600µl RLT buffer containing ß-ME (1:100). QIAcube follows protocol "RNeasy Mini Animal Cell QIAshredder Version 3" using RNeasy Plant Mini Kit. mRNA from untransfected HeLa cells was extracted to be "Standard" to perform plate-to-plate correction. After RNA is extracted, the extracts were put on ice immediately. 2 tubes of 5 µl aliquots were taken, One for measuring RNA concentration and one for gel electrophoresis. The RNA concentration was measured using NanoDrop under 230 nm. Each sample was measured 3 times. The gel electrophoresis was performed to confirm the RNA integrity because RNA degrade under many conditions. We used 1% agarose gel and 0.5x TAE buffer. Next step is the Real-time RT-PCR. We had different setup for different kits.

For SensiMix One-Step Kit (Quantace):
- 96-well reaction setup (25 µl/reaction):
  - 2X MasterMix: 12.5 µl
  - forward primer (5 µM): 1.0 µl
  - reverse primer (5 µM): 1.0 µl
  - probe (1.67 µM): 1.0 µl
  - RNase inhibitor: 0.5 µl
  - MgCl: 0.5 µl
  - RNase-free water: 3.5 µl
  - RNA template (20 ng/µl): 5.0 µl
- Program setup:
  - Reverse transcription: 49°C, 30 min
  - Enzyme activation: 95°C, 10 min
  - Amplification: 35 cycles:
    - 95°C, 10 s
    - 60°C, 1 min
For QuantiTect Probe RT-PCR Kit (QIAGEN):
- 96-well reaction setup (25 µl/reaction):
  - 2X MasterMix: 12.5 µl
  - forward primer (5 µM): 2 µl
  - reverse primer (5 µM): 2 µl
  - probe (1.67 µM): 2 µl
  - RNase-free water: 1.25µl
  - RT Mix: 0.25µl
  - RNA template (20 ng/µl): 5.0 µl
- Program setup:
  - Reverse transcription: 50°C, 30 min
  - Enzyme activation: 95°C, 15 min
  - Amplification: 45 cycles:
    - 94°C, 15 s
    - 60°C, 1 min

In each plate, the 5 housekeeping genes were crossed with 12 replicates as well as Standard. eGFP was mixed with 12 replicates and RNase-free water as negative control. After the program finished, data was collected from OneStep software 2.0 associated to the StepOnePlus system. With a certain threshold (0.05), a series of Ct values were determined, then analyzed with MatLab.

[Back]

References

[1] Brady N. Bioquant Heidelberg, Eils group; Personal communication.
[2] Schilde J. Institute for human genetics at the University of Heidelberg; Personal communication.
[3] Panigrahy D., Singer S., Shen L. Q., Butterfield C. E., Freedman D. A., Chen E. J., Moses M. A., Kilroy S., Duensing S., Fletcher C., Fletcher J. A., Hlatky L., Hahnfeldt P., Folkman J. & Kaipainen A. PPARγ ligands inhibit primary tumor growth and metastasis by inhibiting angiogenesis. Journal of clinical cancer 110: 923-932 (2002).
[4] Lucarelli E., Sangiorgi L., Maini V., Lattanzi G., Marmiroli S., Reggian M., Mordenti M., Gobbi G. A., Scrimieri F., Bertoja A. Z. & Picci P. Troglitazione affects survival of human osteosarcoma cells. International Journal of Cancer 98(3): 344-351 (2002).
[5] Komarov P. G., Komarova E. A., Kondratov R. V., Christov-Tselkov K., Coon J. S., Chernov M. V. & Gudkov A. V. A chemical inhibitor of p53 that protects mice from the side effects of cancer therapy. Science 285(5434): 1733-7 (1999).
[6] Wang S. H., Liang C. T., Liu Y. W., Huang M. C., Huang S. C., Hong W. F. & Su J. G. Crosstalk between activated forms of the aryl hydrocarbon receptor and glucocorticoid receptor. Toxicology 262(2): 87-97 (2009).
[7] Diesing D., Cordes T., Fischer D., Diedrich K. & Friedrich M. Vitamin D--metabolism in the human breast cancer cell line MCF-7. Anticancer Res. 26(4A): 2755-9 (2006).
[8] Bartz F., Kern L., Erz D., Zhu M., Gilbert D., Meinhof T., Wirkner U., Erfle H., Muckenthaler M., Pepperkok R. & Runz H. Identification of Cholesterol-Regulating Genes by Targeted RNAi Screening. Cell Metabolism 10: 63-75 (2009).
[9] Runz H., Miura K., Weiss M. & Pepperkok R. Sterols regulate ER-export dynamics of secretory cargo protein ts-O45-G. The EMBO Journal 25: 2953 - 2965 (2006).
[10] Treede I., Braun A., Jeliaskova P., Giese T., Füllekrug J., Griffiths G., Stremmel W. & Ehehalt R. TNF-α-induced up-regulation of pro-inflammatory cytokines is reduced by phosphatidylcholine in intestinal epithelial cells. BMC Gastroenterology 9:53 (2009)

[Back]

