From 2009.igem.org

(Difference between revisions)

Latest revision as of 03:53, 22 October 2009

Home	The Team	The Project	Parts Submitted to the Registry	Modeling	Notebook	Protocols	Ethics

the notebook

1 Plan
2 June
- 2.1 6/5
- 2.2 6/6
- 2.3 6/7
- 2.4 6/14
- 2.5 6/21
3 July
- 3.1 7/5
- 3.2 7/19
- 3.3 7/20
- 3.4 7/27
- 3.5 7/30~8/2
4 August
5 September
- 5.1 9/15
- 5.2 9/16
- 5.3 9/17
- 5.4 9/19
- 5.5 9/20
- 5.6 9/21
- 5.7 9/22
- 5.8 9/23
- 5.9 9/24
- 5.10 9/25
- 5.11 9/26
- 5.12 9/27
- 5.13 9/29
- 5.14 9/30
6 October
- 6.1 10/2
- 6.2 10/7
- 6.3 10/9
- 6.4 10/10
- 6.5 10/11
- 6.6 10/12
- 6.7 10/13
- 6.8 10/14
- 6.9 10/15
- 6.10 10/16
- 6.11 10/18
- 6.12 10/19
- 6.13 10/20~
- 6.14 Result

Plan

Aim: Create bacteria that produce a noxious odour when induced to do so
Methods:

Clone the yqiT gene from Bacillus subtilis into a biobrick vector.
Make constructs that express this gene constitutively and under the control of an inducible promoter.

June

First, we haven't decided what promoter to use.
While looking for a good promoter, we were cloning YqiT and useful parts.

6/5

Constructs to be created:

yqiT
ptetR-RBS-yqiT-dterm
pAraC-RBS-yqiT-dterm
pLacI-RBS-yqiT-dterm

Obtaining DNA:

Resuspended DNA in the following wells with 10ul water:

Plate 1 1D
[http://partsregistry.org/wiki/index.php/Part:BBa_R0080 AraC regulated promoter] Plate 1 12E
[http://partsregistry.org/wiki/index.php?title=Part:BBa_R0010 LacI regulated promoter]

Plate 1 1H
[http://partsregistry.org/wiki/index.php/Part:BBa_B0030 Strong RBS]

Plate 1 13B
[http://partsregistry.org/wiki/index.php?title=Part:BBa_J13002 TetR repressed POPS generator]

Plate 2 24C
[http://partsregistry.org/wiki/index.php?title=Part:BBa_B0014 Double terminator]

Transformed 1ul of each of the above into DH5a competent cells:

Transformation

Mix 1ul of DNA with 100ul of competent cells on ice.
Leave on ice for 30 minutes.
Heat shock at 42°Cfor 45 seconds.
Leave on ice for 2 minutes.
Add 500ul of LB and incubate at 37°C for 1 hour.
Plate on LB-ampicillin plates.

6/6

No colonies grew from the 5 transformations of 6/5.

6/7

Creating a biobrick part out of yqiT

Strategy: PCR out the yqiT gene from the Bacillus subtilis genome using primers to attach the biobrick preffix/suffix and clone this into a biobrick vector. The vector utilized is the GFP generator which houses a sufficient-sized insert:

Plate 1 16E (from 2007 iGEM distribution provided by Chiba University)
[http://partsregistry.org/wiki/index.php?title=Part:BBa_E0840 GFP generator]

Overview:

PCR yqiT gene from genome
purify DNA from the PCR product
digest GFP generator and purified PCR product by XbaI/PstI
gel-purify the digested vector (GFP generator without the insert i.e. empty) and the yqiT gene
ligate the above 2 fragments of DNA together
transform into E. coli and select for ampicillin resistance
check for transformation success using colony PCR by yqiT primers

PCR of yqiT gene
The Bacillus subtilis genome was provided by Bacillus subtilis 168

The following primers were used to amplify an approx. 1500bp fragment from the Bacillus subtilis genome.

yqiT EX: ccggaattctctagaatggaactttttaaatatatggaacgatacg(bold text is a sequence binding yqiT gene)
yqiT SP: ctgcagcggccgctactagtattagcgacgacttaaaatatgttgg(bold text is a sequence binding yqiT gene)

PCR protocol
The following was mixed in a PCR tube:
1ul 20uM yqiT EX primer
1ul 20uM yqiT SP primer
2ul 10X Pfu Ultra buffer
1.6ul dNTP mix
0.15ul Bacillus subtilis genome
0.5ul Pfu Ultra enzyme
13.85ul MilliQ

Performed PCR using the following program:

1. 95°C 2 minutes
2. 95°C 30 seconds
3. 50°C 30 seconds
4. 72°C 40 seconds
5. Repeat 2-4 23 times
6. 25°C forever

Purified PCR product using the Promega PCR purification kit.

Ran on gel to visualize bands:

PCR unsuccessful: will digest the GFP generator but cannot perform the ligation without the PCR product.

Digestion
Digested purified PCR product and the GFP generator both with XbaI/PstI:

yqiT
3ul PCR product
1ul High buffer
0.5ul XbaI
0.5ul PstI
5ul MilliQ

GFP generator
6ul DNA
2ul High buffer
1ul XbaI
1ul PstI
10ul MilliQ

Incubated mixtures at 37°C for 1 hour.

Ran on gel to gel purify:
Lanes 1, 12:marker
Lanes 2, 5, 9:GFP
Lanes 3, 6, 10:yqiT

Cut out the second band from the bottom and dissolved the gel using the Promega gel purification kit to extract DNA from.

This DNA is stored for later usage as the GFP generator X/P vector fragment.

