|
|
(One intermediate revision not shown) |
Line 188: |
Line 188: |
| | | |
| <font size="4"><b>Activities relating to the USER<sup>TM</sup> fusion assembly standard</b></font><br><br> | | <font size="4"><b>Activities relating to the USER<sup>TM</sup> fusion assembly standard</b></font><br><br> |
- |
| |
- | <font size="3"><b>Construction of biobrick <a href="http://partsregistry.org/Part:BBa_K194003">BBa_K194003 </a> and yeast plasmid containing biobrick BBa_K194003 for demonstration.</b></font><br>
| |
- | <p align="justify"> Two complentary oligoes were ordered so that they could anneal forming the biobrick BBa_K194003 holding a PacI restriction site flanked by two Nt.BbvCI-sites and with XbaI and SpeI sites in the end for upholding the biobrick standard.</p><br>
| |
- |
| |
- | <p align="justify">TCTAGAGGCTGAGGGTTTAATTAAGACCTCAGCGCAGTGGTGCGATCGCGACACTGCTACTAGT AGATCTCCGACTCCCAAATTAATTCTGGAGTCGCGTCACCACGCTAGCGCTGTGACGATGATCA </p><br>
| |
- |
| |
- | <p align="justify"> The two primers were warmed up to 95 °C on PCR machine and slowly cooled down with 5°C every 5 minutes until it reached 25°C for the two primers to anneal correctly. Then the double stranded oligo was digested with XbaI and SpeI o/n (over night). In the morning the oligo was warmed up to 95 °C again and cooled down as former described. This method was chosen to denature the restriction enzyme before ligation as the oligoes would have been lost in a standard DNA purification.
| |
- | The oligo was inserted into two different plasmids:</p><br>
| |
- |
| |
- | <p align="justify">1. <a href="https://www.lablife.org/ct?f=c&a=showvecinfo&vectorid=3289">pRS416 </a>: in-house yeast plasmid with URA marker that we wished to use to demonstrate that Biobrick <a href="http://partsregistry.org/Part:BBa_K194002">BBa_K194002</a> worked in yeast.<br>
| |
- | 2. <a href="http://partsregistry.org/Part:pSB1A2">pSB1A2</a>: a iGEM plasmid what would be used to send the biobrick to MIT as we cannot send pRS416 with the biobrick due to intellectual property issues.</p><br>
| |
- |
| |
- | <p align="justify">The two plasmids were digested seperately using two enzymes, XbaI (20U) and SpeI (10U). The mixtures were incubated at 37 °C for eight hours after which more enzyme was added to ensure maximum digestion. After an additional two hours of incubation the digested plasmids were dephosphorilised to prevent reanealing during ligation. This was achieved by an <a href="http://www.neb.com/nebecomm/products/productM0289.asp">Antartic Phosphatase treatment</a> (25 U). The DNA was <a href="https://2009.igem.org/Team:DTU_Denmark/protocols#_Toc243890370"> gel-purified</a> and the resulting concentration was determined using fluorometrics (<a href="http://www.invitrogen.com/site/us/en/home/brands/Product-Brand/Qubit.html">The Qubit Quantitation PlatformTM</a> from invitrogen). <a href="https://2009.igem.org/Team:DTU_Denmark/protocols#_Toc243890368">The ligation</a> was performed using T4-DNA ligase using a 3:1 ratio of fragment to vector and 9 ng DNA in total at a volume of 20 µl according to the manufactors recommendations. The actual ligation was carried out on a PCR machine for 1½ hours shifting the temperature from 10 °C to 30 °C at 30 second intervals as desribed by [1]. The final product was finally <a href="https://2009.igem.org/Team:DTU_Denmark/protocols#_Toc243890372"> chemically transformed </a> into competent E coli cells.</p><br>
| |
- |
| |
- | <font size="3"><b>Selection of transformants</b></font><br>
| |
- | <p align="justify">
| |
- | Ten random colonies were picked for overnight growth in liquid media. The next day the plasmids were <a href="https://2009.igem.org/Team:DTU_Denmark/protocols#_Toc243890369"> purified</a> and <a href="https://2009.igem.org/Team:DTU_Denmark/protocols#_Toc243890364"> digestion</a> were performed with PacI and XbaI to verify the presence of the biobrick. This was done as the presence of the biobrick is introduced a PacI site in the vector. The XbaI digestion was done to ensure that the biobrick had been inserted with the right directionality.