@@ Line 1: / Line 1: @@
 __NOTOC__
 {{Template_HD_3}}
 <html><body id="Notebook_mam"></body></html>
 {|
-|-valign="top" border="0"
+|-valign="top" border="0" style="margin-left: 2px;"
-|width="650px" style="padding: 0 20px 0 0; background-color:#ede8e2"|
+|width="650px" style="padding: 0 15px 15px 20px; background-color:#ede8e2"|
 __NOTOC__
+=Materials & Methods=
-=Material=
 ==Kits==
-{| class="wikitable"
+{| class="wikitable centered"  style="margin: 1em auto 1em auto"
-|- bgcolor=grey
+|- style="background-color:#99cccc;"
 ! height=20px, width=350px | Kit || width=350px | supplier
-|-style="height:20px"
+|- style="background-color:#9BDDFF;"
 |  ||
-|-align="center"
+|- style="background-color:#9BDDFF;"
-| style="font-weight:bold;" |CompactPrep Plasmid Maxi Kit || Qiagen
+| style="font-weight:bold;" |CompactPrep Plasmid Maxi Kit || QIAGEN
-|-align="center"
+|- style="background-color:#9BDDFF;"
-| style="font-weight:bold;" |HISpeed Plasmid Maxi Kit || Qiagen
+| style="font-weight:bold;" |High Pure PCR Template Preparation Kit || Roche
-|-align="center"
+|- style="background-color:#9BDDFF;"
-| style="font-weight:bold;" |QIAEX II Gel Extraction Kit || Qiagen
+| style="font-weight:bold;" |HISpeed Plasmid Maxi Kit || QIAGEN
-|-align="center"
+|- style="background-color:#9BDDFF;"
-| style="font-weight:bold;" |QIAprep Spin Mini Kit  || Qiagen
+| style="font-weight:bold;" |QIAprep Spin Mini Kit  || QIAGEN
-|-align="center"
+|- style="background-color:#9BDDFF;"
-| style="font-weight:bold;" |QIAquick Gel Extraction Kit || Qiagen
+| style="font-weight:bold;" |QIAquick Gel Extraction Kit || QIAGEN
-|-align="center"
+|- style="background-color:#9BDDFF;"
-| style="font-weight:bold;" |QIAquick PCR Purification Kit || Qiagen
+| style="font-weight:bold;" |QIAquick PCR Purification Kit || QIAGEN
-|-align="center"
+|- style="background-color:#9BDDFF;"
-| style="font-weight:bold;" |RNeasy Plant Mini Kit || Qiagen
+| style="font-weight:bold;" |RNeasy Plant Mini Kit || QIAGEN
-|-align="center"
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" |QuantiTect Probe RT-PCR Kit || QIAGEN
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" |SensiMix One-Step Kit || Quantace
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" |QuikChange XL Site-Directed Mutagenesis Kit || Strategene
 |-
 |}
-[[https://2008.igem.org/Team:Heidelberg/Notebook/material back]]
+[[Team:Heidelberg/Notebook_MaM#Material|[Back]]]
 ==Marker==
-{| class="wikitable"
+{| class="wikitable centered"  style="margin: 1em auto 1em auto"
-|- bgcolor=grey
+ |- style="background-color:#99cccc;"
 ! height=20px, width=350px | Marker || width=350px | supplier
-|-style="height:20px"
+|- style="background-color:#9BDDFF;"
-|  ||
-|-align="center"
 | style="font-weight:bold;" |GeneRuler™ High Range DNA Ladder || MBI Fermentas
-|-align="center"
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" |GeneRuler™ 1kb DNA Ladder Mix || MBI Fermentas
 |-
 |}
-[[https://2009.igem.org/Team:Heidelberg/Notebook/material back]]
+[[Team:Heidelberg/Notebook_MaM#Material|[Back]]]
 ==Enzymes==
-{| class="wikitable"
+{| class="wikitable centered"  style="margin: 1em auto 1em auto"
-|- bgcolor=grey
+ |- style="background-color:#99cccc;"
 ! height=20px, width=350px | Enzym || width=350px | supplier
 |-style="height:20px"
-|  ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
 | style="font-weight:bold;" |Pfu DNA polymerase || Stratagene
-|-align="center"
+|- style="background-color:#9BDDFF;"
-| style="font-weight:bold;" |Phusion DNA polymerase || Finnzymes
+| style="font-weight:bold;" |Phusion DNA polymerase, Mastermix 2x || Finnzymes
-|-align="center"
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" |Taq DNA polymerase || MBI Fermentas
-|-align="center"
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" |T4 DNA ligase || MBI Fermentas / New England Biolabs
-|-align="center"
-| style="font-weight:bold;" |Reverse transcriptase || Quantace
 |-style="height:20px"
-|  ||
 |}
+[[Team:Heidelberg/Notebook_MaM#Material|[Back]]]
 ==Restriction Enzymes==
-{| class="wikitable"
+{| class="wikitable centered"  style="margin: 1em auto 1em auto"
-|- bgcolor=grey
+ |- style="background-color:#99cccc;"
 ! height=20px, width=350px | Enzym || width=350px | supplier
 |-style="height:20px"
-|  ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
 | style="font-weight:bold;" |BclI || MBI Fermentas
-|-align="center"
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" |EcoRI || New England Biolabs
-|-align="center"
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" |HindIII || New England Biolabs
-|-align="center"
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" |MfeI || New England Biolabs
-|-align="center"
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" |NheI || New England Biolabs
-|-align="center"
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" |NotI || New England Biolabs
-|-align="center"
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" |PstI || New England Biolabs
-|-align="center"
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" |ScaI || New England Biolabs
-|-align="center"
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" |SpeI || New England Biolabs
-|-align="center"
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" |SspI || New England Biolabs
-|-align="center"
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" |SphI || New England Biolabs
-|-align="center"
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" |XbaI || New England Biolabs
 |-
 |}
-[[https://2008.igem.org/Team:Heidelberg/Notebook/material back]]
+[[Team:Heidelberg/Notebook_MaM#Material|[Back]]]
 ==Bacteria==
-{| class="wikitable"
+{| class="wikitable centered"  style="margin: 1em auto 1em auto"
-|- bgcolor=grey
+ |- style="background-color:#99cccc;"
 ! height=20px, width=200px | E.coli strain || width=250px | usage || width=250px | reference
 |-style="height:20px"
-|  ||  ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
 | style="font-weight:bold;" |DH5a || amplification of plasmids || Invitrogen
-|-align="center"
+|- style="background-color:#9BDDFF;"
-|-align="center"
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" |SCS110 || amplification of unmethylated plasmids || Stratagene
-|-align="center"
+|- style="background-color:#9BDDFF;"
 |}
-[[https://2008.igem.org/Team:Heidelberg/Notebook/material back]]
+[[Team:Heidelberg/Notebook_MaM#Material|[Back]]]
 ==Bacteria Growth Media==
-{| class="wikitable"
+'''Luria Broth (LB)'''<br>
-|- bgcolor=grey
+* 10 g/L tryptone
-|-align="center"
+* 5 g/L yeast extract
-| style="font-weight:bold;" |Luria Broth (LB) || 10 <sup>g</sup>/<sub>l</sub> || tryptone
+* 10 g/L  NaCl
-|-align="center"
+{| class="wikitable centered"  style="margin: 1em auto 1em auto"
-| style="font-weight:bold;" | || 5 <sup>g</sup>/<sub>l</sub> || yeast extract
+ |- style="background-color:#99cccc;"
-|-align="center"
-| style="font-weight:bold;" | || 10 <sup>g</sup>/<sub>l</sub> || NaCl
-|-align="center"
-| style="font-weight:bold;" | || ||
-|-align="center"
-|-
-|}
-[[https://2008.igem.org/Team:Heidelberg/Notebook/material back]]
-{| class="wikitable"
-|- bgcolor=grey
 ! height=20px, width=200px | Antibiotic || width=250px | concentration
 |-style="height:20px"
-|  ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
 | style="font-weight:bold;" |Ampicillin || 100 mg/ml
-|-align="center"
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" |Kanamycin || 50 mg/ml
 |-
 |}
+[[Team:Heidelberg/Notebook_MaM#Material|[Back]]]
 ==Eucaryotic cell lines==
-'''MCF-7 '''
+*'''[[Team:Heidelberg/Eukaryopedia#MCF-7| MCF-7]] '''
+*''' [[Team:Heidelberg/Eukaryopedia#HeLa| HeLa]]'''
+*''' [[Team:Heidelberg/Eukaryopedia#U2-OS| U2-OS]]'''
-MCF-7 is a hormone-dependent, poorly invasive human breast cancer cell line [[Notebook/material#References|[1]]]. Originally, the cell line was derived from a postmenopausal woman with metastatic breast cancer at the Michigan Cancer Foundation. It was observed, however, that cell lines used in different laboratories vary greatly in their biological characteristics, so that it is suggested that they were derived from different patients [[Notebook/material#References|[2]]]. MCF-7 cells are estrogen-receptor positive and require estrogen for tumorigenesis in vivo. 17β-estradiol induces an TGFα-like activity [[Notebook/material#References|[3]]], which promotes tumor growth and progression [[Notebook/material#References|[4]]]. Furthermore the cells express receptors for and respond to several other hormones including androgen, progesterone, glucocorticoids, insulin, epidermal growth factor, insulin-like growth factor, prolactin and thyroid hormone [[Notebook/material#References|[2]]].
+[[Team:Heidelberg/Notebook_MaM#Material|[Back]]]
-''' HeLa'''
-The cells were originally derived in 1952 from '''He'''nrietta '''La'''cks, who suffered from an adenocarcinoma of the cervix. The HeLa cells were the first human epithelial cells established in long-term culture [[Notebook/material#References|[5]]]. There are three main characteristics of the genome of HeLa by which they can be recognized: hypertriploid chromosome number (3n+), 20 clonally abnormal chromosomes and the integration of multiple copies of HPV18 (Human Papilloma Virus) at various sites [[Notebook/material#References|[6]]]. It has been shown, that the HeLa genome has been remarkably stable after years of subcultivation [[Notebook/material#References|[6]]], but it is also possible to select strains of HeLa cells with certain properties by putting them under selection pressure [[Notebook/material#References|[7]]].
-''' U2-OS '''
-U2-OS, formerly known as 2T cell line [[Notebook/material#References|[8]]], were derived from a 15-year-old girl with a moderately differentiated osteogenic sarcoma of the shinbone. Cell culture of U2-OS started at the time of amputation of the left leg on September 3, 1964 [[Notebook/material#References|[9]]]. U2-OS cells express adhesion molecules such as integrins, Ig-CAMs and chemokine receptors as well as growth factors which are either constitutively expressed (such as IL-7) or inducible (such as TNF) by PMA (phorbol ester) or ionomycine. The adhesion molecules and growth factors support the growth of CD34 progenitor cells [[Notebook/material#References|[10]]].
-===References===
-[1] Clark, R. (1990) The process of malignant progression in human breast cancer. ''Annals of oncology: official journal of the European Society for Medical Oncology/ESMO'' 1: 401-407.<br>
-[2] Osborne, C. K., Hobbs, K. & Trent, J. M. (1987) Biological differences among, MCF-7 human breast cancer cell lines from different laboratories. ''Breast Cancer Research and Treatment'' 9: 111-121.<br>
-[3] Dickson, R. B., Bates, S. E., McManaway, M. E. & Lippman, M. E. (1986) Characterization of Estrogen Responsive Transforming Activity in Human Breast Cancer Cell Lines. ''Cancer Research'' 46: 1707-1713.<br>
-[4] Booth, B. W. & Smith, G. H. (2007) Roles of transforming growth factor-α in mammary development and disease. ''Growth Factors'' 25: 227-235.<br>
-[5] Gey, G. O., Coffman, W. D. & Kubicek, M. T. (1952) Tissue culture studies of the proliferative capacity of cervical carcinoma and norml epithelium. ''Cancer Research'' 12: 264-265 <br>
-[6] Macville, M., Schroeck, E., Padilla-Nash, H., Keck, C., Ghadimi, M. B.,Zimonjic, D., Pospecu, N.  & Ried, T. (1999) Comprehensive and definitive moleculare cytogenic characterization of HeLa cells by spectral karyotyping. ''Cancer Research'' 59: 141-150 <br>
-[7] Masters, J. R. (2002) HeLa cells 50 years on: the good, the bad and the ugly.'' Nature Reviews'' 2:315-319 <br>
-[8] Ek, E. T. H., Dass, C. R. & Choong, P. F. M. (2006) Commonly used mouse models of osteosarcoma. ''Critical Reviews in Oncology/Hematology'' 60: 1-8.<br>
-[9] Ponten, J. & Saksela, E. (1967) Two established in vitro cell lines from human mesenchymal tumours. ''International Journal of Cancer'' 2: 434-447.<br>
-[10] Nelissen, J. M. D. T., Torensma, R., Pluyter, M., Adema, G. J., Raymakers, R. A. P., van Kooyk, Y. & Figdor, C. G. (2000) Molecular analysis of the hematopoiesis supporting osteoblastic cell line U2-OS. ''Experimental Hematology'' 28: 422-432.<br>
 ==Cell Culture Media==
 ===DMEM+++===
 * DMEM
-* 1% Glucosamin
+* 1% L-Glutamine
 * 1% Pen/Strep
 * 10% FCS
@@ Line 183: / Line 153: @@
 ===DMEM++===
 * DMEM
-* 1% Glucosamin
+* 1% L-Glutamin
 * 1% Pen/Strep
 * 1% non-essential aminoacids
@@ Line 190: / Line 160: @@
 * DMEM+++
 * 100 µl/ml Zeocin
+===Hygromycin-Medium===
+* DMEM+++
+* 200 µl/ml Hygromycin
 ===Minimal Medium===
-* 2,1 g/l NaHCO3
+* 2,1 g/l NaHCO<sub>3</sub>
-* 1µM CaCl2
+* 1µM CaCl<sub>2</sub>
 * 10 µM Hepes-Buffer [https://www.sigmaaldrich.com/catalog/ProductDetail.do?D7=0&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&N4=70216%7CFLUKA&N25=0&QS=ON&F=SPEC]<br>
 * 1 % Pen/Strep
 * Krebs-Henseleit-Buffer (Sigma-Aldrich [http://www.sigmaaldrich.com/etc/medialib/docs/Sigma/Product_Information_Sheet/1/k3753pis.Par.0001.File.tmp/k3753pis.pdf])<br>
+[[Team:Heidelberg/Notebook_MaM#Material|[Back]]]
 == Oligos ==
-===Oligos used for [[Project/Synthetic_promoters|RA-PCR]]===
+We used [http://www.lablife.org LabLife], a great, non-commercial lab management resource for lab management and especially for keeping track of Oligos we used. All Oligos therefore are numbered, and all Notebook entries describing PCR reactions refer to a certain number of Oligo. A complete list of all Oligos we had in our lab can be downloaded [[Media:HD09_complete_oligo_list.txt|as comma-separated values]]; find below a list of more interesting oligos we used for RA-PCR and LAM-PCR.
+===Oligos used for [[Team:Heidelberg/Project_Synthetic_promoters|RA-PCR]]===
-{| class="wikitable centered" border="2" rules="rows" width="800px" style="border-color:white;"
+{| class="wikitable centered"  style="margin: 1em auto 1em auto"
-|-
+ |- style="background-color:#99cccc;"
 ! Name
 ! Sequence
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|Stop 5'
 |width="500px"|CAGTACTAGTGGGTGACGGGTTCA
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|Stop 3'
 |width="500px"|TGACAAGCTTAGTGAACCCGTCACCC
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|Sp1 responsive (general transactivator)
 |width="500px"|GCGATCGGCAGATCAGGGGCGGGGCGGGTGACGGGTTCA
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|Ap1 responsive (general transactivator)