6/14

Creating a biobrick part out of yqiT

Strategy: PCR out the yqiT gene from the Bacillus subtilis genome using primers to attach the biobrick preffix/suffix and clone this into a biobrick vector. The vector utilized is the GFP generator which houses a sufficient-sized insert:

Plate 1 1D (from 2009 iGEM distribution provided by Tokyo University) promoter (lacI regulated)

Overview:

PCR yqiT gene from genome

gel-purify DNA from the PCR product

digest lacI regulated promoter and purified PCR product by XbaI/PstI

gel-purify the digested vector (lacI regulated promoter without the insert i.e. empty) and the yqiT gene

ligate the above 2 fragments of DNA together

transform into E. coli and select for ampicillin resistance

check for transformation success using colony PCR by yqiT primers

PCR of yqiT gene The Bacillus subtilis genome was provided by Bacillus subtilis 168

The following primers were used to amplify an approx. 1095bp fragment from the Bacillus subtilis genome.

yqiT EX: ccggaattctctagaatggaactttttaaatatatggaacgatacg(bold text is a sequence binding yqiT gene)

yqiT SP: ctgcagcggccgctactagtattagcgacgacttaaaatatgttgg(bold text is a sequence binding yqiT gene)

PCR protocol

The following was mixed in a PCR tube:

1ul 20uM yqiT EX primer

1ul 20uM yqiT SP primer

2ul 10X Pfu Ultra buffer

1.6ul dNTP mix

0.15ul Bacillus subtilis genome

0.5ul Pfu Ultra enzyme

13.75ul MilliQ

Performed PCR using the following program:

1. 95°C 2 minutes

2. 95°C 30 seconds

3. 50°C 30 seconds

4. 72°C 40 seconds

5. Repeat 2-4 29 times

6. 25°C forever

Purified PCR product using the Promega PCR purification kit.

Ran on gel to gel purify:

Lanes 1:marker 6ul

Lanes 2:yqiT PCR product 10ul + 10xLoading Dye 2ul

PCR successful

Ligation

Ligated gel purified yqiT and vector with TaKaRa Solutions 1:

lacI regulated promoter (vector) 2ul

yqiT 8ul

TaKaRa Solutions 1 6ul

Incubated mixtures at 37°C for 10 minutes.

Transformation

6/21

Creating a biobrick part out of yqiT

Strategy: PCR out the yqiT gene from the Bacillus subtilis genome using primers to attach the biobrick preffix/suffix and clone this into a biobrick vector. The vector utilized is the GFP generator which houses a sufficient-sized insert:

Plate 1 1D (from 2009 iGEM distribution provided by Tokyo University)
[http://partsregistry.org/wiki/index.php?title=Part:BBa_R0010 promoter (lacI regulated)]

Overview:

PCR yqiT gene from genome
gel-purify DNA from the PCR product
digest lacI regulated promoter and purified PCR product by XbaI/PstI
gel-purify the digested vector (lacI regulated promoter without the insert i.e. empty) and the yqiT gene
ligate the above 2 fragments of DNA together
transform into E. coli and select for ampicillin resistance
check for transformation success using colony PCR by yqiT primers

PCR of yqiT gene
The Bacillus subtilis genome was provided by Bacillus subtilis 168

The following primers were used to amplify an approx. 1095bp fragment from the Bacillus subtilis genome.

yqiT EX: ccggaattctctagaatggaactttttaaatatatggaacgatacg(bold text is a sequence binding yqiT gene)
yqiT SP: ctgcagcggccgctactagtattagcgacgacttaaaatatgttgg(bold text is a sequence binding yqiT gene)

PCR protocol
The following was mixed in a PCR tube:
1ul 20uM yqiT EX primer
1ul 20uM yqiT SP primer
2ul 10X Pfu Ultra buffer
1.6ul dNTP mix
0.15ul Bacillus subtilis genome
0.5ul Pfu Ultra enzyme
13.75ul MilliQ

Performed PCR using the following program:

1. 95°C 2 minutes
2. 95°C 30 seconds
3. 50°C 30 seconds
4. 72°C 40 seconds
5. Repeat 2-4 29 times
6. 25°C forever

Purified PCR product using the Promega PCR purification kit.

Ran on gel to gel purify:
Lanes 6:marker 6ul
Lanes 2, 4:yqiT PCR product 10ul + 10xLoading Dye 2ul

PCR successful

Digestion
Digested purified PCR product and the lacI regulated promoter both with XbaI/PstI:

yqiT
3ul PCR product
1ul High buffer
0.5ul XbaI
0.5ul PstI
5ul MilliQ

lacI regulated promoter
4ul DNA
4ul High buffer
2ul XbaI
2ul PstI
28ul MilliQ

Incubated mixtures at 37°C for 1 hour.

Ran on gel to gel purify:
Lanes 3:marker 6ul
Lanes 2, 5:lacI regulated promoter 40ul + 10xLoading Dye 8ul
Lanes 1, 4:yqiT 10ul + 10xLoading Dye 2ul

Cut out the band and dissolved the gel using the Promega gel purification kit to extract DNA from.

Ligation
Ligated gel purified yqiT and vector with TaKaRa Solutions 1:

lacI regulated promoter (vector) 0.5ul
yqiT 5.5ul
TaKaRa Solutions 1 4ul

Incubated mixtures at 37°C for 10 minutes.

Transformation

July

We tried to read the sequence of YqiT for the first time.
But the trial　ended to failure....

7/5

TA cloning of YqiT
PCR of YqiT
0.25ul Takara ExTaq
5ul 10xExTaq Buffer
4ul dNTPmix
0.5ul Bacillus subtilis genome
0.5ul 5'primer(It is the same sequence as that on 6/21)
0.5ul 3'primer(It is the same sequence as that on 6/21)
up to 50ul MilliQ

Performed PCR using the following program: 1. 94°C 2 minutes
2. 94°C 30 seconds
3. 52°C 80 seconds
4. 72°C 60 seconds
5. Repeat 2-4 29 times
6. 25°C forever

lane1:marker
lane2~5:YqiT

PCR successful!
But we couldn't do ligation because TA cloning kit was not left.
We purified PCR products and put them in -20°C.