| |
- | </p><br>
| |
- |
| |
- | </html>
| |
- | [[image:Fig1_gelpicture.JPG|500px|thumb|center|]]
| |
- | <html>
| |
- | <font size="1">Figure 1. Left: PacI restriction assay, BBa_K194003 insertion into pRS416. Restriction performed on ten randomly picked, o/n grown and plasmid purified samples. Samples are run on a 1 % agarose gel. Digestion should leave a single band at approxiamately 6 kb. Colonies 5 and 9 are believed to contain the correct plasmid. Right: The ladder used in the corresponding experiment, Hypper Ladder 1.</font><br><br>
| |
- |
| |
- | <font size="3"><b> Demonstration of BBa_K194003</b></font><br>
| |
- | <p align="justify">
| |
- | From the gel it was seen that the BBa_K194003 had been inserted correctly into pRS416. Now this was used to demonstrate that biobrick <a href="http://partsregistry.org/Part:BBa_K194002"> BBa_K194002</a> was functional. This was done by opening the USER cassette in BBa_K194003 with PacI and Nt.BbvCI, purifying the backbone from gel and adding two PCR fragments:</p><br>
| |
- | <p align="justify">1. The constitutive TEF promoter (400bp) using the primers BGHA200/370<br>
| |
- | 2. Biobrick <a href="http://partsregistry.org/Part:BBa_K194002"> BBa_K194002</a> (1500bp) using the primers BGHA371/372</p><br>
| |
- |
| |
- | </html>
| |
- | [[image:Fig2_USERfusion.JPG|500px|thumb|center|]]
| |
- | <html>
| |
- | <font size="1">Figure 2. The cloning strategy for demonstrating that biobricks BBa_K194002 works. Two PCR products were fused using USER fusion and inserted into the pRS416 backbone by USER cloning.</font><br><br>
| |
- |
| |
- | <p align="justify">After treatment with USERTM mix, the mixture was <a href="https://2009.igem.org/Team:DTU_Denmark/protocols#_Toc243890372"> transformed </a>into E. coli.</p>
| |
- |
| |
- | <font size="3"><b>Verification</b></font><br>
| |
- | <p align="justify">Following selection of transformants and overnight liquid cultures the plasmids was <a href="https://2009.igem.org/Team:DTU_Denmark/protocols#_Toc243890369"> purified </a>. The plasmids were linearized using AsiSI, which is also included in the <a href="http://partsregistry.org/Part:BBa_K194003"> BBa_K194003</a>. Plasmids holding the fusion of TEF and <a href="http://partsregistry.org/Part:BBa_K194002"> BBa_K194002</a> will show to be 2kb longer than the ones without.
| |
- | The presence of the gene were only verified by PCR of the genes inserted.</p><br>
| |
- |
| |
- | <font size="3"><b>Transformation into yeast</b></font><br>
| |
- | <p align="justify">Yeast (CEN PK 113 5D (Ura-)) was <a href="https://2009.igem.org/Team:DTU_Denmark/protocols#_Toc243890373"> transformed</a> with this plasmid using the Ura marker present on pRS416
| |
- | Yeast was also transformed with pSC011 kindly provided by Simon Carlsen, CMB containing the sequence from BBa_K194001 under the constitutive expression of the TEF promoter. pSC011 holds the same promoter and terminator as the pRS416 holding the <a href="http://partsregistry.org/Part:BBa_K194003"> BBa_K194003</a> and can therefore be used to analyze the difference of the addition of the Cln2 degradation signal.
| |
- | </p><br>
| |
- |
| |
- | <font size="3"><b>BioLector fermentation</b></font><br>
| |
- | <p align="justify">To characterize the yeast strains that we have constructed in the project we used the <a href="http://www.bioresearchonline.com/product.mvc/High-Throughput-Screening-System-BioLector-0002"> BioLector machine </a> kindly provided by the Center for Biological Sequence Analysis at DTU.
| |
- | We characterized:<br>
| |
- | 1. Wildtype as background: CEN PK 113 7D without any auxotrophic marker was chosen. If there is GFP fluorescence of the wildtype this needs to be accounted for.<br>
| |
- | 2. Our <a href="https://2009.igem.org/Team:DTU_Denmark/genetic_design"> Redoxilater construct</a>: This construct holds the redoxilator sensor controlling the expression of <a href="http://partsregistry.org/Part:BBa_K194002"> BBa_K194002</a>. This plasmid was transformed into CEN PK 113 5D (Ura-).<br>
| |
- | 3. Leaky construct: To check whether the redoxilator actually induces expression of <a href="http://partsregistry.org/Part:BBa_K194002"> BBa_K194002</a> or our minimal promoter is simply leaky. This plasmid was transformed into CEN PK 113 5D (Ura-).<br>
| |
- | 4. pSC011: Demonstration of <a href="http://partsregistry.org/Part:BBa_K194001"> BBa_K194001</a>. This plasmid was transformed into CEN PK 113 5D (Ura-).<br>
| |
- | 5. pRS416c: Demonstration of <a href="http://partsregistry.org/Part:BBa_K194002"> BBa_K194002</a>. This plasmid was transformed into CEN PK 113 5D (Ura-).</p><br>
| |
- |
| |
- | <p align="justify">To minimize the background fluorescence from the media, synthetic complete without riboflavin and folic acid was used, since they have been reported to be fluorescent [2]. <br>
| |
- | The cells were grown in this media overnight to reach an OD high enough for inoculation of the microtiter plate for the BioLector.
| |
- | The cells were inoculated in the mirotiterplate in 1ml media with an OD of 0.15 with the following carbon sources<br>
| |
- | 1.glucose (20g/l)<br>
| |
- | 2.ethanol (15,7 g/l = same cmol as glucose)<br>
| |
- | 3.galactose (20g/l = same cmol as glucose)<br>
| |
- | 4.glucose (10g/l) + galactose (10g/l) – so we should see an diauxic shift over the course of the experiment<br>
| |
- | This experiment ran for 3 days while the BioLector keept the microtiterplate stirring and measured OD and GFP levels every 3rd minut.</p><br><br>
| |
- |
| |
- |
| |
- | <font size="3"><b>References</b></font><br>
| |
- | <p align="justify"> [1] Lund, A. H., M. Duch, and F. S. Pedersen. 1996. Increased cloning efficiency by temperature-cycle ligation. Nucleic Acids Res. 24:800-801. doi:l50400</p><br>
| |
- | <p align="justify"> [2] Mark A. Sheff and Kurt S. Thorn. 2004. Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast 24:800-801. doi:10.1002/yea.1130</p><br>
| |
- |
| |
- |
| |
- |
| |
- |
| |
- |
| |
| | | |
| <!-- | | <!-- |