Team:NYMU-Taipei/Project/Removal

From 2009.igem.org

(Difference between revisions)
(→References)
 
(10 intermediate revisions not shown)
Line 4: Line 4:
== Motivation ==
== Motivation ==
-
Our engineered ''E. coli'' (ViroCatcher) is designed to trap the viruses and successfully prevents viruses spreading out in our bodies. If we remove ViroCatcher, viruses will be cleaned up together as well with our ViroCatcher. To remove viruses, we must work out a method for E. coli removal.
+
Our engineered ''E. coli'' (ViroCatcher) is designed to trap the viruses and successfully prevents viruses spreading out in our bodies. If we remove ViroCatcher, viruses will be cleaned up together as well with our ViroCatcher. To remove viruses, we must work out a method for ''E. coli'' removal.
-
For removing ViroCatcher, we have two choices. One is to let it suicide, and the other is to let it be removed by our immune cells (like how dead cells are removed). Before removal, we must be sure that the intended work is done, and viruses must be removed at the same time. Therefore, we designed a removal gene and included it in ViroCatcher. If ViroCatcher gets the sinal of binding with viral proteins, it will turn on the removal gene and be removed.  
+
For removing ViroCatcher, we have two choices. One is to let it suicide, and the other is to let it be removed by our immune cells (like how dead cells are removed). Before removal, we must be sure that the intended work is done, and viruses must be removed at the same time. Therefore, we designed a removal gene and included it in ViroCatcher. If ViroCatcher gets the signal of binding with viral proteins, it will turn on the removal gene and be removed.  
-
Furthermore, if ViroCatcher did not catch anything, we still have to design a mechanism to let our ViroCatcher express the removal gene and remove itself. Otherwise, bacteria will fill our blood vessel and block our blood flow.
+
Furthermore, if ViroCatcher did not catch anything, we still have to design a mechanism to let our ViroCatcher express the removal gene and remove itself. Otherwise, bacteria will fill our blood vessels and block blood flow.
== Selecting the Removal Gene ==
== Selecting the Removal Gene ==
Line 27: Line 27:
=== Macrophage Inflammatory Proteins ===
=== Macrophage Inflammatory Proteins ===
<br>[[image:NYMU 2.jpg]]
<br>[[image:NYMU 2.jpg]]
-
* Macrophage Inflammatory Proteins (MIP) belong to the family of chemotactic cytokines known as chemokines. In humans, there are two major forms, MIP-1α and MIP-1β that are now officially named CCL3 and CCL4 respectively. Both are major factors produced by macrophages after they are stimulated with bacterial endotoxins[1]. They activate human granulocytes (neutrophils, eosinophils and basophils) which can lead to acute neutrophilic inflammation. They also induce the synthesis and release other pro-inflammatory cytokines such as interleukin 1 (IL-1), IL-6 and TNF-α from fibroblasts and macrophages. The genes for CCL3 and CCL4 are both located on human chromosome 17[2].
+
* Macrophage Inflammatory Proteins (MIP) belong to the family of chemotactic cytokines known as chemokines[13]. In humans, there are two major forms, MIP-1α and MIP-1β that are now officially named CCL3 and CCL4 respectively. Both are major factors produced by macrophages after they are stimulated with bacterial endotoxins[1]. They activate human granulocytes (neutrophils, eosinophils and basophils) which can lead to acute neutrophilic inflammation. They also induce the synthesis and release other pro-inflammatory cytokines such as interleukin 1 (IL-1), IL-6 and TNF-α from fibroblasts and macrophages. The genes for CCL3 and CCL4 are both located on human chromosome 17[2].
-
** Chemokine (C-C motif) ligand 3, also known as CCL3, is a human gene. Macrophage inflammatory protein-1 is a so-called monokine that is involved in the acute inflammatory state in the recruitment and activation of polymorphonuclear leukocytes (Wolpe et al., 1988). Sherry et al. (1988) demonstrated 2 protein components of MIP1, called by them alpha and beta[supplied by OMIM][1].
+
** Chemokine (C-C motif) ligand 3, also known as CCL3, is a human gene. Macrophage inflammatory protein-1 is a so-called monokine that is involved in the acute inflammatory state in the recruitment and activation of polymorphonuclear leukocytes (Wolpe et al., 1988). Sherry et al. (1988) demonstrated 2 protein components of MIP1, called by them alpha and beta[supplied by OMIM][1][10].
-
** CCL4 is a CC chemokine with specificity for CCR5 receptors. It is a chemoattractant for natural killer cells, monocytes and a variety of other immune cell [2]. CCL4 is a major HIV-suppressive factor produced by CD8+ T cells [3]. Perforin-low memory CD8+ T cells that normally synthesize MIP-1-beta [4].<br>[[image:Chemokine_concentration_chemotaxis.jpg]]<br>
+