 |width="500px"|GCGATCGGCAGATCATGACTCAGGGTGACGGGTTCA
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|CREB responsive (general transactivator)
 |width="500px"|GCGATCGGCAGATCABNBVNTGACGTCAGGGTGACGGGTTCA
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|NFY responsive (general transactivator)
 |width="500px"|GCGATCGGCAGATCANNCCAATNNGGGTGACGGGTTCA
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|Spacer forward
 |width="500px"|GCGATCGGCAGATCANNNNNNNNNNGGGTGACGGGTTCA
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|Spacer reverse
 |width="500px"|TGATCTGCCGATCGCNNNNNNNNNNTGAACCCGTCACCC
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|AHR responsive, forwards
 |width="500px"|GCGATCGGCAGATCACCYCNRRSTNGCGTGASAGGGTGACGGGTTCA
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|AHR responsive, reverse
 |width="500px"|TGATCTGCCGATCGCASAGTGCGNTSRRNCYCCTGAACCCGTCACCC
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|Estrogen Receptor responsive, forward v 1
 |width="500px"|GCGATCGGCAGATCAGGTCACTGTGACCGGGTGACGGGTTCA
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|Estrogen Receptor responsive, forward v 2
 |width="500px"|GCGATCGGCAGATCARGNCANNNTGACCYGGGTGACGGGTTCA
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|Estrogen Receptor responsive, reverse
 |width="500px"|TGATCTGCCGATCGCCCAGTGTCACTGGTGAACCCGTCACCC
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|HIF responsive, forward v 1
 |width="500px"|GCGATCGGCAGATCATCTGTACGTGACCACAGGGTGACGGGTTCA
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|HIF responsive, forward v 2
 |width="500px"|GCGATCGGCAGATCAGTCTACGTGCGGACGGGTGACGGGTTCA
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|NF&kappa;B responsive, forward v 1
 |width="500px"|GCGATCGGCAGATCAGGGGACTTTGCCGGGTGACGGGTTCA
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|NF&kappa;B responsive, forward v 2
 |width="500px"|GCGATCGGCAGATCAGGGGRWYYCCCGGGTGACGGGTTCA
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|NF&kappa;B responsive, reverse
 |width="500px"|TGATCTGCCGATCGCCCGTTTCAGGGGTGAACCCGTCACCC
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|p53 responsive, forward
 |width="500px"|GCGATCGGCAGATCAGAACATGTCCAAGCATGCTGGGGTGACGGGTTCA
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|PPAR&gamma; responsive, reverse
 |width="500px"|TGATCTGCCGATCGCHACTGGAAACTGGRRTGAACCCGTCACCC
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|PPAR&gamma; responsive, forward
 |width="500px"|GCGATCGGCAGATCARRGGTCAAAGGTCAHGGGTGACGGGTTCA
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|SREBP responsive, forward
 |width="500px"|GCGATCGGCAGATCAKATCACCCCACGGGTGACGGGTTCA
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|SREBP responsive, reverse
 |width="500px"|TGATCTGCCGATCGCCACCCCACTAKTGAACCCGTCACCC
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|p53 reverse
 |width="500px"|TGATCTGCCGATCGCGTCGTACGAACCTGTACAAGTGAACCCGTCACCC
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|HIF reverse
 |width="500px"|TGATCTGCCGATCGCGATCCGTCGTGCATCAGTGTGAACCCGTCACC
+|-
 |}
 ===Oligos for LAM-PCR===
-{| class="wikitable centered" border="2" rules="rows" width="800px" style="border-color:white;"
-|-
+{| class="wikitable centered"  style="margin: 1em auto 1em auto"
+ |- style="background-color:#99cccc;"
 ! Name
 ! Sequence
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|LAMPCR9_1 (biotinylated)
 |width="500px"|AATACCGCGCCACATAGCAG
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|LAMPCR9_2 (biotinylated)
 |width="500px"|TTCTTCGGGGCGAAAACTCT
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|LAMPCR9_3 (biotinylated)
 |width="500px"|CACTCGTGCACCCAACTGAT
-|-
+|- style="background-color:#9BDDFF;"
 |width="300px"|LAMPCR9_4
 |width="500px"|TCTGGGTGAGCAAAAACAGGA
+|-
 |}
+===Oligos for real-time RT-PCR===
+{| class="wikitable centered"  style="margin: 1em auto 1em auto"
+ |- style="background-color:#99cccc;"
+! Name
+! Sequence
+|- style="background-color:#9BDDFF;"
+|width="300px"|GAPDH_forward_primer
+|width="500px"|GGTATCGTGGAAGGACTCATGACC
+|- style="background-color:#9BDDFF;"
+|width="300px"|GAPDH_reverse_primer
+|width="500px"|GATGACCTTGCCCACAGCCTTG
+|- style="background-color:#9BDDFF;"
+|width="300px"|GAPDH_probe
+|width="500px"|CTCTCCAGAACATCATCCCTGCCTCTAC
+|- style="background-color:#9BDDFF;"
+|width="300px"|G6PD_forward_primer
+|width="500px"|GAGTCCTGCATGAGCCAGATAGG
+|- style="background-color:#9BDDFF;"
+|width="300px"|G6PD_reverse_primer
+|width="500px"|GCACCATGAGGTTCTGCACCATC
+|- style="background-color:#9BDDFF;"
+|width="300px"|G6PD_probe
+|width="500px"|ACCAGATCTACCGCATCGACCACTACCT
+|- style="background-color:#9BDDFF;"
+|width="300px"|18s_rRNA_forward_primer
+|width="500px"|GGCCCTGTAATTGGAATGAGTCCAC
+|- style="background-color:#9BDDFF;"
+|width="300px"|18s_rRNA_reverse_primer
+|width="500px"|GCTCCCAAGATCCAACTACGAGCTT
+|- style="background-color:#9BDDFF;"
+|width="300px"|18s_rRNA_probe
+|width="500px"|CAGCAGCCGCGGTAATTCCAGCTCC
+|- style="background-color:#9BDDFF;"
+|width="300px"|G2TUB_forward_primer
+|width="500px"|TTCTACCAGGCAGACGATGAGCAC
+|- style="background-color:#9BDDFF;"
+|width="300px"|G2TUB_reverse_primer
+|width="500px"|CCCAGTTGTTGCCAGCTCCTC
+|- style="background-color:#9BDDFF;"
+|width="300px"|G2TUB_probe
+|width="500px"|CTGCTGGACTTGGAACCCCGGGTG
+|- style="background-color:#9BDDFF;"
+|width="300px"|bACT_forward_primer
+|width="500px"|CAGGCACCAGGGCGTGATGG
+|- style="background-color:#9BDDFF;"
+|width="300px"|bACT_reverse_primer
+|width="500px"|CTCCATGTCGTCCCAGTTGGTG
+|- style="background-color:#9BDDFF;"
+|width="300px"|bACT_probe
+|width="500px"|AGGATTCCTATGTGGGCGACGAGGC
+|- style="background-color:#9BDDFF;"
+|width="300px"|eGFP_forward_primer
+|width="500px"|CGACCACATGAAGCAGCACGAC
+|- style="background-color:#9BDDFF;"
+|width="300px"|eGFP_reverse_primer
+|width="500px"|CGATGCCCTTCAGCTCGATGC
+|- style="background-color:#9BDDFF;"
+|width="300px"|eGFP_probe
+|width="500px"|AGGCTACGTCCAGGAGCGCACCATC
+|- style="background-color:#9BDDFF;"
+|width="300px"|mCherry_forward_primer
+|width="500px"|CAAGTGGGAGCGCGTGATGAAC
+|- style="background-color:#9BDDFF;"
+|width="300px"|mCherry_reverse_primer
+|width="500px"|CCAGCCCATGGTCTTCTTCTGC
+|- style="background-color:#9BDDFF;"
+|width="300px"|mCherry_probe
+|width="500px"|TGACCGTGACCCAGGACTCCTCCC
+|-
+|}
+[[Team:Heidelberg/Notebook_MaM#Material|[Back]]]
 == Plasmids ==
 The following is a list of all used plasmids. Some of them are just working plasmids, others are of greater value for our project. The latter are bold in the table.
+{| class="wikitable centered"  style="margin: 1em auto 1em auto"
-{| class="wikitable"
+ |- style="background-color:#99cccc;"
-|- bgcolor=grey
 ! height=20px, width=100px | Plasmid Abbreviation || width=200px | plasmid name || width=200px | insert || width=300px | remarks || width=100px | resistance
 |-style="height:20px"
-|  ||  ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | P1 || pcDNA5/FRT ||  ||  || Ampicillin/Hygromycin
-| style="font-weight:bold;" | P1 || pcDNA5/FRT || - ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | P2 || pEGFP template ||  ||  || Ampicillin
-| style="font-weight:bold;" | P2 || pEGFP template || - ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | P3 || mcherry template ||  ||  || Kanamycin
-| style="font-weight:bold;" | P3 || mcherry template || - ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | P4 || mcherry &Delta;PstI ||  ||  || Kanamycin (?)
-| style="font-weight:bold;" | P4 || mcherry &Delta;PstI || - ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | P5 || pcDNA5/FRT &Delta;PstI ||  ||  || Ampicillin/Hygromycin
-| style="font-weight:bold;" | P5 || pcDNA5/FRT &Delta;PstI || - ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | '''P6''' || '''pcDNA5/FRT &Delta;PstI/&Delta;EcoRI''' ||  || '''negative control for [[Team:Heidelberg/Project_Measurement#Measuring_REU_by_flow_cytometry_and_image_analysis|measurements]]''' || '''Ampicillin/Hygromycin'''
-| style="font-weight:bold;" | P6 || pEGFP template || - ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | P7 || pcDNA5/FRT &Delta;PstI/&Delta;EcoRI *unmethylated* || - || transformed in [[Team:Heidelberg/Notebook_MaM#Bacteria|SC110]] || Ampicillin/Hygromycin
-| style="font-weight:bold;" | P7 || pcDNA5/FRT &Delta;Pst/&Delta;EcoRI *unmethylated* || - || transformed in [[Notebook/material#Bacteria|SC110]]
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | P8 || Part:BBa_E0040 || E0040 (GFPmut3B) || does not seem to work in eukaryotes || Ampicillin
-| style="font-weight:bold;" | P8 || Part:BBa_E0040 || E0040 (GFPmut3B) || does not seem to work in eukaryotes
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | P9 || pFRT/''lacZeo'' || - || plasmid was stably integrated in cell lines and used for [[Team:Heidelberg/stables|stable integration]] of constructs || Ampicillin/Zeocin
-| style="font-weight:bold;" | P9 || pFRT/lacZeo || - || plasmid was stably integrated in cell lines and used for stable integration of constructs; has Zeocin resistance
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | P10 || pcDNA5/FRT &Delta;PstI/&Delta;EcoRI EGFP || EGFP (from pEGFP-N1) ||  || Ampicillin/Hygromycin
-| style="font-weight:bold;" | P10 || pcDNA5/FRT EGFP || EGFP (from pEGFP-N1) ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | P11 || pcDNA5/FRT &Delta;PstI/&Delta;EcoRI mcherry JeT || mCherry, Jet promoter || || Ampicillin/Hygromycin
-| style="font-weight:bold;" | P11 || pcDNA5/FRT/mcherry JeT || mCherry, Jet promoter ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | P12 || pcDNA5/FRT &Delta;PstI/&Delta;EcoRI mcherry Min || mCherry, Min promoter || || Ampicillin/Hygromycin
-| style="font-weight:bold;" | P12 || pcDNA5/FRT/mcherry Min || mCherry, Min promoter ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | P13 || pcDNA5/FRT &Delta;PstI/&Delta;EcoRI GFPb3mut || E0040 (GFPmut3B) || || Ampicillin/Hygromycin
-| style="font-weight:bold;" | P13 || pcDNA5FRT/GFPb3mut || E0040 (GFPmut3B) ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | '''P23''' || '''psB1A3 - Registry''' || '''J04450 (RFP device)''' || '''backbone used for creation of BBb submission plasmid''' || '''Ampicillin'''
-| style="font-weight:bold;" | P23 || psB1A3 - Registry || J04450 (RFP device) ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | P27 || pEGFP-N1 || EGFP || preliminary (+) control for transfection || Kanamycin
-| style="font-weight:bold;" | P27 || pEGFP-N1 || EGFP || preliminary (+) control for transfection
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | P29 || pSB1A3 - Registry || P1010 ||  || Ampicillin
-| style="font-weight:bold;" | P29 || pSB1A3 registry || P1010 ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | P30 || pcDNA5/FRT &Delta;PstI/&Delta;EcoRI GFP Min || GFP, Min promoter ||  || Ampicillin/Hygromycin
-| style="font-weight:bold;" | P30 || pcDNA5/FRT/GFP Min || GFP, Min promoter ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | '''P31''' || '''pcDNA5/FRT &Delta;PstI/&Delta;EcoRI GFP BBbJeT''' || '''GFP, standardized JeT promoter''' ||  || '''Ampicillin/Hygromycin'''
-| style="font-weight:bold;" | P31 || pcDNA5/FRT/GFP JeT || GFP, JeT promoter ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | P32 || CFP_emp_cytosole || CFP, cytosole localization signal || template || Kanamycin
-| style="font-weight:bold;" | P32 || CFP_emp_cytosole || CFP ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | P33 || YFP_emp_cytosole || YFP, cytosole localization signal || template || Kanamycin
-| style="font-weight:bold;" | P33 || YFP_emp_cytosole || YFP ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | P34 || YFP_GPI_PM || YFP, PM localization signal || template || Kanamycin/Neomycine
-| style="font-weight:bold;" | P31 || pcDNA5/FRT/GFP JeT || GFP, JeT promoter ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | P35 || CFP_GPI_PM || CFP, PM localization signal || template || Kanamycin/Neomycine
-| style="font-weight:bold;" | P31 || pcDNA5/FRT/GFP JeT || GFP, JeT promoter ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | P36 || YFP_Sar1_ER || YFP, ER localization signal || template || Kanamycin
-| style="font-weight:bold;" | P31 || pcDNA5/FRT/GFP JeT || GFP, JeT promoter ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | P37 || CFP_Sar1_ER || CFP, ER localization signal || template || Kanamycin
-| style="font-weight:bold;" | P31 || pcDNA5/FRT/GFP JeT || GFP, JeT promoter ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | P38 || EBFP_NLS_nucleus || EBFP, nuclear localization signal || template || Kanamycin
-| style="font-weight:bold;" | P31 || pcDNA5/FRT/GFP JeT || GFP, JeT promoter ||
+|- style="background-color:#9BDDFF;"
-|-align="center"
+| style="font-weight:bold;" | P39 || eYFP_NLS-cas8_nucleus || EYFP, nuclear localization signal || template || Kanamycin
-| style="font-weight:bold;" | P31 || pcDNA5/FRT/GFP JeT || GFP, JeT promoter ||
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | P40 || mCherry_H2B_nucleus || mCherry, nuclear localization signal || template || Kanamycin
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | P41 || eYFP_H2B_nucleus || EYFP, nuclear localization signal || template || Kanamycin
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | P42 || GFP_myrpalm_PM || GFP, PM localization signal || template || Kanamycin
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | P43 || mCherry_myrpalm_PM || mCherry, PM localization signal || template || Kanamycin
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | P44 || GFP_mitomeet_Mitochondria || GFP, mitochondrial localization signal || template || Kanamycin
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | P45 || pOG44 || FLP || contains FLP enzymes that is used for [[Team:Heidelberg/stables|stable integration]] of pcDNA5/FRT derived plasmids at FRT sites in the genome || Ampicillin
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | P46 || Oakes NFkB || 5x NF&kappa;B responsive element || backbone: pGL3 || Ampicillin
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | P47 || Oakes NFAT || NFAT RE || backbone: pGL4 || Ampicillin
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | '''P48''' || '''p31_cmv_core_Jet_prox''' || '''CMV core promoter, JeT proximal promoter''' || '''standardized (BBb) fused promoter''' || '''Ampicillin/Hygromycin'''