7/19

YqiT colony PCR

put a small amount of single colony into each tube with 5ul MilliQ water
|
v

95°C 5min
|
v

PCR reaction
1ul 10×buffer
0.8ul 2.5mMdNTP
0.08ul Ex-Taq
0.1ul 5’-primer
0.1ul 3’-primer
2.92ul MilliQ water
|
v

added the PCR reaction to each tube.
|
v

Performed PCR using the following program:
1. 95°C 2min
2. 95°C 30sec
3. 52°C 30sec
4. 72.5°C 80sec
5. repeat 2-4 29times
6. 25°C forever

PCR successful!

added a small amount of colony number 2 and 3 to each test tube with 4ml LB broth.
cultured them over night.

7/20

Miniprep of E.coli cells containing YqiT gene with Promega, Wizard Plus SV Miniprep DNA Purification System

7/27

Sequencing YqiT by BIG DYE
1.8ul 5xB.D.3.1.buffer
0.4ul B.D.3.1.
6.3ul MilliQ water
1ul plasmid(0.15ug/ul)
0.5ul 5'or3'primer(3.2pmol/ul)
|
v

PCR　Program
1.96°C 2min
2.96°C 10sec
3.55°C 5sec
4.60°C 3min
5.go to 2.29times
6.25°C forever
|
v

add 0.5ul PHOSPHATASE ALKALINE shrimp
|
v

37°C 1hr incubate
|
v

add 1ul 3MNaOAc
|
v

add 25ul EtOH
|
v

20000xg 4°C 10min centrifugation
|
v

put off supernatant
|
v

dry tubes
|
v

add 15ul HiDi
|
v

put them in the sequence machine

7/30~8/2

Sequencing YqiT by BigDye
unsuccessful

August

Sequence reading succeed!
We made YqiT + double terminator.

8/3

sequence YqiT by BigDye
successful

8/7~9

Digestion
insert YqiT gene into a terminator of iGEM parts
terminator
double terminatorMiniprep ., using Promega kit
plate1 23L

8/12~14

PCR of YqiT for restriction enzyme fragmentation and infusion
PCR protocol
The following was mixed in a PCR tube:
0.2ul 100uM yqiT EX primer/yqiT infusion 5'primer
0.2ul 100uM yqiT SP primer/yqiT infusion 3'primer
2ul 10X Pfu Ultra buffer
1.6ul dNTP mix
0.2ul plasmid containing YqiT gene(that sequence matches YqiT gene of Batillus genome)
0.5ul Pfu Ultra enzyme
15.3ul MilliQ

Performed PCR using the following program:

1. 95°C 2 minutes
2. 95°C 30 seconds
3. 55°C 30 seconds
4. 72.5°C 30 seconds
5. Repeat 2-4 29 times
6. 25°C forever

restriction enzyme fragmentation of double terminator by XbaI
1ug plasmid
10ul BSA
10ul 10xM buffer
2.5ul XbaI
up to　100ul MilliQ water
37°C over night
　 restriction enzyme fragmentation of double terminator by EcoRI
1ug plasmid
10ul 10xH buffer
2.5ul EcoRI
up to　100ul MilliQ water
37°C over night
　 restriction enzyme fragmentation of YqiT gene by SpeI
1ug DNA
10ul 10xH buffer
2.5ul SpeI
up to　100ul MilliQ water
37°C over night
　 restriction enzyme fragmentation of YqiT gene by EcoRI
1ug DNA
10ul 10xH buffer
2.5ul EcoRI
up to　100ul MilliQ water
37°C over night
　

8/15,16

ligate YqiT and double terminator

8/19

1 colony PCR of YqiT
Result: successful

September

Aim
We decided to use YqiT as a reporter of dioxin!
So, we began to create this construct
1.-XRE-Gal1 promoter-yqiT-
2.-Ahr-←Gal1promoter/Gal10 promoter→-Arnt-

PCR of yqiT and insert it in iGEM parts(plate 1-7D:Gal1 promoter)

Performed PCR using the following program:
1. 95°C 2 minutes
2. 95°C 30 seconds
3. 55°C 30 seconds
4. 72.5°C 30 seconds
5. Repeat 2-4 29 times
6. 25°C forever

cut YqiT off with EcoRI and SpeI
cut P1-7D off with EcoRI and XbaI
ligate the upper two DNA

read the Sequencing of Gal1 promoter+yqiT

->the result conforms with NCBI datebase

9/15

1. Restriction enzyme digestion

P1 7L with E

2. ligation + transformation

P1 7L + yqit

3. restriction enzyme digestion

P1 7L with S

4. restriction enzyme digestion

yqit with X and P
P1 7D with S and P

9/16

1. Colony PCR

P1 7D+yqit

2. gel extraction (product of restriction enzyme digestion)

P1 7L (E,X)
P1 7D (S,P)
yqit (X,P)

3. ligation and transformation

yqit + P1 7D

9/17

1. colony PCR

P1 7D + yqit

2. restriction enzyme digestion

yqit with X and P
P1 7D with S and P
P1 7L with E and S

9/19

1. Ligation->transformation

P1 7D+yqit

9/20

1.Sequencing

yqit->failure

2. colony PCR

P1 7D+yqit->success

9/21

1.Miniprep

P1 7D+yqit

9/22

1.Sequencing

P1 7D+yqit->failure

9/23

1. restriction enzyme digestion

P1 7D with E and X
P1 7L+yqit with E and X

2. Ligation->transformation

P1 7D+XRE
P1 7D+yqit+XRE

9/24

1. Miniprep

P2 10F

2. restriction enzyme digestion

P1 7D with E and X
P1 7L+yqit with E and X

9/25

insert XRE in P1-7D and P1-7D including yqiT using Infusion kit(clonthech)
gel purification of P1-7D and P1-7D including yqiT