** CCL4 is a CC chemokine with specificity for CCR5 receptors[11]. It is a chemoattractant for natural killer cells, monocytes and a variety of other immune cell [2]. CCL4 is a major HIV-suppressive factor produced by CD8+ T cells [3]. Perforin-low memory CD8+ T cells that normally synthesize MIP-1-beta [4].<br>[[image:Chemokine_concentration_chemotaxis.jpg]]<br>
-
** The main function of chemokines is the induction of cell migration. Cells will move toward the direction of increment of continuous chemokine concentration gradient. In other words, cells migrate toward the source of chemokine. For example, the induction of lymphocyte to the lymphatic node is due to chemokines. Apply this thinking to our design, we want to use CCL3 and CCL4, or chemokines for macrophages, to assemble macrophages around ViroCatcher. It will raise the possibility that macrophages recognize the proteins of viruses and swallow the ''E. coli'' whole.<br> But there's a problem. CCL3 and CCL4 is two kinds of ligands of receptors of antibody. If we use this design, ViroCatchers will bind with each other, aggregate together, and block our blood vessels. So unfortunately, this design still cannot be used as the removal circuit.
+
** The main function of chemokines is the induction of cell migration[12]. Cells will move toward the direction of increment of continuous chemokine concentration gradient. In other words, cells migrate toward the source of chemokine. For example, the induction of lymphocyte to the lymphatic node is due to chemokines. Apply this thinking to our design, we want to use CCL3 and CCL4, or chemokines for macrophages, to assemble macrophages around ViroCatcher. It will raise the possibility that macrophages recognize the proteins of viruses and swallow the ''E. coli'' whole.<br> But there's a problem. CCL3 and CCL4 is two kinds of ligands of receptors of antibody. If we use this design, ViroCatchers will bind with each other, aggregate together, and block our blood vessels. So unfortunately, this design still cannot be used as the removal circuit.
=== Expression of LPS ===
=== Expression of LPS ===
Line 98: Line 98:
=== Removal for Binding Viruses ===
=== Removal for Binding Viruses ===
-
Mentioned before at [[Team:NYMU-Taipei/Project/Signal Transduction|Signal]], an output promoter called ompC promoter will be inactivate through the way of the signal transduction of binding with viruses. Obviously, if we use a promoter inhibited by the ompC promoter output protein , when ompC inactivated, the gene we want to express will tun on. Therefore, we come out this design:  
+
Mentioned before at [[Team:NYMU-Taipei/Project/Signal Transduction|Signal]], an output promoter called ompC promoter will be inactivate through the way of the signal transduction of binding with viruses. If we use a promoter inhibited by the ompC promoter output protein, when ompC inactivated, the gene we want to express will tun on. Therefore, we come out this design:  
-
[[image:NYMU 5.jpg]](this picture must be changed)
+
[[image:NYMU 5.jpg]]
-
Use the tetR promoter as a switch for the msbB gene. If the receptor catches a virus, TetR protein absent, tetR promoter will turn on msbB gene, then LPS will be expressed and it will attract the immune system. ViroCatcher will be cleaned up by immune cells together with the trapped viruses.
+
Use the tetR promoter as a switch for the msbB gene. If the receptor catches a virus, TetR protein will stop expressing, and the pTet promoter will turn on msbB gene, then LPS will be expressed and it will attract the immune system. ViroCatcher will then be cleaned up by immune cells together with the trapped viruses.
=== Timed Removal ===
=== Timed Removal ===
Line 120: Line 120:
== Experiment Results ==
== Experiment Results ==
 +
 +
==== Lab note ====
 +
[[Team:NYMU-Taipei/Project/Lab Note]]
 +
====Protocol of Promoter Strength Testing====
====Protocol of Promoter Strength Testing====
#extract the Biobrick promoter
#extract the Biobrick promoter
Line 130: Line 134:
#characterize the basal level expression without any inducer or repressor interaction
#characterize the basal level expression without any inducer or repressor interaction
-
==== Lab note ====
+
==== Promoter Strength Testing Reporting Assays ====
-
[[Team:NYMU-Taipei/Project/Lab Note]]
+
[[Team:NYMU-Taipei/Project/Promoter Strength Testing|Reporting Assay of Promoter Strength Testing]]
==== Oscillator Modeling ====
==== Oscillator Modeling ====
[[Team:NYMU-Taipei/Project/Removal/Modeling|Modeling]]
[[Team:NYMU-Taipei/Project/Removal/Modeling|Modeling]]
-
 