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | '''P49''' || '''BBb_JeT pSB1A3''' || '''standardized JeT promoter''' || '''backbone: pSB1A3; our very first plasmid to be send to the registry!''' || '''Ampicillin'''
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | '''P51''' || '''pcDNA5/FRT &Delta;PstI/&Delta;EcoRI BBbJeT''' || '''standardized JeT promoter''' ||  || '''Ampicillin/Hygromycin'''
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | P52 || hsp70-EGFP || EGFP, hsp70 promoter || [[Team:Heidelberg/Project_Natural_promoters#Methods|natural heat sensitive promoter]]|| Kanamycin
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | '''P53''' || '''pcDNA/FRT &Delta;PstI/&Delta;EcoRI BBbCMV''' || standardized CMV promoter ||  || Ampicillin/Hygromycin
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | '''P55''' || '''pcDNA5/FRT &Delta;PstI/&Delta;EcoRI GFP_BBbCMV''' || '''GFP with standardized CMV promoter''' || '''exactly the same plasmid as P31 except for the promoter''' || '''Ampicillin/Hygromycin'''
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | P56 || p31 CYP1A1 || GFP, CYP1A1 promoter || [[Team:Heidelberg/Project_Natural_promoters#Methods|natural promoter]] || Ampicillin/Hygromycin
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | '''P57''' || '''pcDNA/FRT &Delta;PstI/&Delta;EcoRI mCherry_BBbJeT''' || '''mCherry with standardized JeT promoter''' || '''same plasmid as P31 except for fluorescent protein; used for cotransfection for [[Team:Heidelberg/Project_Measurement#Measuring_REU_by_flow_cytometry_and_image_analysis|measurements]]''' || '''Ampicillin/Hygromycin'''
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | P58 || intron in submission plasmid ||  ||  || Ampicillin
 |}
+[[Team:Heidelberg/Notebook_MaM#Material|[Back]]]
+== Instruments ==
+The following is a list of all used Instruments.
+{| class="wikitable centered"  style="margin: 1em auto 1em auto"
+ |- style="background-color:#99cccc;"
+! height=20px, width=300px |Instrument|| width=300px | Name || width=300px | Manufactor
+|-style="height:20px"
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Table Centrifuge || Microfuge'''®''' 18 Centrifuge || Beckman Coulter<sup>TM</sup>
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Table Centrifuge  || MicrofugeR 22'''®''' Centrifuge  || Beckman Coulter<sup>TM</sup>
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Centrifuge  ||  Allegra X-12 || Beckman Coulter<sup>TM</sup>
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" |  Shaker || VORTEXGENIER 2  || Scientific Industries, SI<sup>TM</sup>
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" |  Heating plate (magnet stirrer) || MR Hei-Standard  || Heidolph
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" |  Heatblock || QBD4  || Grant
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" |  Heatblock (shakeing function) || Thermomixer comfort  || Eppendorf
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | PCR-machine  || MyCycler<sup>TM</sup> thermo cycler  || BioRad
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" |  UV-chamber ||  Transluminator || Vilber Lourmat
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Scale (fine)  || Pioneer<sup>TM</sup> PA114C  || OHAUS
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" |  Scale ||  Pioneer<sup>TM</sup> PA4101C || OHAUS
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Fridge  || KTP 1750 Premium || Liebherr
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Freezer  || GP 1366 Premium  || Liebherr
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | -86 Freezer  ||  -86°C Ultralow Freezer || NUAIRE<sup>TM</sup>
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" |  Hood || Tischabzug  || Wesemann'''®''' Laboreinrichtung
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Draw-off pump  || Vacuhand control  || Vacubrand
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Incubator  || HT Multitron Version 2  || INFORS
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Incubator (cell culture)  || HERAcell 150  || Thermo electron coorperation
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Hood (cell culture)  || HERAsafe  || Thermo electron coorperation
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Plate reader  || Infinite M200  || TECAN
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | FACS  || Cytomics FC 500 MPL  || Beckman Coulter<sup>TM</sup>
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Microscope  || CKX41  || Olympus
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Computer  ||   || Sun Microsystems
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | UV/Visivle Spectrometer  || Ultrospec 3300 pro  || Amersham Biosciences
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Photometer  || NanoDrop'''®''' ND-1000 Spectrophotometer  || peQLab Biotechnologie GmbH
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Photometer  || NanoVue<sup>TM</sup>  || General Electric
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Ice Machine  || MF22  || SCOTSMAN'''®'''
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Gel electrophoresis chamber  || Mupid'''®'''-One  || Advance
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | pipetting robot  || QIAcube<sup>TM</sup>  || QIAGEN
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Wide field microscope  || Nikon Eclipse 90i  || Nikon
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | PCR machine  || MyCycler thermal cycler  || BIO-RAD
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Real-time PCR machine  || StepOnePlus<sup>TM</sup> Real-time PCR System  || Applied Biosystems<sup>TM</sup>
+|- style="background-color:#9BDDFF;"
+|}
+[[Team:Heidelberg/Notebook_MaM#Material|[Back]]]
+== Lab material ==
+The following is a list of the used Lab material.
+{| class="wikitable centered"  style="margin: 1em auto 1em auto"
+ |- style="background-color:#99cccc;"
+! height=20px, width=300px |Material|| width=300px | Name || width=300px | Manufactor
+|-style="height:20px"
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Bottle 50 ml, 100 ml, 200 ml, 500 ml, 1000 ml  || Schott Duran  || Schott
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Beaker 50 ml, 100 ml, 200 ml, 500 ml 1000 ml || - || Simax
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Conical flask 500 ml, 1000 ml, 100 ml || FB33141, FB33142, FB33139 || Fischerbrand
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Conical flask 300 ml || - || Simax
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Single channel pipet || Pipetman'''®''' P2, P20, P200, P1000 || Gilson
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Multichannel pipet || Research'''®''' Multikanal || Eppendorf
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Multistep pipet || e10, e120, e1000, e5000 || Biohit
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Pipet || accu-jet'''®''' pro || Brand
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | PCR-tubes || PCR softtubes || Biozym
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Microcentrifuge tubes || safe-lock-tubes 2 ml/1,5 ml || Eppendorf
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Centrifugetubes || BD Falcon<sup>TM</sup> 15 ml /50 ml || BD Biosciences
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | PCR 8-strips || Tube Strips, CLR || Biorad
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Serological Pipet || 5 ml, 10 ml, 25 ml || BD Labware
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Gloves || Latex Medical Examination Gloves (S,M,L) || Blossom
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Nitrile Gloves || Freeform<sup>TM</sup> SE Examination Gloves (S,M,L) || MICROFLEX'''®'''
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Filtertips ||  Extended length Filtertips|| Starlab
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Pipettips  || TipOne'''®''' || Starlab
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Counting Chamber || Neubauer || Brand
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Inoculating loop || - || nunc<sup>TM</sup>
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Disposal bags || - || Plastibrand'''®'''
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Flasks || Tissue Culture Flasks || TPP'''®'''
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | Plate || Microplates for life science Research || PerkinElmer<sup>TM</sup>
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | IBD || Lab-Tek'''®''' || nunc<sup>TM</sup>
+|- style="background-color:#9BDDFF;"
+| style="font-weight:bold;" | 6/16-Well plates || Nunclon<sup>TM</sup> Surface || nunc<sup>TM</sup>
+|}
+[[Team:Heidelberg/Notebook_MaM#Material|[Back]]]
 = Methods =
@@ Line 370: / Line 596: @@
 === Transformation of Bacteria ===
-For enrichment of vectors, E .coli DH5α were used. For the transformation 100 µl of the competent cells were thawed on ice and 50 – 400 ng DNA solution added (depending on the concentration of the DNA solution). After a 30-60 minute incubation on ice, cells were made permeable for the DNA by heat shocking for 45 seconds at 42 °C and a further 3 minute incubation on ice. The samples were than rescued by adding 500µl preheated antibiotic free LB-medium and incubated for one hour at 37 °C while shaking for induction of the antibiotic resistance. The selection for plasmid containing and therefore antibiotic resistant bacteria was conducted by plating them on antibiotic containing LB-agar plates.
+For enrichment of vectors, ''E. coli'' DH5α were used. For the transformation 100 µl of the competent cells were thawed on ice and 50 – 400 ng DNA solution added (depending on the concentration of the DNA solution). After a 30-60 minute incubation on ice, cells were made permeable for the DNA by heat shocking for 45 seconds at 42 °C and a further 3 minute incubation on ice. The samples were than rescued by adding 500 µl preheated antibiotic free LB-medium and incubated for one hour at 37 °C while shaking for induction of the antibiotic resistance. The selection for plasmid containing and therefore antibiotic resistant bacteria was conducted by plating them on antibiotic containing LB-agar plates.
 === Glycerol stock ===
@@ Line 381: / Line 607: @@
 === Preparing chemically competent cells ===
-First, a 20 ml over night culture was inoculated in antibiotic free LB medium from a fresh single colony and transferred into 400 ml antibiotic free LB medium the next day. This culture was incubated at 37 °C while shacking until an OD600 of 0.5 – 0.6 was achieved. The culture was than cooled down on ice, centrifuged (8 min, 4 °C, 3500 rpm), the supernatant discarded and the pellet resuspended in 10 ml 100 mM CaCl2. After addition of further 190 ml 100 mM CaCl2 the suspension was incubated on ice for 30 min. The suspension was than again centrifuged (8 min, 4 °C, 3500 rpm), the supernatant discarded, the pellet resuspended in 20 ml 82.5 mM CaCl2 with 17.5 % glycerol and aliquoted. The aliquots were flash frozen in liquid nitrogen and than stored at -80 °C until usage.
+First, a 20 ml over night culture was inoculated in antibiotic free LB medium from a fresh single colony and transferred into 400 ml antibiotic free LB medium the next day. This culture was incubated at 37 °C while shacking until an OD600 of 0.5 – 0.6 was achieved. The culture was than cooled down on ice, centrifuged (8 min, 4 °C, 3500 rpm), the supernatant discarded and the pellet resuspended in 10 ml 100 mM CaCl<sub>2</sub>. After addition of further 190 ml 100 mM CaCl<sub>2</sub> the suspension was incubated on ice for 30 min. The suspension was than again centrifuged (8 min, 4 °C, 3500 rpm), the supernatant discarded, the pellet resuspended in 20 ml 82.5 mM CaCl<sub>2</sub> with 17.5 % glycerol and aliquoted. The aliquots were flash frozen in liquid nitrogen and than stored at -80 °C until usage.
 === Ligation ===
 '''Standard Ligation Protocol'''
-T4 ligase joins the 5' phosphate and the 3'-hydroxyl groups of DOUBLE stranded DNA molecules. First step for ligation is to estimate the vector and insert concentrations:if insert is from PCR, assume that 50% is recovered, typically 5 mg, and resuspended in 10 ml of H20; same with vector, assume half is recovered in purification/precipitation and resuspend in 10-20 ml of H2O if it is not re-suspended already. Second step is to plan control reactions: One reaction with no insert, one reaction with no vector (if enough insert is available). Then Molar Ratio of Insert to Vector is determined where a ratio of Insert:Vector 3:1 (100-150ng Vector DNA) is tried to be achieved. After this,  ligation mixure is setup in the following way:
+T4 ligase joins the 5' phosphate and the 3'-hydroxyl groups of DOUBLE stranded DNA molecules. First step for ligation is to estimate the vector and insert concentrations:if insert is from PCR, assume that 50% is recovered, typically 5 mg, and resuspended in 10 ml of H<sub>2</sub>0; same with vector, assume half is recovered in purification/precipitation and resuspend in 10-20 ml of H<sub>2</sub>0 if it is not re-suspended already. Second step is to plan control reactions: One reaction with no insert, one reaction with no vector (if enough insert is available). Then Molar Ratio of Insert to Vector is determined where a ratio of Insert:Vector 3:1 (100-150ng Vector DNA) is tried to be achieved. After this,  ligation mixure is setup in the following way:
 * 10X Ligase buffer (Promega #M1801)
 * 1 ml T4 Ligase (Promega #M1801, 3 U/ml)
@@ Line 392: / Line 618: @@
 * If  doing a blunt-end ligation, it may be needed to add PEG (up to 15%) to increase the efficiency.
 Samples are incubated according to the guidelines below
-* Incubate sticky end ligation reactions at room temperature for 3 hours (or at 4 to 8 deg C, overnight).
+* Incubate sticky end ligation reactions at room temperature for 3 hours (or at 4 to 8 °C, overnight).
-* Incubate blunt-end ligation reactions at 17 deg C for 4 to 18 hours.
+* Incubate blunt-end ligation reactions at 17 °C for 4 to 18 hours.
-After incubation  the ligase is heat inactivated by placing tube in 65C water bath for 10 minutes. 2 ml of theLigation mixture is used for transformation.
+After incubation  the ligase is heat inactivated by placing tube in 65 °C water bath for 10 minutes. 2 ml of the ligation mixture is used for transformation.