9/26

preculture of E.coli cells containing Ahr and Arnt gene for Miniprep

9/27

Miniprep of E.coli cells containing Ahr and Arnt gene with Promega, Wizard Plus SV Miniprep DNA Purification System

Aim
TA cloning of Ahr, Arnt and gal1/10 promoter

PCR of Ahr and Arnt for TA cloning(Ex-taq , Funakoshi)

template:human Ahr cDNA and human Arnt cDNA
1,95°C 2min
2,95°C 30sec
3,55°C 30sec
4,72.5°C 1.5min
5,go°C to 2, 29times
6,25°C forever

9/29

ligation of P17D+YqiT and XRE

ligation of P17D and XRE

restriction enzyme digest

P17D with S and P

sequencing of XRE+P17D

9/30

miniprep of ARNT and AMR

colony PCR of P17D+XRE

primer:
EX_XRE3_5_5'
J630101P7Dseq3'

restriction enzyme digest

YqiT+D.T. with Pst1 and Xba1

again, colony PCR of P17D+XRE

primer:
EX_XRE3_5_5'
J630101P7Dseq3'

October

We made the plasmid including XRE+Gal1p+YqiT.
Cloning of Ahr, Arnt and gal1/10p were difficult...

10/2

colony PCR of YqiT

10/7

PCR of gal1/10 promoter (Ex-taq , Funakoshi)

template:S.serevisiae genome DNA
1,95°C 2min
2,95°C 30sec
3,55°C 30sec
4,72.5°C1min
5,go°C to 2, 29times
6,25°C forever

10/9

PCR of gal1/10 promoter (Ex-taq , Funakoshi)

template:S.serevisiae genome DNA
1,95°C 2min
2,95°C 30sec
3,55°C 30sec
4,72.5°C1min
5,go°C to 2, 29times
6,25°C forever

10/10

TA cloning of Ahr, Arnt and gal1/10 promoter

ligate PCR product and T bector
->
put each plasmid into different E.coli
->
Miniprepof them by using Promega kit
->
read each sequence in order to check whether there is plasmids including Ahr, Arnt or gal1/10 promoter

10/11

check YqiT expression

Using iGEM parts, create the construct that produces YqiT steadily or reguratory
P2-10F-YqiT-double terminator
P2-16E-YqiT-double terminator
P1-22A-YqiT-double terminator
P1-21B-YqiT-double terminator

cut YqiT-double terminator off with XbaI and PstI
cut P2-10F, P2-16E, P1-22A and P1-21B off with SpeI and PstI
|
v
ligate YqiT-double terminator and iGEM part
|
v
put each plasmid into different E.coli
|
v
Miniprep of them by using Promega kit
|
v
read each sequence in order to check whether there is plasmids including the construct

10/12

Miniprep of P1,10F with Promega Kit

10/13

Sequencing of Arnt, Ahr

10/14

Colony PCR of Arnt, Aht, and pGal1/10
Sequencing Ahr, Arnt, and pGal1
preculture of Arnt and Ahr

10/15

Sequencing Arnt, Ahr and pGal1/10

10/16

Miniprep of Arnt,Ahr and pGal1/10 with Promega Kit

10/18

1. Sequencing
read the following sequences;

P1-23A+yqit
P1-21B+yqit
p1-16E+yqit
XRE+Gal1+yqit
P2 10F

2. transformation

P2 10F+yqit+double terminator

3.Miniprep

P2 10F

4. Restriction enzyme digestion

yqit with X and P
XRE+P1 7D with S and P

5. Gel extraction(after gel electrophoresis)

yqit (processed with restriction enzymes)
P1 7D processed with restriction enzymes)

6. Restriction enzyme digestion

yqit with P

7. Restriction enzyme digestion

P1 7D with S and P
P1 22A with E and P

8. Sequencing

P1 14L
P1 16E
P1 21B
P1 22A
P2 5F
P2 9H
P2 10F
P2 16E
XRE-Gal1-yqit

9. Restriction enzyme digestion

P1 7D with S and P

10. Ligation

XRE and yqit

11. Transformation

XRE + yqit

12. restriction enzyme digest

yqit with X and P
P2 10F with S and P

10/19

1. colony PCR

P1 7D+XRE+yqit+double terminator

2. restriction enzyme digest

P2 10F with S and P
yqit with X and P

3. sequencing

P2 10F

4. Ligation

P2 10F + yqit

5. transformation

P2 10F + yqit
yqit

6. restriction enzyme digest

XRE+P1 7D+yqit with E and P

7. infusion

yqit + PET

8. colony PCR

P1 7D+XRE+yqit

9. colony PCR

P2 10F+yqit

10/20~

1. colony PCR

P2 10F+yqit

2. Smell Test 2. Smell Test

Time for shake culture (each of sample) 15 hours
Negative control has plasmid containing “yqiT + double terminator” (Not including promoter)
Cleansed air is cleansed with active carbon filter.
Equipment
- Trade name: ODOR CONCENTRATION METER
- Model: XP-329
- Serial No. 311059
- Manuf. NEW COSMOS ELECTRIC CO,LTD.
- Setting: Peak hold
the following values indicate intensity of the smell
- cleansed air:200
- air:515
- normal E.coli: 582
- E.coli with constitutive promotor+RBS+yqit+double terminator: 686
yqit successfully worked!!
Associate Prof. Kawanishi offered us the yeast, whose chromosome contains AhR and ARNT.

Result

We have made E.coli which has "Constitutive promoter (strong) - RBS - yqiT - double terminator" in its plasmid.
and
We will have made yeast which has Ahr and ARNT in its chromosome, and "XRE - Gal1p - yqiT" in its plasmid by 21 October.