-
==== Promoter Strength Testing ====
 
-
[[Team:NYMU-Taipei/Project/Promoter Strength Testing|Reporting Assay of Promoter Strength Testing]]
 
====Colony PCR Gel Pictures====
====Colony PCR Gel Pictures====
Line 165: Line 166:
====Graph of Experiments====
====Graph of Experiments====
-
{| border="1"
 
-
|  [[image:NYMU Promoter Strength Test-1.png|640px]]  ||  '''Figure 1.''' This is the relative promoter strength to pTet, which was tested by measuring the flurorescence with an ELISA Reader. pLux and pLas are inducible promoters, so their measured promoter strength is their basal level strength.
 
-
 
-
|}
 
{| border="1"
{| border="1"
-
|  [[image:NYMU Chart (Lr2tEr7t) without line-1.png|640px]]  || '''Figure 2.''' This is the component testing with the activator CII at the downstream of pLac inducing pRE to express GFP.
+
|  [[image:NYMU Chart (Lr2tEr7t) without line-1.png|640px]]  || '''Figure 1.''' This is the component testing with the activator CII at the downstream of pLac inducing pRE to express GFP.
|}
|}
{| border="1"
{| border="1"
-
|  [[image:NYMU Chart (oscillator) 3-1.png|640px]]  || ''' Figure 3.''' This is the measurement by using an ELISA reader, graphing Fluorescence versus O.D of the Time Delay device(I) ({{:Team:NYMU-Taipei/BBa|K195622}})
+
|  [[image:NYMU Chart (oscillator) 3-1.png|640px]]  || ''' Figure 2.''' This is the measurement by using an ELISA reader, graphing Fluorescence versus O.D of the Time Delay device(I) ({{:Team:NYMU-Taipei/BBa|K195622}})
|}
|}
Line 195: Line 192:
<br>[6]http://partsregistry.org/Part:BBa_K145230<br>
<br>[6]http://partsregistry.org/Part:BBa_K145230<br>
[7] [http://en.wikipedia.org/wiki/Lipopolysaccharide#Lipid_A/ LPS]
[7] [http://en.wikipedia.org/wiki/Lipopolysaccharide#Lipid_A/ LPS]
-
<br>[8] [[File:NYMU LPS濃度對於細胞CD14的表現的影響.pdf]]
+
<br>[8] ZHANG Hai-yu, SHAN Yu-xing, WU Ning, CHEN Guang-wei '''effect of LPS with different doses on CD14 surface expression in J774A.1 cell line'''
<br>[9]Sudipta Tripathi, David Bruch and Dilip S Kittur*:'''Ginger extract inhibits LPS induced macrophage activation and function.'''2008 Tripathi et al; licensee BioMed Central Ltd.BMC Complementary and Alternative Medicine 2008, 8:1 doi:10.1186/1472-6882-8-1
<br>[9]Sudipta Tripathi, David Bruch and Dilip S Kittur*:'''Ginger extract inhibits LPS induced macrophage activation and function.'''2008 Tripathi et al; licensee BioMed Central Ltd.BMC Complementary and Alternative Medicine 2008, 8:1 doi:10.1186/1472-6882-8-1
 +
<br>[10][http://en.wikipedia.org/wiki/CCL3 Chemoattractant of CCL3]
 +
<br>[11][http://en.wikipedia.org/wiki/CCL4 Chemoattractant of CCL4]
 +
<br>[12][http://en.wikipedia.org/wiki/Chemokine Chemokine]
 +
<br>[13][http://en.wikipedia.org/wiki/Macrophage_Inflammatory_Protein function of Macrophage Inflammatory Protein]
{{:Team:NYMU-Taipei/Footer}}
{{:Team:NYMU-Taipei/Footer}}