-transformed cells are plated on selective media and incubated overnight.
+Transformed cells are plated on selective media and incubated overnight.
 === Site-directed mutagenesis ===
-For removal of unwanted Restriction Sites, a PCR-based site direct mutagenesis protocol was adapted from [http://www.stratagene.com/manuals/200518.pdf Stratgene]. Oligos were designed to have a high (>78°C) Tm ny applying the formula
+For removal of unwanted Restriction Sites, a PCR-based site direct mutagenesis protocol was adapted from [http://www.stratagene.com/manuals/200518.pdf Stratgene]. Oligos were designed to have a high (>78°C) T<sub>m</sub> by applying the formula
-<math>T_{m} = 81{,}5 + 0{,}41 * (%GC) - \frac{675}N - %mismatch</math>.
+[[Image:HD09_eqdna.png]]
 The following scheme was used for pipetting:
-{| class="wikitable"
+{| class="wikitable centered"  style="margin: 1em auto 1em auto"
-|- bgcolor=grey
+ |- style="background-color:#99cccc;"
 ! height=20px, width=900px |
-|-align="center"
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" | 1 µl   template (10 ng)
-|-align="center"
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" | 1 µl   primer 1 (25µM)
-|-align="center"
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" | 1 µl   primer 2 (25µM)
-|-align="center"
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" | 25 µl Mastermix 2x (Phusion)
-|-align="center"
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" | 22 µl   dH2O
 |-
@@ Line 419: / Line 645: @@
 The PCR procedure was as follows:
-{| class="wikitable"
+* Initial denaturation, 1 cycle
-|- bgcolor=grey
+** 95 °C, 30 sec
-! height=20px, width=300px | || width=300px| || width=300px|
+* Amplification, 16 cycles
-|-align="center"
+** denaturation 95 °C, 50 sec
-| style="font-weight:bold;" |Initiale denaturation || 95 °C, 30 sec || 1 cycle
+**annealing, 60 °C, 50 sec
-|-style="height:20px"
+**extension, 72 °C, 40sec/kb + 30sec
-|
+* Final Extension,1 cycle
-|-align="center"
+** 72 °C, 5 – 10 min
-| style="font-weight:bold;" |denaturation || 95 °C, 50 sec
+* 4 °C hold, forever
-|-align="center"
-| style="font-weight:bold;" |annealing || 60 °C, 50 sec
-|-align="center"
-| style="font-weight:bold;" |extension || 72 °C, 40sec/kb + 30sec || 16 cycles
-|-align="center"
-|
-|-align="center"
-| style="font-weight:bold;" |termination || 72 °C, 5 – 10 min || 1 cycle
-|-align="center"
-| style="font-weight:bold;" | || 4 °C || forever
-|-style="height:20px"
-|
-|-
-|}
-After completion, 1µL of DpnI (NEB) was added and the mix was incubated for 1h at 37°C. Then, DH5alpha cells were transformed as described above.
+After completion, 1 µL of DpnI (NEB) was added and the mix was incubated for 1h at 37°C. Then, DH5alpha cells were transformed as described above.
 === DNA synthesis ===
-Oligos were designed using [http://baderlab.bme.jhu.edu/gd/ GeneDesign]. 15Bp were chosen as an overhang and 56 °C as an annealing temperature. Oligos were ordered at a concentration of 100µM. 1:10 dilutions of the first and last oligo were prepared. Then, all oligos (including first and last) were pooled at 1µL each. Water was added to 10x the original volume. (So if a gene is synthesized from x = 14 oligos, water was added to 10*x = 140µL). This pool was then diluted 1:10. x µL of the dilution were put into a PCR reaction with 25µL Phusion master mix and 25-x µL water. PCR was conducted as following:
+Oligos were designed using [http://baderlab.bme.jhu.edu/gd/ GeneDesign]. 15Bp were chosen as an overhang and 56 °C as an annealing temperature. Oligos were ordered at a concentration of 100 µM. 1:10 dilutions of the first and last oligo were prepared. Then, all oligos (including first and last) were pooled at 1 µl each. Water was added to 10x the original volume. (So if a gene is synthesized from x = 14 oligos, water was added to 10*x = 140 µl). This pool was then diluted 1:10. x µl of the dilution were put into a PCR reaction with 25 µl Phusion master mix and 25-x µl water. PCR was conducted as following:
+* Initial denaturation, 1 cycle
+** 95 °C, 5 min
+* Amplification, 7 cycles
+** denaturation 95 °C, 30 sec
+**annealing, 58 °C, 30 sec
+**extension, 72 °C, 1 minute
+* 4 °C hold, forever
-{| class="wikitable"
+Afterwards, 1 µl of the 1:10 dilutions of the innermost and outermost primer were added. The same PCR protocol was then repeated, but with 25 instead of 7 cycles. PCR products were run on a 2% agarose gel and gel purified.
-|- bgcolor=grey
-! height=20px, width=300px | || width=300px| || width=300px|
-|-align="center"
-| style="font-weight:bold;" |Initiale denaturation || 95 °C, 5 min || 1 cycle
-|-style="height:20px"
-|
-|-align="center"
-| style="font-weight:bold;" |denaturation || 95 °C, 30 sec
-|-align="center"
-| style="font-weight:bold;" |annealing || 58 °C, 30 sec
-|-align="center"
-| style="font-weight:bold;" |extension || 72 °C, 1 minute || 7 cycles
-|-align="center"
-|
-|-align="center"
-| style="font-weight:bold;" | || 4 °C || forever
-|-style="height:20px"
-|
-|-
-|}
-Afterwards, 1µL of the 1:10 dilutions of the innermost and outermost primer were added. The same PCR protocol was then repeated, but with 25 instead of 7 cycles. PCR products were run on a 2% agarose gel and gel purified.
 ===Purification of DNA from PCR reactions===
@@ Line 478: / Line 675: @@
 ===Enzymatic hydrolysis of DNA by restriction enzymes===
-'''restriction digest'''
+'''Restriction digest'''
-Restriction digest of DNA was used for analysis of purified DNA form mini or maxiprep or for isolation of specific DNA fragments for further cloning. Analytical digestions were routinely conducted in 20 µl volume,preparative digestions were routinely conducted in 50 µl volume. In all digestions a minimum of 2 Units restriction enzyme(s) was used per microgram DNA. Optimised buffer conditions were secured by using NEB buffer system. The final reaction volume was achieved by adding H<sub>2</sub>O dest. The sample was incubated at optimal temperature for the restriction enzyme(s) (usually 37 °C). Analysis and preparation of DNA were either done by gelelectrophoreses (loading dye was added to the samples and they were loaded on a agarose gel) or alternatively PCR Purification (PCR Purification QIAquick  Kit from Qiagen)
+Restriction digest of DNA was used for analysis of purified DNA form mini or maxiprep or for isolation of specific DNA fragments for further cloning. Analytical digestions were routinely conducted in 20 µl volume,preparative digestions were routinely conducted in 50 µl volume. In all digestions a minimum of 2 Units restriction enzyme(s) was used per microgram DNA. Optimised buffer conditions were secured by using NEB buffer system. The final reaction volume was achieved by adding H<sub>2</sub>O<sub>dest</sub>. The sample was incubated at optimal temperature for the restriction enzyme(s) (usually 37 °C). Analysis and preparation of DNA were either done by gelelectrophoreses (loading dye was added to the samples and they were loaded on a agarose gel) or alternatively PCR Purification (PCR Purification QIAquick  Kit from Qiagen)
 '''Phosphatasing with Shrimp Alkaline Phosphatase'''
@@ Line 497: / Line 694: @@
 Plasmid DNA and DNA fragments were extracted using the Gel Extraction Kit from Qiagen following the manufacture instructions. To check the purity and amount of extracted DNA an aliquot was analysed using a NanoDrop.
+[[Team:Heidelberg/Notebook_MaM#Methods|[Back]]]
 ==Cell Culture==
 === Splitting cells===
-Cultures of HeLa, MCF7 and U2OS cells are splitted 1:10 every 3-4 days or 1:3 every day: DMEM+++ (see Material) covering the cells is removed and the cells are washed with 3 ml PBS. The PBS is removed after the washing step and 3 ml of trypsin are added to the flask; almost all of the Trypsin is removed again until the cells are only slightly covered with Trypsin. The trypsinized cells are then incubated for 5 min at 37°C and 5% CO<sub>2</sub>. After this incubation time,  the cells are detached from the bottom and the flask is filled with 5 ml of DMEM+++. Cells are resuspended in medium  by pipetting up and down. To achieve a diluton of 1:10, 0,5 ml of the suspension is transferred to another flask and 5 ml of DMEM+++ are added. This dilution is then incubated for 3-4 days at 37°C and 5% CO<sub>2</sub>. The rest of the cell suspension (about 4 ml) is transferred to a 50 ml falcon tube and the same volume of DMEM+++ is added to the falcon. 9,6 µl of this dilution are transferred to a counting chamber and the number of cells is determined (x*10^4).
+Cultures of HeLa, MCF7 and U2OS cells are splitted 1:10 every 3-4 days or 1:3 every day: DMEM+++ (see Material) covering the cells is removed and the cells are washed with 3 ml PBS. The PBS is removed after the washing step and 3 ml of trypsin are added to the flask; almost all of the Trypsin is removed again until the cells are only slightly covered with Trypsin. The trypsinized cells are then incubated for 5 min at 37 °C and 5% CO<sub>2</sub>. After this incubation time,  the cells are detached from the bottom and the flask is filled with 5 ml of DMEM+++. Cells are resuspended in medium  by pipetting up and down. To achieve a diluton of 1:10, 0,5 ml of the suspension is transferred to another flask and 5 ml of DMEM+++ are added. This dilution is then incubated for 3-4 days at 37°C and 5% CO<sub>2</sub>. The rest of the cell suspension (about 4 ml) is transferred to a 50 ml falcon tube and the same volume of DMEM+++ is added to the falcon. 9,6 µl of this dilution are transferred to a counting chamber and the number of cells is determined (x*10<sup>4</sup>).
-* Note 1: HeLa and U2OS seem to grow faster than MCF7; check notebook for information on splitting ratios
+* Note 1: HeLa and U2-OS seem to grow faster than MCF-7; check notebook for information on splitting ratios
 === Transfection of Mammalian cells ===
-'''1.Fugene (Roche)''' 10^5 cells were moved to 6-well plates. 2,5 mL of DMEM medium plus addiditives were added.The following day, 97 µL pure DMEM was incubated for 5 minutes with 3µL Fugene6 reagent at roomt temperature. Afterwards, the mixture was added dropwise to 500ng of plasmid and allowed to incubate for 15 minutes at RT. The mixture was then added dropwise to the cells.Cells were incubated for 24 hours without selection pressure, afterwards, medium was changed and Zeomycine was added to a concentration of 350ng/mL
+'''1.Fugene (Roche)''' 10<sup>5</sup> cells were moved to 6-well plates. 2,5 ml of DMEM medium plus addiditives were added. The following day, 97 µl pure DMEM was incubated for 5 minutes with 3 µl Fugene6 reagent at room temperature. Afterwards, the mixture was added dropwise to 500 ng of plasmid and allowed to incubate for 15 minutes at RT. The mixture was then added dropwise to the cells. Cells were incubated for 24 hours without selection pressure, afterwards, medium was changed and Zeocin was added to a concentration of 350 ng/ml.
-'''2. Effectene Transfection (Qiagen)''' Move x (for apropriate amounts see table below) cells to 6-well plates/ LabTek 8 chamber and add 2 ml/0,5 ml DMEM+++. Incubate over night at 37°C and 5% CO<sub>2</sub>.The following day, dilute x µg of DNA in Buffer EC to a total volume of x µl (note: Yara just adds 100 µl/50 µl). Add x µl of Enhancer and mix by tapping the tube (or vortex for 1 sec). Incubate for 2-5 min at RT. Add x µl of Effectene Transfection reagent to the DNA-Enhancer Mixture. Mix by tapping the tube (or vortexing for 10 s or pipetting up and down 5 times). Incubate samples for 5- 10 min at RT to allow for transfection-complex formation. While complex formation takes place, aspire medium and add x ml of fresh growth medium. After incubation time add the transfection
+'''2. Effectene Transfection (Qiagen)''' Move x (for apropriate amounts see table below) cells to 6-well plates/ LabTek 8 chamber and add 2 ml/0,5 ml DMEM+++. Incubate over night at 37 °C and 5 % CO<sub>2</sub>.The following day, dilute x µg of DNA in Buffer EC to a total volume of x µl (note: Yara just adds 100 µl/50 µl). Add x µl of Enhancer and mix by tapping the tube (or vortex for 1 sec). Incubate for 2-5 min at RT. Add x µl of Effectene Transfection reagent to the DNA-Enhancer Mixture. Mix by tapping the tube (or vortexing for 10 s or pipetting up and down 5 times). Incubate samples for 5- 10 min at RT to allow for transfection-complex formation. While complex formation takes place, aspire medium and add x ml of fresh growth medium. After incubation time add the transfection
 -complexes drop-wise to the cells on the well. Gently swirl the plate to ensure uniform distribution of the complexes.
 * transient transfection: remove Effectene-DNA complexes after 6-18 hours, wash cells 1x with sterile PBS, add fresh medium. Incubate cells with the complexes under normal growth conditions for an appropriate time for expression.
-* stable transfection: change medium after 24 hours (wash with PBS); check confluency after 48 hours - (if required) split to 25% confluency, add fresh medium and incubate 2-3 hours until cells have attached to culture dish. Then, remove medium and add fresh DMEM+++/Zeocin.
+* stable transfection: change medium after 24 hours (wash with PBS); check confluency after 48 hours - (if required) split to 25 % confluency, add fresh medium and incubate 2-3 hours until cells have attached to culture dish. Then, remove medium and add fresh DMEM+++/Zeocin.
-{| class="wikitable" border="1"
+{| class="wikitable centered"  style="margin: 1em auto 1em auto"
-|-
+|- style="background-color:#99cccc;"
 !  Culture format
 !  Number of cells
@@ Line 521: / Line 720: @@
 !  Effectene reagent [µl]
 !  Volume of Medium to add to cells [µl]
-|-
+|- style="background-color:#9BDDFF;"
 |  96-well
-|  10^4
+|  10<sup>4</sup>
 |  0,1
 |  0,8
@@ Line 529: / Line 728: @@
 |  2,5
 |  100
-|-
+|- style="background-color:#9BDDFF;"
 |  Ibidi
-|  1,5*10^4
+|  1,5*10<sup>4</sup>
 |  0,15
 |  1,2
@@ Line 537: / Line 736: @@
 |  4
 |  200-250
-|-
+|- style="background-color:#9BDDFF;"
 |  24-well
-|  4*10^4
+|  4*10<sup>4</sup>
 |  0,2
 |  1,6
@@ Line 545: / Line 744: @@
 |  5,0
 |  700
-|-
+|- style="background-color:#9BDDFF;"
 |  6-well
-|  10^5
+|  10<sup>5</sup>
 |  0,4
 |  3,2
@@ Line 558: / Line 757: @@
 === Freeze cells ===