Home	The Team	The Project	Parts Submitted to the Registry	Modeling	Notebook	Protocols	Ethics

@@ Line 7: / Line 7: @@
 p { font-size : 10pt }
    pz{ font-size : 30pt; color : red}
-  -->
    .aaa { font-size : 20pt }
 @charset "UTF-8";
@@ Line 13: / Line 12: @@
 	background:black;
 	}
+div#top_plan{
+   background:#B22222;
+   color:#ffffe0;
+   margin 0 0 0 0
+   width:900px;
+   height:200px;
+}
+div#exp{
+   background:#696969;
+   color:#C0C0C0;
+   width:700px;
+   height:200px;
+}
+div#exp day{
+   background:#006400;
+   color:white;
+   width 70px;
+   height 70px;
+   margin: 10 0 10 0;
+   float:left;
+}
    </style>
   </head>
-<body></body></html>
+<body></body>
+</html>
 = Plan =
-'''Aim:''' Create bacteria that produce a noxious odour when induced to do so
+'''Aim:''' Create bacteria that produce a noxious odour when induced to do so<BR>
 '''Methods:'''<BR>
 # Clone the yqiT gene from ''Bacillus subtilis'' into a biobrick vector.<BR>
 # Make constructs that express this gene constitutively and under the control of an inducible promoter.<BR>
+[[Image:Tbcco.png|400px]]
+=June=
+First, we haven't decided what promoter to use.<BR>
+While looking for a good promoter, we were cloning YqiT and useful parts.
 ==6/5==
 '''Constructs to be created:'''
@@ Line 39: / Line 61: @@
 Plate 1 1D<BR>
 [http://partsregistry.org/wiki/index.php/Part:BBa_R0080 AraC regulated promoter]
 Plate 1 12E<BR>
 [http://partsregistry.org/wiki/index.php?title=Part:BBa_R0010 LacI regulated promoter]
@@ Line 54: / Line 75: @@
 Transformed 1ul of each of the above into DH5a competent cells:
-'''Transformation'''
+[[Team:Todai-Tokyo/Protocols/Transformation|'''Transformation''']]
 *Mix 1ul of DNA with 100ul of competent cells on ice.
 *Leave on ice for 30 minutes.
@@ Line 60: / Line 81: @@
 *Leave on ice for 2 minutes.
 *Add 500ul of LB and incubate at 37°C for 1 hour.
 *Plate on LB-ampicillin plates.
 == 6/6 ==
@@ Line 68: / Line 88: @@
 == 6/7 ==
 <font color=red size=4>'''Creating a biobrick part out of yqiT''' </font>
 '''Strategy''':
-PCR out the yqiT gene from the ''Bacillus subtilis'' genome using primers to attach the biobrick preffix/suffix and clone this into a biobrick vector. The vector utilized is the GFP generator which houses a sufficient-sized insert:
+[[Team:Todai-Tokyo/Protocols/PCR|PCR]] out the yqiT gene from the ''Bacillus subtilis'' genome using primers to attach the biobrick preffix/suffix and clone this into a biobrick vector. The vector utilized is the GFP generator which houses a sufficient-sized insert:
@@ Line 81: / Line 100: @@
 '''Overview:'''<BR>
-# PCR yqiT gene from genome
+# [[Team:Todai-Tokyo/Protocols/PCR|PCR]] yqiT gene from genome
-# purify DNA from the PCR product
+# purify DNA from the [[Team:Todai-Tokyo/Protocols/PCR|PCR]] product
-# digest GFP generator and purified PCR product by XbaI/PstI
+# digest GFP generator and purified [[Team:Todai-Tokyo/Protocols/PCR|PCR]] product by XbaI/PstI
 # gel-purify the digested vector (GFP generator without the insert i.e. empty) and the yqiT gene
 # ligate the above 2 fragments of DNA together
 # transform into ''E. coli'' and select for ampicillin resistance
-# check for transformation success using colony PCR by yqiT primers
+# check for transformation success using colony [[Team:Todai-Tokyo/Protocols/PCR|PCR]] by yqiT primers
-'''PCR of yqiT gene'''<Br>
+'''[[Team:Todai-Tokyo/Protocols/PCR|PCR]] of yqiT gene'''<Br>
 The ''Bacillus subtilis'' genome was provided by Bacillus subtilis 168
@@ Line 99: / Line 118: @@
 yqiT SP: ctgcagcggccgctactagta'''ttagcgacgacttaaaatatgttgg'''(bold text is a sequence binding yqiT gene)
-'''PCR protocol'''<BR>
+'''[[Team:Todai-Tokyo/Protocols/PCR|PCR]] protocol'''<BR>
-The following was mixed in a PCR tube:<Br>
+The following was mixed in a [[Team:Todai-Tokyo/Protocols/PCR|PCR]] tube:<Br>
 ul 20uM yqiT EX primer<Br>
 ul 20uM yqiT SP primer <Br>
@@ Line 109: / Line 128: @@
 .85ul MilliQ<Br>
-Performed PCR using the following program:
+Performed [[Team:Todai-Tokyo/Protocols/PCR|PCR]] using the following program:
 . 95°C 2 minutes<Br>
@@ Line 118: / Line 137: @@
 . 25°C forever<Br>
-Purified PCR product using the Promega PCR purification kit.
+Purified [[Team:Todai-Tokyo/Protocols/PCR|PCR]] product using the Promega [[Team:Todai-Tokyo/Protocols/PCR|PCR]] purification kit.
 Ran on gel to visualize bands:
@@ Line 124: / Line 143: @@
 [[Image:090607.1.jpg|200px]]
-<font color=blue>PCR unsuccessful</font>: will digest the GFP generator but cannot perform the ligation without the PCR product.
+<font color=blue>[[Team:Todai-Tokyo/Protocols/PCR|PCR]] unsuccessful</font>: will digest the GFP generator but cannot perform the ligation without the [[Team:Todai-Tokyo/Protocols/PCR|PCR]] product.
 <BR><BR>
 '''Digestion'''<BR>
-Digested purified PCR product and the GFP generator both with XbaI/PstI:
+Digested purified [[Team:Todai-Tokyo/Protocols/PCR|PCR]] product and the GFP generator both with XbaI/PstI:
 '''yqiT'''<Br>
-ul PCR product<Br>
+ul [[Team:Todai-Tokyo/Protocols/PCR|PCR]] product<Br>
 ul High buffer<Br>
 .5ul XbaI<Br>
@@ Line 159: / Line 178: @@
 This DNA is stored for later usage as the GFP generator X/P vector fragment.
 == 6/14 ==
@@ Line 239: / Line 257: @@
 Lanes 1:marker 6ul
-Lanes 2:yqiT PCR product 10ul + 10xLoading Dye 2ul
+Lanes 2:yqiT PCR product 10ul + 10xLoading Dye 2ul<BR>
+[[Image:090614.jpg]]<BR>
- [[Image:090614.jpg]]
 PCR successful
@@ Line 367: / Line 381: @@
 '''Transformation'''<BR>
+=July=
+We tried to read the sequence of YqiT for the first time.<BR>
+But the trial　ended to failure....
 == 7/5 ==
@@ Line 401: / Line 418: @@
 put a small amount of single colony into each tube with 5ul MilliQ water<BR>
-￬<BR>
+|<BR>
+v<BR>
 °C 5min<BR>
-￬<BR>
+|<BR>
+v<BR>
 PCR reaction<BR>
 ul 10×buffer <BR>
@@ Line 411: / Line 432: @@
 .1ul 3’-primer<BR>
 .92ul MilliQ water<BR>
-￬<BR>
+|<BR>
+v<BR>
 added the PCR reaction to each tube.<BR>
-￬<BR>
+|<BR>
+v<BR>
 Performed PCR using the following program:<BR>
 . 95°C 2min<BR>
@@ Line 428: / Line 453: @@
 =='''7/20'''==
-Miniprep of E.coli cells containing YqiT gene with Promega, Wizard Plus SV Miniprep DNA Purification System
+Miniprep of E.coli cells containing YqiT gene with Promega, Wizard Plus SV [[Team:Todai-Tokyo/Protocols/Miniprep|Miniprep]]  DNA Purification System
 =='''7/27'''==
-sequencing YqiT by BIG DYE<BR>
+[[Team:Todai-Tokyo/Protocols/Sequencing|Sequencing]] YqiT by BIG DYE<BR>
 .8ul 5xB.D.3.1.buffer<BR>
 .4ul B.D.3.1.<BR>
@@ Line 437: / Line 462: @@
 ul plasmid(0.15ug/ul)<BR>
 .5ul 5'or3'primer(3.2pmol/ul)<BR>
-￬<BR>
+|<BR>
+v<BR>
 PCR　Program<BR>
 .96°C 2min<BR>
@@ Line 445: / Line 472: @@
 .go to 2.29times<BR>
 .25°C forever<BR>
-￬<BR>
+|<BR>
+v<BR>
 add 0.5ul PHOSPHATASE ALKALINE shrimp<BR>
-￬<BR>
+|<BR>
+v<BR>
 °C 1hr incubate<BR>
-￬<BR>
+|<BR>
+v<BR>
 add 1ul 3MNaOAc<BR>
-￬<BR>
+|<BR>
+v<BR>
 add 25ul EtOH<BR>
-￬<BR>
+|<BR>
+v<BR>
 xg 4°C 10min centrifugation<BR>
-￬<BR>
+|<BR>
+v<BR>
 put off supernatant<BR>
-￬<BR>
+|<BR>
+v<BR>
 dry tubes<BR>
-￬<BR>
+|<BR>
+v<BR>
 add 15ul HiDi<BR>
-￬<BR>
+|<BR>
+v<BR>
 put them in the sequence machine<BR>
 =='''7/30~8/2'''==
-sequence YqiT by BigDye<BR>
+[[Team:Todai-Tokyo/Protocols/Sequencing|Sequencing]] YqiT by BigDye<BR>
 unsuccessful<BR>
+=August=
+Sequence reading succeed!<BR>
+We made YqiT + double terminator.
 =='''8/3'''==
 sequence YqiT by BigDye<BR>
@@ Line 474: / Line 523: @@
 insert YqiT gene into a terminator of iGEM parts<BR>
 '''terminator'''<BR>
-double terminator Miniprep., using Promega kit<BR>
+double terminator[[Team:Todai-Tokyo/Protocols/Miniprep|Miniprep]] ., using Promega kit<BR>
 plate1 23L<BR>
@@ Line 526: / Line 575: @@
 =='''8/15,16'''==
-ligate YqiT and double terminator<BR>
+ligate YqiT and double terminator<BR><BR>
-=='''August'''==
+=='''8/19''' ==
+colony PCR of YqiT<BR>
+Result: successful<BR><BR>
+='''September'''=
 <font color=red>Aim<BR></font>
 '''We decided to use YqiT as a reporter of dioxin!'''<BR>
@@ Line 548: / Line 603: @@
 *ligate the upper two DNA<BR>