Latest revision as of 02:53, 22 October 2009

NYMU Wt--rev.png

Contents

Motivation

Our engineered E. coli (ViroCatcher) is designed to trap the viruses and successfully prevents viruses spreading out in our bodies. If we remove ViroCatcher, viruses will be cleaned up together as well with our ViroCatcher. To remove viruses, we must work out a method for E. coli removal.

For removing ViroCatcher, we have two choices. One is to let it suicide, and the other is to let it be removed by our immune cells (like how dead cells are removed). Before removal, we must be sure that the intended work is done, and viruses must be removed at the same time. Therefore, we designed a removal gene and included it in ViroCatcher. If ViroCatcher gets the signal of binding with viral proteins, it will turn on the removal gene and be removed.

Furthermore, if ViroCatcher did not catch anything, we still have to design a mechanism to let our ViroCatcher express the removal gene and remove itself. Otherwise, bacteria will fill our blood vessels and block blood flow.

Selecting the Removal Gene

We had considered the following three removal genes. In the end, we chose to use the expression of LPS.

Cell Suicide Generator


NYMU 1.jpg

  • The CcdB protein, constitutively expressed by P1010, is lethal to most of the BioBrick cell strains, only DB3.1 is resistant[5]. A hybrid promoter controls the production of LuxR and ccdB. The promoter is activated by HSL-LuxR complex and repressed by P22 c2. The LuxR coding region is preceded by a strong RBS and followed by a bad terminator (60% efficiency). This means there is read through into the ccdB coding region which can be translated from a very weak RBS. If the P22 c2 repressor is absent, there should be a strong enough LuxR background to allow autoactivation if HSL is added. The amound of ccdB should be sublethal as long as there is no significant activation[6].

The most simple way to get rid of the E. coli is to let it suicide, however, there are many viruses that have been caught on the surface that we have to pay attention to. If ViroCatcher dies or explodes, the trapped viruses will spread into our bloodstream again. Cell Suicide Generator seems not to be a good choice.

Cell suicide generator

R0034
NYMU icon R.png		 ccdB
K145151
NYMU icon C.png
B0010
NYMU icon T.png
B0012
NYMU icon T.png