-Cells to be frozen should be confluent, but not too dense. Medium covering the cells is removed  and cells are washed once with PBS. Afterwards cells are rinsed with  3 ml Trypsin; Trypsin is removed until the cells are only slightly  covered (about 1 ml) and cells are incubated for about 5 min. After incubation, cells are resuspended in medium (at least about 4-5 times as much as Trypsin to inactivate that;  used 5 ml). The suspension is transferred to 15 ml falcon and centrifuged at 2000 rpm for 3-5 minutes. The supernatant is discarded and the remaining pellet is resuspended in DMEM+++ (here: 7,5 ml for 5 aliquots, 1,5 ml each). 1,5 ml of the suspension is distributed into freezer vials. After adding of 150 µl DMSO to each vial, cells are put on ice and stored at -80°C.
+Cells to be frozen should be confluent, but not too dense. Medium covering the cells is removed  and cells are washed once with PBS. Afterwards cells are rinsed with  3 ml Trypsin; Trypsin is removed until the cells are only slightly  covered (about 1 ml) and cells are incubated for about 5 min. After incubation, cells are resuspended in medium (at least about 4-5 times as much as Trypsin to inactivate that;  used 5 ml). The suspension is transferred to 15 ml falcon and centrifuged at 2000 rpm for 3-5 minutes. The supernatant is discarded and the remaining pellet is resuspended in DMEM+++ (here: 7,5 ml for 5 aliquots, 1,5 ml each). 1,5 ml of the suspension is distributed into freezer vials. After adding of 150 µl DMSO to each vial, cells are put on ice and stored at -80 °C.
 === Picking cells with cloning disks ===
-Foci of cells, which were under selection pressure (zeocin) are marked on the bottom of the petri dish (use pen from underneath the microscope). As many cloning disks as foci available are prpared by incubating them 3-5 minutes in trypsin (in a petri dish). Medium covering the cells is removed and cells are washed with PBS. PBS is removed till the cells are only slightly covered with it. The cloning disks are placed on the previousely marked spots and incubated for 3 minutes at 37 °C. During incubation a 96-well plate is prepared with 0,7 ml DMEM+++/Zeocin (1:1000)per well. The clonig disks are picked up with pressure (or swipe a little) to remove the entire foci off the plate and  the cloning disk is transferred to the 96-well plate (one disk per well). Medium is pipetted up and down to loosen the cells from the cloning disks.
+Foci of cells, which were under selection pressure (zeocin) are marked on the bottom of the petri dish (use pen from underneath the microscope). As many cloning disks as foci available are prepared by incubating them 3-5 minutes in trypsin (in a petri dish). Medium covering the cells is removed and cells are washed with PBS. PBS is removed till the cells are only slightly covered with it. The cloning disks are placed on the previousely marked spots and incubated for 3 minutes at 37 °C. During incubation a 96-well plate is prepared with 0,7 ml DMEM+++/Zeocin per well. The clonig disks are picked up with pressure (or swipe a little) to remove the entire foci off the plate and  the cloning disk is transferred to the 96-well plate (one disk per well). Medium is pipetted up and down to loosen the cells from the cloning disks.
 === Fix cells for microscopy ===
-The medium is removed from the cells on cover slips. 500 µl of 4% Paraformaldehyde (in PBS)is added to the cells and incubated for 10 minutes. PFA is taken off and cells are washed with 500 µl of PBS. Slides are labeled and  a small drop of fluoromount is added with a pipet tip. Cover slips are washed in dH2O, by picking them up with tweezers and dipping them into the water. Afterwards cover slips are dried with filter paper without the paper touching the cover slip side containing the cells. Cover slips are layed down on the drop of fluoromount with the cells facing downwards. Fixed cells are dried overnight and can then be used for fluorescence microscopy.
+The medium is removed from the cells on cover slips. 500 µl of 4% Paraformaldehyde (in PBS) is added to the cells and incubated for 10 minutes. PFA is taken off and cells are washed with 500 µl of PBS. Slides are labeled and  a small drop of fluoromount is added with a pipet tip. Cover slips are washed in dH<sub>2</sub>0, by picking them up with tweezers and dipping them into the water. Afterwards cover slips are dried with filter paper without the paper touching the cover slip side containing the cells. Cover slips are layed down on the drop of fluoromount with the cells facing downwards. Fixed cells are dried overnight and can then be used for fluorescence microscopy.
-=== Flow Cytometry (FC)===
-Before preparing samples for flow cytometry  the flow cytometer has to be turned on at least 20 min before the run.
-Samples are then prepared in the following way (this is for a 96 well plate):As much DMEM+++ as possible is removed from the cells. Next 60 µl Trypsin are added and the cells are incubated at 37 C for 10-15 min. Then, 160 µl of 1xPBS + 1% BSA  are added. Samples are now ready for FC. At the FC the correct plate format is chosen. The plate is placed in the machine and the lid is taken off. Measurement parameters such as plateformat, wells, and  the desired protocol are chosen from the list. Volume and Mix iterations are are also chosen and saved as... .The discriminator is set to increase the threshold(2-10). The measurement is started with forward vs. side scatter in order to find cells. When cells are found, a gate (line) is added around the cells or cell candidates. Selected cells are then measured.
 === Induction ===
@@ Line 578: / Line 772: @@
 {|cellpadding="5" class="wikitable"
-|- bgcolor=grey
+ |- style="background-color:#99cccc;"
 ! height=20px, width=70px | Pathway || width=70px | mode || width=80px | cell type || width=80px | drug || width = 80px | stock concentration || width=100px | dilution || width=80px | final concentration || width=80px | medium || width=80px | time to leave on cells || width=180px | remarks ||
-|-style="height:20px"
+|- style="background-color:#9BDDFF;"
-||
+| style="font-weight:bold;" | HIF [[Team:Heidelberg/Notebook_MaM#References|[1]]] || activator || MCF-7 || [http://www.sigmaaldrich.com/catalog/ProductDetail.do?D7=0&N5=Product%20No.%7CBRAND_KEY&N4=D9533%7CSIGMA&N25=0&QS=ON&F=SPEC DFO] || 50 mM || 1:500 || 100 &mu;M || minimal medium || 24 h || together with HIF-bag ||
-|-align="center"
+|- style="background-color:#9BDDFF;"
-| style="font-weight:bold;" |HIF<sup>*1)</sup> || activator || MCF-7 || [http://www.sigmaaldrich.com/catalog/ProductDetail.do?D7=0&N5=Product%20No.%7CBRAND_KEY&N4=D9533%7CSIGMA&N25=0&QS=ON&F=SPEC DFO] || 50 mM || 1:500 || 100 &mu;M || minimal medium || 24 h || together with HIF-bag ||
-|-align="center"
 | style="font-weight:bold;" | || inhibitor || MCF-7 || [https://www.sigmaaldrich.com/catalog/ProductDetail.do?D7=0&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&N4=07741%7CFLUKA&N25=0&QS=ON&F=SPEC Everolimus] ||  || 1:500 000 ||  || minimal medium || 24 h || without HIF-bag ||
-|-align="center"
+|- style="background-color:#9BDDFF;"
-| style="font-weight:bold;" | SREBP<sup>*2)</sup> || activator || HeLa || Lipid-depleted-Serum (LDS) ||  || 1:200 ||  || DMEM++ || 2-3 days || put on cells after transfection and put back on after 3 h with HPCD ||
+| style="font-weight:bold;" | SREBP [[Team:Heidelberg/Notebook_MaM#References|[2]]], [[Team:Heidelberg/Notebook_MaM#References|[8]]] [[Team:Heidelberg/Notebook_MaM#References|[9]]] || activator || HeLa || Lipid-depleted-Serum (LDS) || - || 0,5% || - || DMEM++ || 2-3 days || put on cells after transfection and put back on after 3 h with HPCD ||
-|-align="center"
+|- style="background-color:#9BDDFF;"
-| style="font-weight:bold;" |  || activator || HeLa || [http://www.sigmaaldrich.com/catalog/ProductDetail.do?D7=0&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&N4=H107%7CSIGMA&N25=0&QS=ON&F=SPEC HPCD] ||  || 1:100 ||  || DMEM++ with LDS|| 3 h || add after cells were 2-3 days in DMEM++ +LDS ||
+| style="font-weight:bold;" |  || activator || HeLa || [http://www.sigmaaldrich.com/catalog/ProductDetail.do?D7=0&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&N4=H107%7CSIGMA&N25=0&QS=ON&F=SPEC HPCD] || 500 mg/ml || 1:100 || 500 &mu;g/ml || DMEM++ with LDS|| 3 h || add after cells were 2-3 days in DMEM++ +LDS ||
-|-align="center"
+|- style="background-color:#9BDDFF;"
-| style="font-weight:bold;" |  || inhibitor || HeLa || [http://www.sigmaaldrich.com/catalog/ProductDetail.do?D7=0&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&N4=C8667%7CSIGMA&N25=0&QS=ON&F=SPEC Cholesterol] ||  ||  ||  || DMEM+++ || 2-3 days || ||
+| style="font-weight:bold;" |  || inhibitor || HeLa || [http://www.sigmaaldrich.com/catalog/ProductDetail.do?D7=0&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&N4=C8667%7CSIGMA&N25=0&QS=ON&F=SPEC Cholesterol] || 10 mg/ml || 1:1000 || 10 &mu;g/ml || DMEM+++ || 2-3 days || ||
-|-align="center"
+|- style="background-color:#9BDDFF;"
-| style="font-weight:bold;" |  || inhibitor || HeLa || [http://www.sigmaaldrich.com/catalog/ProductDetail.do?D7=0&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&N4=L7914%7CSIGMA&N25=0&QS=ON&F=SPEC LDL] ||  ||  ||  || DMEM+++ || 2-3 days || ||
+| style="font-weight:bold;" |  || inhibitor || HeLa || [http://www.sigmaaldrich.com/catalog/ProductDetail.do?D7=0&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&N4=L7914%7CSIGMA&N25=0&QS=ON&F=SPEC LDL] || 0,5 mg/ml || 1:50 || 10 &mu;g/ml || DMEM+++ || 2-3 days || got LDL from Jessica Schilde -> self-made in Runz' lab ||
-|-align="center"
+|- style="background-color:#9BDDFF;"
-| style="font-weight:bold;" | NF&kappa;B || activator || U2-OS || [http://www.sigmaaldrich.com/catalog/ProductDetail.do?N4=T0157%7CSIGMA&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&F=SPEC&lang=null%3E TNF&alpha;] || 2,5 mM || 1:1000 || 2,5 &mu;M || DMEM++ || 10 h || ||
+| style="font-weight:bold;" | NF&kappa;B[[Team:Heidelberg/Notebook_MaM#References|[1]]] [[Team:Heidelberg/Notebook_MaM#References|[10]]] || activator || U2-OS || [http://www.sigmaaldrich.com/catalog/ProductDetail.do?N4=T0157%7CSIGMA&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&F=SPEC&lang=null%3E TNF&alpha;] || 2,5 mM || 1:1000 || 2,5 &mu;M || DMEM++ || 10 h || ||
-|-align="center"
+|- style="background-color:#9BDDFF;"
-| style="font-weight:bold;" | p53 || activator || MCF-7 || [http://www.sigmaaldrich.com/catalog/ProductDetail.do?D7=0&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&N4=C9911%7CSIGMA&N25=0&QS=ON&F=SPEC Camptothecin] || 2 mM || 1:1000 || 2 &mu;M || minimal medium || 12 h ||  ||
+| style="font-weight:bold;" | p53 [[Team:Heidelberg/Notebook_MaM#References|[1]]],[[Team:Heidelberg/Notebook_MaM#References|[5]]]  || activator || MCF-7 || [http://www.sigmaaldrich.com/catalog/ProductDetail.do?D7=0&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&N4=C9911%7CSIGMA&N25=0&QS=ON&F=SPEC Camptothecin] || 2 mM || 1:1000 || 2 &mu;M || minimal medium || 12 h ||  ||
-|-align="center"
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" |  || inhibitor || MCF-7 || [http://www.sigmaaldrich.com/catalog/ProductDetail.do?D7=0&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&N4=P4359%7CSIGMA&N25=0&QS=ON&F=SPEC Pifithrin-&alpha;] || 2 mM || 1:1000 || 2 &mu;M || minimal medium || 12 h ||  ||
-|-align="center"
+|- style="background-color:#9BDDFF;"
-| style="font-weight:bold;" | AHR || activator || HeLa || [http://www.sigmaaldrich.com/catalog/ProductDetail.do?N4=B1760%7CSIGMA&N5=Product%20No.%7CBRAND_KEY&F=SPEC Benzo-a-pyrene] ||  || 1:10 000 ||  || DMEM+++ || 18 h || ||
+| style="font-weight:bold;" | AHR [[Team:Heidelberg/Notebook_MaM#References|[6]]]  || activator || HeLa || [http://www.sigmaaldrich.com/catalog/ProductDetail.do?N4=B1760%7CSIGMA&N5=Product%20No.%7CBRAND_KEY&F=SPEC Benzo-a-pyrene] || 100 mM || 1:10 000 || 10 &mu;M || DMEM+++ || 18 h || ||
-|-align="center"
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" |  || activator || MCF-7 || [http://www.sigmaaldrich.com/catalog/ProductDetail.do?lang=en&N4=48599%7CSUPELCO&N5=SEARCH_CONCAT_PNO%6CBRAND_KEY&F=SPEC TCDD] ||  || 1:3000 ||  || DMEM++ || 48 h || ||
-|-align="center"
+|- style="background-color:#9BDDFF;"
-| style="font-weight:bold;" | PPAR&gamma; [[Notebook/methods#References|[1]]],[[Notebook/methods#References|[2]]]|| activator || U2-OS || [http://www.sigmaaldrich.com/catalog/ProductDetail.do?N4=88405X%7CFLUKA&N5=Product%20No.%7CBRAND_KEY&F=SPEC 2,4-Thiazolidinedione] || 500 mM || 1:100 000 || 5 &mu;M || DMEM+++ || 60 h || ||
+| style="font-weight:bold;" | PPAR&gamma; [[Team:Heidelberg/Notebook_MaM#References|[3]]],[[Team:Heidelberg/Notebook_MaM#References|[4]]]|| activator || U2-OS || [http://www.sigmaaldrich.com/catalog/ProductDetail.do?N4=88405X%7CFLUKA&N5=Product%20No.%7CBRAND_KEY&F=SPEC 2,4-Thiazolidinedione] || 500 mM || 1:100 000 || 5 &mu;M || DMEM+++ || 60 h || ||
-|-align="center"
+|- style="background-color:#9BDDFF;"
 | style="font-weight:bold;" | Estrogen receptor || activator || MCF-7 || [http://www.sigmaaldrich.com/catalog/ProductDetail.do?N4=E8875%7CSIGMA&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&F=SPEC &beta;-Estradiol] || 100 mM || 1:10 000 000 || 10 &mu;M || DMEM++ || 24 h || keep cells with DMEM++ for 24 h after transfections, then add drug ||
-|-align="center"
+|- style="background-color:#9BDDFF;"
-| style="font-weight:bold;" | VDR || activator ||  || [http://www.sigmaaldrich.com/catalog/ProductDetail.do?D7=0&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&N4=D1530%7CSIGMA&N25=0&QS=ON&F=SPEC Vitamine D3] ||  ||  ||  ||  ||  ||  ||
+| style="font-weight:bold;" | VDR [[Team:Heidelberg/Notebook_MaM#References|[7]]]  || activator || MCF-7 || [http://www.sigmaaldrich.com/catalog/ProductDetail.do?D7=0&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&N4=D1530%7CSIGMA&N25=0&QS=ON&F=SPEC Vitamine D3] || 100 &mu;M || 1:1000/ 1:10000 || 100 nM/ 1 nM || DMEM+++ || 24 h, 48 h, 72 h, 96 h || TECAN read every 24 hours -> see induction: FACS ||
-|-align="center"
+|- style="background-color:#9BDDFF;"
-| style="font-weight:bold;" | c-Jun || activator || HeLa || [https://www.sigmaaldrich.com/catalog/ProductDetail.do?N4=E4269%7CSIGMA&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&F=SPEC EGF] ||  || 1:2000 ||  ||  ||  ||  ||