-=='''September'''==
-*read the sequence of Gal1 promoter+yqiT<BR>
-→the result conforms with NCBI datebase<BR>
-*insert XRE in P1-7D including yqiT using infusion kit(clonthech)<BR>
+*read the [[Team:Todai-Tokyo/Protocols/Sequencing|Sequencing]] of Gal1 promoter+yqiT<BR>
+->the result conforms with NCBI datebase<BR>
+=='''9/15'''==
+. Restriction enzyme digestion<BR>
+*P1 7L with E<BR>
+. ligation + transformation<BR>
+*P1 7L + yqit<BR>
+. restriction enzyme digestion<BR>
+*P1 7L with S<BR>
+. restriction enzyme digestion<BR>
+*yqit with X and P<BR>
+*P1 7D with S and P<BR>
+=='''9/16'''==
+. Colony PCR<BR>
+*P1 7D+yqit<BR>
+. gel extraction (product of restriction enzyme digestion)<BR>
+*P1 7L (E,X)<BR>
+*P1 7D (S,P)<BR>
+*yqit (X,P)<BR>
+. ligation and transformation<BR>
+*yqit + P1 7D<BR>
+=='''9/17'''==
+. colony PCR<BR>
+*P1 7D + yqit<BR>
+. restriction enzyme digestion<BR>
+*yqit with X and P<BR>
+*P1 7D with S and P<BR>
+*P1 7L with E and S<BR>
+=='''9/19'''==
+. Ligation->transformation
+*P1 7D+yqit
+=='''9/20'''==
+.[[Team:Todai-Tokyo/Protocols/Sequencing|Sequencing]]
+*yqit->failure
+. colony PCR
+*P1 7D+yqit->success
+=='''9/21'''==
+.[[Team:Todai-Tokyo/Protocols/Miniprep|Miniprep]]
+*P1 7D+yqit
+=='''9/22'''==
+.[[Team:Todai-Tokyo/Protocols/Sequencing|Sequencing]]
+*P1 7D+yqit->failure
+=='''9/23'''==
+. restriction enzyme digestion<BR>
+*P1 7D      with E and X<BR>
+*P1 7L+yqit with E and X<BR>
+. Ligation->transformation
+*P1 7D+XRE
+*P1 7D+yqit+XRE
+=='''9/24'''==
+. [[Team:Todai-Tokyo/Protocols/Miniprep|Miniprep]]
+*P2 10F
+. restriction enzyme digestion<BR>
+*P1 7D      with E and X<BR>
+*P1 7L+yqit with E and X<BR>
+=='''9/25'''==
+*insert XRE in P1-7D and P1-7D including yqiT using [[Team:Todai-Tokyo/Protocols/Infusion|Infusion]] kit(clonthech)<BR>
+*gel purification of P1-7D and P1-7D including yqiT<BR>
+=='''9/26'''==
+*preculture of E.coli cells containing Ahr and Arnt gene for [[Team:Todai-Tokyo/Protocols/Miniprep|Miniprep]] <BR>
+=='''9/27'''==
+*Miniprep of E.coli cells containing Ahr and Arnt gene with Promega, Wizard Plus SV [[Team:Todai-Tokyo/Protocols/Miniprep|Miniprep]]  DNA Purification System
-----
 '''Aim'''<BR>
@@ Line 569: / Line 700: @@
 <BR>
-=='''October'''='em
+=='''9/29'''==
+*ligation of P17D+YqiT and XRE<br><br>
+*ligation of P17D and XRE<br><br>
+*restriction enzyme digest
+P17D with S and P<br><br>
+*sequencing of XRE+P17D<br><br>
+=='''9/30'''==
+*miniprep of ARNT and AMR<br><br>
+*colony PCR of P17D+XRE
+primer:<br>
+EX_XRE3_5_5'<br>
+J630101P7Dseq3'<br><br>
+*restriction enzyme digest
+YqiT+D.T. with Pst1 and Xba1<br><br>
+*again, colony PCR of P17D+XRE
+primer:<br>
+EX_XRE3_5_5'<br>
+J630101P7Dseq3'<br><br>
+='''October'''=
+We made the plasmid including XRE+Gal1p+YqiT.<BR>
+Cloning of Ahr, Arnt and gal1/10p were difficult...
+=='''10/2'''==
+*colony PCR of YqiT
+=='''10/7'''==
 *PCR of gal1/10 promoter (Ex-taq , Funakoshi)<BR>
 template:S.serevisiae genome DNA<BR>
@@ Line 579: / Line 744: @@
 ,25°C forever<BR>
 <BR>
+=='''10/9'''==
+*PCR of gal1/10 promoter (Ex-taq , Funakoshi)<BR>
+template:S.serevisiae genome DNA<BR>
+,95°C 2min<BR>
+,95°C 30sec<BR>
+,55°C 30sec<BR>
+,72.5°C1min<BR>
+,go°C to 2, 29times<BR>
+,25°C forever<BR>
+=='''10/10'''==
 *TA cloning of Ahr, Arnt and gal1/10 promoter<BR>
 ligate PCR product and T bector<BR>
-￬<BR>
+-><BR>
 put each plasmid into different E.coli<BR>
-￬<BR>
+-><BR>
-Miniprep of them by using Promega kit<BR>
+[[Team:Todai-Tokyo/Protocols/Miniprep|Miniprep]]of them by using Promega kit<BR>
-￬<BR>
+-><BR>
 read each sequence in order to check whether there is plasmids including Ahr, Arnt or gal1/10 promoter<BR>
 <BR>
 <BR>
-----
+=='''10/11'''==
-'''Aim'''<BR>
 *check YqiT expression<BR>
 Using iGEM parts, create the construct that produces YqiT steadily or reguratory<BR>
@@ Line 603: / Line 775: @@
 cut YqiT-double terminator off with XbaI and PstI<BR>
 cut P2-10F, P2-16E, P1-22A and P1-21B off with SpeI and PstI<BR>
-￬<BR>
+|<BR>
+v<BR>
 ligate YqiT-double terminator and iGEM part<BR>