Macrophage Inflammatory Proteins


NYMU 2.jpg

  • Macrophage Inflammatory Proteins (MIP) belong to the family of chemotactic cytokines known as chemokines[13]. In humans, there are two major forms, MIP-1α and MIP-1β that are now officially named CCL3 and CCL4 respectively. Both are major factors produced by macrophages after they are stimulated with bacterial endotoxins[1]. They activate human granulocytes (neutrophils, eosinophils and basophils) which can lead to acute neutrophilic inflammation. They also induce the synthesis and release other pro-inflammatory cytokines such as interleukin 1 (IL-1), IL-6 and TNF-α from fibroblasts and macrophages. The genes for CCL3 and CCL4 are both located on human chromosome 17[2].
    • Chemokine (C-C motif) ligand 3, also known as CCL3, is a human gene. Macrophage inflammatory protein-1 is a so-called monokine that is involved in the acute inflammatory state in the recruitment and activation of polymorphonuclear leukocytes (Wolpe et al., 1988). Sherry et al. (1988) demonstrated 2 protein components of MIP1, called by them alpha and beta[supplied by OMIM][1][10].
    • CCL4 is a CC chemokine with specificity for CCR5 receptors[11]. It is a chemoattractant for natural killer cells, monocytes and a variety of other immune cell [2]. CCL4 is a major HIV-suppressive factor produced by CD8+ T cells [3]. Perforin-low memory CD8+ T cells that normally synthesize MIP-1-beta [4].
      Chemokine concentration chemotaxis.jpg
    • The main function of chemokines is the induction of cell migration[12]. Cells will move toward the direction of increment of continuous chemokine concentration gradient. In other words, cells migrate toward the source of chemokine. For example, the induction of lymphocyte to the lymphatic node is due to chemokines. Apply this thinking to our design, we want to use CCL3 and CCL4, or chemokines for macrophages, to assemble macrophages around ViroCatcher. It will raise the possibility that macrophages recognize the proteins of viruses and swallow the E. coli whole.
      But there's a problem. CCL3 and CCL4 is two kinds of ligands of receptors of antibody. If we use this design, ViroCatchers will bind with each other, aggregate together, and block our blood vessels. So unfortunately, this design still cannot be used as the removal circuit.

Expression of LPS


NYMU 3.jpg

  • In the Chassis part of our project, we have mentioned that ViroCatcher is a LPS[7] knock-out stain, in order to avoid the detection by the immune system. Therefore, if we re-express LPS, our ViroCatcher will have the ability to attract immune cells and let immune system macrophage remove ViroCatcher itself along with the viruses bound to the surface[8][9]. To express LPS again in ViroCatcher, we just have to turn on msbB gene.


Homo sapiens chemokine (C-C motif) ligand 3, mRNA (cDNA clone MGC:198546 IMAGE:9054485), complete cds[http://www.ncbi.nlm.nih.gov/nuccore/219521699] 

       1 acactcgagc ccacattccg tcacctgctc agaatcatgc aggtctccac tgctgccctt
      61 gctgtcctcc tctgcaccat ggctctctgc aaccagttct ctgcatcact tgctgctgac
     121 acgccgaccg cctgctgctt cagctacacc tcccggcaga ttccacagaa tttcatagct
     181 gactactttg agacgagcag ccagtgctcc aagcctggtg tcatcttcct aaccaagcga
     241 agccggcagg tctgtgctga ccccagtgag gagtgggtcc agaaatatgt cagcgacctg
     301 gagctgagtg cctgaggggt ccagaagctt cgaggcccag cgacctcggt gggcccagtg
     361 gggaggagca ggagcctgag ccttgggaac atgcgtgtga cctccacagc tacctcttct
     421 atggactggt tgttgccaaa cagccacact gtgggactct tcttaactta aattttaatt
     481 tatttatact atttagtttt tgtaatttat tttcgatttc acagtgtgtt tgtgattgtt
     541 tgctctgaga gttccccctg tcccctc


Homo sapiens chemokine (C-C motif) ligand 4, mRNA (cDNA clone MGC:126026 IMAGE:40032172), complete cds [http://www.ncbi.nlm.nih.gov/nuccore/74355495]

       1 cacagctggg ttctgaagct tctgagttct gcagcctcac ctctgagaaa acctcttttc
      61 caccaatacc atgaagctct gcgtgactgt cctgtctctc ctcatgctag tagctgcctt
     121 ctgctctcca gcgctctcag caccaatggg ctcagaccct cccaccgcct gctgcttttc
     181 ttacaccgcg aggaagcttc ctcgcaactt tgtggtagat tactatgaga ccagcagcct
     241 ctgctcccag ccagctgtgg tattccaaac caaaagaagc aagcaagtct gtgctgatcc
     301 cagtgagacc tgggtccagg agtacgtgta tgacctggaa ctgaactgag ctgctcagag
     361 acaggaagtc ttcagggaag gtcacctgag cccggatgct tctccatgag acacatctcc
     421 tccatactca ggactcctct ccgcagttcc tgtcccttct cttaatttaa tcttttttat
     481 gtgccgtgtt attgtattag