+| style="font-weight:bold;" | c-Jun [[Team:Heidelberg/Notebook_MaM#References|[1]]] || activator || HeLa || [https://www.sigmaaldrich.com/catalog/ProductDetail.do?N4=E4269%7CSIGMA&N5=SEARCH_CONCAT_PNO%7CBRAND_KEY&F=SPEC EGF] || 100&mu;g/mL || 1:1000 || 100ng/mL || DMEM+++ || 3h || after 3 h, EGF was removed and FACS measurement was carried out another 4 hours later ||
 |-
 |}
-<sup>*1)</sup> Brady, N.  Bioquant Heidelberg, Eils group; Personal communication.
-<br /><sup>*2)</sup> Schilde, J. Institute for human genetics at the University of Heidelberg; Personal communication.
+[[Team:Heidelberg/Notebook_MaM#Methods|[Back]]]
+== RA-PCR ==
+For a RA-PCR protocol, please refer to [[Team:Heidelberg/Project_Synthetic_promoters#RA-PCR_protocol|Project page]]
+We used the following Oligo concentrations:
+{| class="wikitable centered"  style="margin: 1em auto 1em auto"
+|- style="background-color:#99cccc;
+! p53
+! NF&kappa;B II
+! HIF
+! Activator Mix
+|- style="background-color:#9BDDFF;"
+|width="150px"|6µL  p53 (O.91)<br>
+µL p53 reverse (O.188)<br>
+µL random (O.56)<br>
+µL Activator Mix<br>
+.8µL Stop 5 new (O.187)<br>
+.8µL Stop 3 (O.58)<br>
+|width="150px"|3µL NFkB-1 (O.93)<br>
+µL NF&kappa;B-2 (O.94)<br>
+µL NF&kappa;B-rev (O.194)<br>
+µL Random (O.56)<br>
+µL Activator Mix<br>
+.8µL Stop 5 new (O.187)<br>
+.8µL Stop 3 (O.58)<br>
+|width="150px"|2,5µL  HIF-1 (O.53)<br>
+,5µL HIF-2 (O.54)<br>
+µL CREB(O.89)<br>
+µL HIF-rev (O.189)<br>
+µL Random (O.56)<br>
+µL Stop 5 new (O.187)<br>
+µL Stop 3 (O.58)
+.2µL each Ap1, Sp1 (O.55, O.57)
+|width="150px"|2µL each Ap1, Sp1, CREB (O.55, O.57, O.89)<br>
+µL each NFY, Empty (O.90, O.95)
+Water to 30µL
+|- style="background-color:#99cccc;
+! SREBP
+! AHR
+! pPAR&gamma;
+! Estrogen receptor
+|- style="background-color:#9BDDFF;"
+|width="150px"|5µL  SREBP (O.208)<br>
+µL SREBP reverse (O.209)<br>
+µL Sp1 (O.57)
+µL random (O.56)<br>
+µL Activator Mix<br>
+.8µL Stop 5 new (O.187)<br>
+.8µL Stop 3 (O.58)<br>
+|width="150px"|5µL  AHR (O.212)<br>
+µL AHR reverse (O.213)<br>
+µL random (O.56)<br>
+,5µL Activator Mix<br>
+.8µL Stop 5 new (O.187)<br>
+.8µL Stop 3 (O.58)<br>
+|width="150px"|5µL  pPAR&gamma; (O.210)<br>
+µL pPAR&gamma; reverse (O.211)<br>
+µL random (O.56)<br>
+,5µL Activator Mix<br>
+.8µL Stop 5 new (O.187)<br>
+.8µL Stop 3 (O.58)<br>
+|width="150px"|5µL Estrogen receptor (O.210)<br>
+µL Estrogen receptor reverse (O.211)<br>
+µL random (O.56)<br>
+,5µL Activator Mix<br>
+.8µL Stop 5 new (O.187)<br>
+.8µL Stop 3 (O.58)<br>
+|}
+[[Team:Heidelberg/Notebook_MaM#Methods|[Back]]]
 == Measurement and Screening ==
@@ Line 621: / Line 885: @@
 === Screening by TECAN ===
-Cells were grown in black 96 well plates (PerkinElmer) and induced as [[Notebook/methods#Induction|described]] for the various pathways. Outer wells were left free. After induction, media was removed and replaced by PBS. Fluorescence was then measured using a TECAN infiniteM200 automated plate reader (excitation = 488nm, emission=518nm). In order to account for variations in cell number, cells were stained by Hoechst 33342 dye (SigmaAldrich). PBS was removed and replaced by PBS containing Hoechst 33342 dye at a concentration of 1µg/mL. Cells were allowed to incubate at room temperature for 30 minutes. Afterwards, medium was replaced by PBS again and fluorescence (excitation = 355nm, emission=455nm) was measured again by TECAN. Fluoresences values from the first reading were divided by fluorescence values of the second reading and multiplied by the lowest value of the second reading. Clones showing induction were considered further.
+Cells were grown in black 96 well plates (PerkinElmer) and induced as [[Notebook/methods#Induction|described]] for the various pathways. Outer wells were left free. After induction, media was removed and replaced by PBS. Fluorescence was then measured using a TECAN infiniteM200 automated plate reader (excitation = 488 nm, emission=518 nm). In order to account for variations in cell number, cells were stained by [http://www.sigmaaldrich.com/etc/medialib/docs/Sigma/Product_Information_Sheet/b2261pis.Par.0001.File.tmp/b2261pis.pdf Hoechst 33342 dye] . PBS was removed and replaced by PBS containing Hoechst 33342 dye at a concentration of 1µg/mL. Cells were allowed to incubate at room temperature for 30 minutes. Afterwards, medium was replaced by PBS again and fluorescence (excitation = 355nm, emission=455nm) was measured again by TECAN. Fluoresence values from the first reading were divided by fluorescence values of the second reading and multiplied by the lowest value of the second reading. Clones showing induction were considered further.
+=== Flow Cytometry (FC) ===
+Before preparing samples for flow cytometry the flow cytometer has to be turned on at least 20 min before the run. Samples are then prepared in the following way (this is for a 96 well plate): As much DMEM+++ as possible is removed from the cells. 60 µl Trypsin are added and the cells are incubated at 37 C for 10-15 min. Then, 160 µl of 1xPBS + 1% BSA are added. Samples are now ready for FC. At the FC the correct plate format is chosen. The plate is placed in the machine and the lid is taken off. When starting the flow cytometry measurement we first adjusted the gates and the background signal to the negative control. Measurement parameters such as plateformat, wells, and the desired protocol are chosen from the list. Volume and Mix iterations are are also chosen and saved as... .The discriminator is set to increase the threshold(2-10). The measurement is started with forward vs. side scatter in order to find cells. When cells are found, a gate (line) is added around the cells or cell candidates. Selected cells are then measured.
+Cells were prepared in 96-well format with 10^4 cells/well and transfected with the promoter of interest and if necessary induction drug was added for inducible promoters.
+=== Microscopy/ Image Analysis ===
+Microscopy images of our samples fixed with 4% formaldehyde were taken using the Nikon Eclipse 90i upright automated widefield microscope in the Nikon Imaging Center at the University of Heidelberg. Each image was taken in the GFP and mCherry channel and the exposure time had to be adjusted for over- or underexposed images. The conversion factor was experimentally determined by imaging a fluorescent plate with exposure time varying from 10 to 70 ms (the estimated range of our promoters) and plotting the mean grey values of these images versus time. A linear relationship between the exposure times and grey values was observed for this time frame and the conversion factor was determined to be 0.998. For image analysis we used the ImageJ (Image Processing and Analysis in Java) software measuring the mean grey values of each cell containing the promoter of interest. ImageJ is an open source software developed at the National Institutes of Health (http://rsbweb.nih.gov/ij/). The measurement is performed by setting the boundaries around the cells using the threshold in the mCherry image and generating a mask that is then applied to the image of the GFP channel in the following steps:
+* Open image and select split channels
+* Select mCherry image (all images should be 8-bit)
+* Go to Image> Adjust> Threshold
+* Set lower bar to maximum and adjust upper bar so that the cells are still visible
+* Remove unwanted spots such as dead cell using the drawing tools
+* Apply the threshold (image should appear in all white now with black spots indicating the cells)
+* Go to Process> Math> Divide and divide the image by 255 (image should be all white now)
+* Next go to Process> Image Calculator and multiply the GFP channel with the mCherry channel pictures.
+* Now select the result image and adjust the threshold so that the lower bar is set to the maximum (255) and the upper bar is set to 1 (only GFP containing cells should be visible through the mask)
+* Go to Analyze> Set Measurement and make sure the measurement is limited to the threshold and the result image of the multiplication is selected.
+* Go to Analyze> Measure.
+* Mean grey values should show up in the 'Results' window
+Alternatively the images can be analyzed using the ROI manager where the cell have to be selected by hand using the drawing tools and added to the ROI list. In comparison the threshold method is much quicker and the results are comparable. We preselect the mCherry positive cells which are very likely to contain GFP. The mean grey values of 5-10 images per sample were averaged and adjusted to the same exposure time. The results were given in REU relative to JeT, which was always prepared as a reference sample for each measurement.
+=== Real-time RT-PCR ===
+Cells were collected as a pellet. Cell number must excede 1*10<sup>5</sup>cells/tube and no more than 6*10<sup>6</sup>/tube due to column capacity. In order to obtain reliable results and reduce the variance during the extraction, reverse transcription and PCR, we did the measurement for each promoter with 12 replicates from an identical sample. Resuspend the pellet with 600µl RLT buffer containing ß-ME (1:100). QIAcube follows protocol "RNeasy Mini Animal Cell QIAshredder Version 3" using RNeasy Plant Mini Kit. mRNA from untransfected HeLa cells was extracted to be "Standard" to perform plate-to-plate correction.
+After RNA is extracted, the extracts were put on ice immediately. 2 tubes of 5 µl aliquots were taken, One for measuring RNA concentration and one for gel electrophoresis. The RNA concentration was measured using NanoDrop under 230 nm. Each sample was measured 3 times. The gel electrophoresis was performed to confirm the RNA integrity because RNA degrade under many conditions. We used 1% agarose gel and 0.5x TAE buffer.
+Next step is the Real-time RT-PCR. We had different setup for different kits.
+*For SensiMix One-Step Kit (Quantace):
+**96-well reaction setup (25 µl/reaction):
+***2X MasterMix:                12.5 µl
+***forward primer (5 µM):     1.0 µl
+***reverse primer (5 µM):     1.0 µl
+***probe (1.67 µM):              1.0 µl
+***RNase inhibitor:                0.5 µl
+***MgCl:                                0.5 µl
+***RNase-free water:            3.5 µl
+***RNA template (20 ng/µl): 5.0 µl
+**Program setup:
+***Reverse transcription: 49°C, 30 min
+***Enzyme activation: 95°C, 10 min
+***Amplification: 35 cycles:
+****95°C, 10 s
+****60°C, 1 min
+*For QuantiTect Probe RT-PCR Kit (QIAGEN):
+**96-well reaction setup (25 µl/reaction):
+***2X MasterMix: 12.5 µl
+***forward primer (5 µM): 2 µl
+***reverse primer (5 µM): 2 µl
+***probe (1.67 µM):  2 µl
+***RNase-free water: 1.25µl
+***RT Mix: 0.25µl
+***RNA template (20 ng/µl): 5.0 µl
+**Program setup:
+***Reverse transcription: 50°C, 30 min
+***Enzyme activation: 95°C, 15 min
+***Amplification: 45 cycles:
+****94°C, 15 s
+****60°C, 1 min
+In each plate, the 5 housekeeping genes were crossed with 12 replicates as well as Standard. eGFP was mixed with 12 replicates and RNase-free water as negative control. After the program finished, data was collected from OneStep software 2.0 associated to the StepOnePlus system. With a certain threshold (0.05), a series of Ct values were determined, then analyzed with MatLab.
+[[Team:Heidelberg/Notebook_MaM#Methods|[Back]]]
+== References ==
-===References===
+[1] Brady N. Bioquant Heidelberg, Eils group; Personal communication. <br>
-[1] Dipak Panigrahy, Samuel Singer, Lucy Q. Shen, Catherine E. Butterfield, Deborah A. Freedman, Emy J. Chen, Marsha A. Moses, Susan Kilroy, Stefan Duensing, Christopher Fletcher, Jonathan A. Fletcher, Lynn Hlatky, Philip Hahnfeldt, Judah Folkman & Arja Kaipainen (2002) PPAR&gamma; ligands inhibit primary tumor growth and metastasis by inhibiting angiogenesis. ''Journal of clinical cancer'' 110: 923-932.
+[2] Schilde J. Institute for human genetics at the University of Heidelberg; Personal communication.<br>
-<br />[2] Enrico Lucarelli, Luca Sangiorgi, Veronica Maini, Giovanna Lattanzi, Sandra Marmiroli, Matteo Reggiani, Marina Mordenti, Giuliana Alessandra Gobbi, Francesca Scrimieri, Annarosa Zambon Bertoja, Piero Picci (2002) Troglitazione affects survival of human osteosarcoma cells. ''International Journal of Cancer'' 98 (3): 344-351.
+[3] Panigrahy D., Singer S., Shen L. Q., Butterfield C. E., Freedman D. A., Chen E. J., Moses M. A., Kilroy S., Duensing S., Fletcher C., Fletcher J. A., Hlatky L., Hahnfeldt P., Folkman J. & Kaipainen A. PPAR&gamma; ligands inhibit primary tumor growth and metastasis by inhibiting angiogenesis. ''Journal of clinical cancer'' 110: 923-932 (2002). <br>
-<br />[3]
+[4] Lucarelli E., Sangiorgi L., Maini V., Lattanzi G., Marmiroli S., Reggian M., Mordenti M., Gobbi G. A., Scrimieri F., Bertoja A. Z. & Picci P. Troglitazione affects survival of human osteosarcoma cells. ''International Journal of Cancer'' 98(3): 344-351 (2002). <br>
+[5] Komarov P. G., Komarova E. A., Kondratov R. V., Christov-Tselkov K., Coon J. S., Chernov M. V. & Gudkov A. V. A chemical inhibitor of p53 that protects mice from the side effects of cancer therapy. ''Science'' 285(5434): 1733-7 (1999). <br>
+[6] Wang S. H., Liang C. T., Liu Y. W., Huang M. C., Huang S. C., Hong W. F. & Su J. G. Crosstalk between activated forms of the aryl hydrocarbon receptor and glucocorticoid receptor. ''Toxicology'' 262(2): 87-97 (2009). <br>
+[7] Diesing D., Cordes T., Fischer D., Diedrich K. & Friedrich M. Vitamin D--metabolism in the human breast cancer cell line MCF-7. ''Anticancer Res.'' 26(4A): 2755-9 (2006). <br>
+[8] Bartz F., Kern L., Erz D., Zhu M., Gilbert D., Meinhof T., Wirkner U., Erfle H., Muckenthaler M., Pepperkok R. & Runz H. Identification of Cholesterol-Regulating Genes by Targeted RNAi Screening. ''Cell Metabolism'' 10: 63-75 (2009). <br>
+[9] Runz H., Miura K., Weiss M. & Pepperkok R. Sterols regulate ER-export dynamics of secretory cargo protein ts-O45-G. ''The EMBO Journal'' 25: 2953 - 2965 (2006). <br>
+[10] Treede I., Braun A., Jeliaskova P., Giese T., Füllekrug J., Griffiths G., Stremmel W. & Ehehalt R. TNF-α-induced up-regulation of pro-inflammatory cytokines is reduced by phosphatidylcholine in intestinal epithelial cells. ''BMC Gastroenterology'' 9:53  (2009)
+[[Team:Heidelberg/Notebook_MaM#Methods|[Back]]]
-|width="250px" style="background-color:#d8d5d0"|
+|width="250px" style="padding: 0 20px 15px 15px; background-color:#d8d5d0"|
 |}