-￬<BR>
+|<BR>
+v<BR>
 put each plasmid into different E.coli<BR>
-￬<BR>
+|<BR>
-Miniprep of them by using Promega kit<BR>
+v<BR>
-￬<BR>
+[[Team:Todai-Tokyo/Protocols/Miniprep|Miniprep]]  of them by using Promega kit<BR>
+|<BR>
+v<BR>
 read each sequence in order to check whether there is plasmids including the construct<BR>
 <BR>
+== '''10/12''' ==
+*[[Team:Todai-Tokyo/Protocols/Miniprep|Miniprep]]  of P1,10F with Promega Kit
+=='''10/13'''==
+*Sequencing of Arnt, Ahr
+=='''10/14'''==
+*Colony PCR of Arnt, Aht, and pGal1/10
+*[[Team:Todai-Tokyo/Protocols/Sequencing|Sequencing]] Ahr, Arnt, and pGal1
+*preculture of Arnt and Ahr
+=='''10/15'''==
+*[[Team:Todai-Tokyo/Protocols/Sequencing|Sequencing]] Arnt, Ahr and pGal1/10
+=='''10/16'''==
+*[[Team:Todai-Tokyo/Protocols/Miniprep|Miniprep]]  of Arnt,Ahr and pGal1/10 with Promega Kit
+=='''10/18'''==
+. [[Team:Todai-Tokyo/Protocols/Sequencing|Sequencing]]<BR>
+read the following sequences;<BR>
+*P1-23A+yqit<BR>
+*P1-21B+yqit<BR>
+*p1-16E+yqit<BR>
+*XRE+Gal1+yqit<BR>
+*P2 10F<BR>
+. transformation<BR>
+*P2 10F+yqit+double terminator<BR>
+.[[Team:Todai-Tokyo/Protocols/Miniprep|Miniprep]] <BR>
+*P2 10F <BR>
+. Restriction enzyme digestion<BR>
+*yqit with X and P <BR>
+*XRE+P1 7D with S and P<BR>
+. Gel extraction(after gel electrophoresis)<BR>
+*yqit (processed with restriction enzymes)<BR>
+*P1 7D processed with restriction enzymes)<BR>
+. Restriction enzyme digestion<BR>
+*yqit with P<BR>
+. Restriction enzyme digestion<BR>
+*P1 7D with S and P<BR>
+*P1 22A with E and P<BR>
+. [[Team:Todai-Tokyo/Protocols/Sequencing|Sequencing]]<BR>
+*P1 14L<BR>
+*P1 16E<BR>
+*P1 21B<BR>
+*P1 22A<BR>
+*P2 5F<BR>
+*P2 9H<BR>
+*P2 10F<BR>
+*P2 16E <BR>
+*XRE-Gal1-yqit<BR>
+. Restriction enzyme digestion<BR>
+*P1 7D with S and P<BR>
+. Ligation<BR>
+*XRE and yqit<BR>
+. Transformation<BR>
+*XRE + yqit<BR>
+. restriction enzyme digest<BR>
+*yqit with X and P<BR>
+*P2 10F with S and P<BR>
+=='''10/19'''==
+. colony PCR<BR>
+*P1 7D+XRE+yqit+double terminator<BR>
+. restriction enzyme digest<BR>
+*P2 10F with S and P<BR>
+*yqit with X and P<BR>
+. sequencing<BR>
+*P2 10F<BR>
+. Ligation<BR>
+*P2 10F + yqit<BR>
+. transformation<BR>
+*P2 10F + yqit<BR>
+*yqit<BR>
+. restriction enzyme digest<BR>
+*XRE+P1 7D+yqit with E and P<BR>
+. infusion<BR>
+*yqit + PET<BR>
+. colony PCR<BR>
+*P1 7D+XRE+yqit<BR>
+. colony PCR<BR>
+*P2 10F+yqit<BR>
+=='''10/20~'''==
+. colony PCR<BR>
+*P2 10F+yqit<BR>
+. Smell Test
+. Smell Test<BR>
+*Time for shake culture (each of sample) 15 hours<BR>
+*Negative control has plasmid containing “yqiT + double terminator” (Not including promoter)<BR>
+*Cleansed air is cleansed with active carbon filter.<BR>
+*Equipment<BR>
+**Trade name: ODOR CONCENTRATION METER<BR>
+**Model: XP-329<BR>
+**Serial No. 311059<BR>
+**Manuf. NEW COSMOS ELECTRIC CO,LTD.<BR>
+**Setting: Peak hold<BR>
+*the following values indicate intensity of the smell<BR>
+**cleansed air:200<BR>
+**air:515<BR>
+**normal E.coli: 582<BR>
+**E.coli with constitutive promotor+RBS+yqit+double terminator: 686<BR>
+*yqit successfully worked!!<BR>
+*'''Associate Prof. Kawanishi offered us the yeast, whose chromosome contains AhR and ARNT.
+'''<BR>
 <!--- The Mission, Experiments --->
-{{:Team:Todai-Tokyo/Template}}
+== Result ==
+We have made E.coli which has "Constitutive promoter (strong) - RBS - yqiT - double terminator" in its plasmid.
+<BR>and<BR>
+We will have made yeast which has Ahr and ARNT in its chromosome, and "XRE - Gal1p - yqiT" in its plasmid by 21 October.
+ {{:Team:Todai-Tokyo/Template}}

Team:Todai-Tokyo/Notebook/isoleucine

From 2009.igem.org

Latest revision as of 03:53, 22 October 2009

Contents

Plan

June

6/5

6/6

6/7

6/14

6/21

July

7/5

7/19

7/20

7/27

7/30~8/2

August

8/3

8/7~9

8/12~14

8/15,16

8/19

September

9/15

9/16

9/17

9/19

9/20

9/21

9/22

9/23

9/24

9/25

9/26

9/27

9/29

9/30

October

10/2

10/7

10/9

10/10

10/11

10/12

10/13

10/14

10/15

10/16

10/18

10/19

10/20~

Result