Escherichia coli K-12 substr. MG1655 msbB gene sequence[http://biocyc.org/ECOLI/sequence-rc?type=GENE&object=EG10614] 

       1 atgGAAACGA AAAAAAATAA TAGCGAATAC ATTCCTGAGT TTGATAAATC CTTTCGCCAC
      61 CCGCGCTACT GGGGAGCATG GCTGGGCGTA GCAGCGATGG CGGGTATCGC TTTAACGCCG
     121 CCAAAGTTCC GTGATCCCAT TCTGGCACGG CTGGGACGTT TTGCCGGACG ACTGGGAAAA
     181 AGCTCACGCC GTCGTGCGTT AATCAATCTG TCGCTCTGCT TTCCAGAACG TAGTGAAGCT
     241 GAACGCGAAG CGATTGTTGA TGAGATGTTT GCCACCGCGC CGCAAGCGAT GGCAATGATG
     301 GCTGAGTTGG CAATACGCGG GCCGGAGAAA ATTCAGCCGC GCGTTGACTG GCAAGGGCTG
     361 GAGATCATCG AAGAGATGCG GCGTAATAAC GAGAAAGTTA TCTTTCTGGT GCCGCACGGT
     421 TGGGCCGTCG ATATTCCTGC CATGCTGATG GCCTCGCAAG GGCAGAAAAT GGCAGCGATG
     481 TTCCATAATC AGGGCAACCC GGTTTTTGAT TATGTCTGGA ACACGGTGCG TCGTCGCTTT
     541 GGCGGTCGTC TGCATGCGAG AAATGACGGT ATTAAACCAT TCATCCAGTC GGTACGTCAG
     601 GGGTACTGGG GATATTATTT ACCCGATCAG GATCATGGCC CAGAGCACAG CGAATTTGTG
     661 GATTTCTTTG CCACCTATAA AGCGACGTTG CCCGCGATTG GTCGTTTGAT GAAAGTGTGC
     721 CGTGCGCGCG TTGTACCGCT GTTTCCGATT TATGATGGCA AGACGCATCG TCTGACGATT
     781 CAGGTGCGCC CACCGATGGA TGATCTGTTA GAGGCGGATG ATCATACGAT TGCGCGGCGG
     841 ATGAATGAAG AAGTCGAGAT TTTTGTTGGT CCGCGACCAG AACAATACAC CTGGATACTA
     901 AAATTGCTGA AAACTCGCAA ACCGGGCGAA ATCCAGCCGT ATAAGCGCAA AGATCTTTAT
     961 CCCATCAAAT AA

*Primer Design
gaattcgcggccgcttctag atgGAAACGAAAAAAAATAATAGCGAA 55deg GC:26% length:27bp
ctgcagcggccgctactagta TTATTTGATGGGATAAAGATCTTTGC 54deg GC:31% length:26bp

Goals

There are two specific aims for the removal part. One is ViroCatcher binding to viruses and being removed, and the other is self-removal after a specified period of time. Since the gene msbB of LPS is knocked out, if there is an insertion of msbB gene into the plasmid, then msbB gene and the LPS functions will express. Once the LPS is expressed, the immune system is turned on and ViroCatcher is swallowed by macrophage through phagocytosis along with many viruses attached.

If the machine catches nothing, it is still necessary to remove the E. coli machine after a period of time. This period of time should be controlled precisely, otherwise the machine will be removed before it catches any viruses. We compose an oscillator and a toggle switch together as our timer.