Team:Heidelberg/Notebook MaM

From 2009.igem.org

Latest revision as of 16:35, 20 November 2009

Materials & Methods

Kits

Marker

Enzymes

Restriction Enzymes

Bacteria

Bacteria Growth Media

Eucaryotic cell lines

Cell Culture Media

DMEM+++

DMEM++

Zeocin-Medium

Hygromycin-Medium

Minimal Medium

Oligos

Oligos used for RA-PCR

Oligos for LAM-PCR

Oligos for real-time RT-PCR

Plasmids

Instruments

Lab material

Methods

General Methods

Transformation of Bacteria

Glycerol stock

Isolation of plasmid DNA by alkaline lysis (mini and maxiprep)

Preparing chemically competent cells

Ligation

Site-directed mutagenesis

DNA synthesis

Purification of DNA from PCR reactions

Enzymatic hydrolysis of DNA by restriction enzymes

Agarose gel electrophoresis for separating DNA

Isolation of DNA fragments from an agarose gel

Cell Culture

Splitting cells

Transfection of Mammalian cells

Freeze cells

Picking cells with cloning disks

Fix cells for microscopy

Induction

RA-PCR

Measurement and Screening

Screening by TECAN

Flow Cytometry (FC)

Microscopy/ Image Analysis

Real-time RT-PCR

References