Removal Design

Removal for Binding Viruses

Mentioned before at Signal, an output promoter called ompC promoter will be inactivate through the way of the signal transduction of binding with viruses. If we use a promoter inhibited by the ompC promoter output protein, when ompC inactivated, the gene we want to express will tun on. Therefore, we come out this design:

NYMU 5.jpg

Use the tetR promoter as a switch for the msbB gene. If the receptor catches a virus, TetR protein will stop expressing, and the pTet promoter will turn on msbB gene, then LPS will be expressed and it will attract the immune system. ViroCatcher will then be cleaned up by immune cells together with the trapped viruses.

Timed Removal

If the receptor does not catch anything, the ompC promoter will not be turned on, and the removal gene will not be expressed, so ViroCatcher cannot be removed when it catches nothing. How to make sure our Viro Catcher is removed from the human body? We worked out this set of design:

NYMU 4.jpg

This circuit is composed of three parts - oscillator, toggle switch, and remover. Oscillator and toggle switch work together as the timer. The oscillator is consist of two genes. One gene activate the other gene and get a negative feedback. When output proteins of oscillator reach a threshold that preset, then the promoter of toggle switch will be activate, and output protein of toggle switch will suddenly activate the promoter of remover.

The following picture shows how the timer works by modeling:
NYMU threshold.png

We stop the timer by setting a threshold. As the protein produced by the oscillator promoter accumulates and reaches a certain threshold, the output promoter activity would suddenly change. This output promoter is connected to removal gene msbB. Therefore, at the time that timer stops, LPS expressed and attract macrophages.

This setting can control the micromachine to trigger an immune response after a period of time. This period of time is controlled precisely, otherwise ViroCatcher will be removed too fast or too late. Anyway, no matter what kind of situation, our ViroCatcher will be removed.

Experiment Results

Lab note

Team:NYMU-Taipei/Project/Lab Note

Protocol of Promoter Strength Testing

  1. extract the Biobrick promoter
  2. combine it with GFP generator [http://partsregistry.org/Part:BBa_I13504 BBa_I13504] with the promoter and then transform
  3. colony PCR
  4. liquid incubation and plasmid extraction
  5. measure the amount of fluroresence by using an ELISA reader with a 96 well plate
  6. data collection
  7. using pTet as the standard having the value of 1
  8. characterize the basal level expression without any inducer or repressor interaction

Promoter Strength Testing Reporting Assays

Reporting Assay of Promoter Strength Testing

Oscillator Modeling

Modeling

Colony PCR Gel Pictures

NYMU Gel 1.png Figure 1. 1.pTet with generator ([http://partsregistry.org/Part:BBa_K195610 BBa_K195610]) 2.pLac with generator ([http://partsregistry.org/Part:BBa_K195612 BBa_K195612]) 3.pRE with generator ([http://partsregistry.org/Part:BBa_K195609 BBa_K195609])
NYMU Gel 2-1.png Figure 2. L1~L2 pTet with generator ([http://partsregistry.org/Part:BBa_K195610 BBa_K195610]) L3~L4 pPenI with generator ([http://partsregistry.org/Part:BBa_K195611 BBa_K195611]) L5~L6 pLac with generator ([http://partsregistry.org/Part:BBa_K195612 BBa_K195612])
NYMU Gel 5-1.png Figure 3. L1~L4 pLuxR with generator ([http://partsregistry.org/Part:BBa_K195615 BBa_K195615]) L5 pCI with generator ([http://partsregistry.org/Part:BBa_K195613 BBa_K195613]) L6~L8 pLasR with generator ([http://partsregistry.org/Part:BBa_K195616 BBa_K195616])
NYMU Gel 4-1.png Figure 4. L1~L4 p22 with generator ([http://partsregistry.org/Part:BBa_K195614 BBa_K195614]) L5~L8 pLuxR with generator ([http://partsregistry.org/Part:BBa_K195615 BBa_K195615])
NYMU Gel 6-1.png Figure 5. L1~L6 pRE with PenI repressor gene ([http://partsregistry.org/Part:BBa_K195621 BBa_K195621])

Graph of Experiments

NYMU Chart (Lr2tEr7t) without line-1.png Figure 1. This is the component testing with the activator CII at the downstream of pLac inducing pRE to express GFP.
NYMU Chart (oscillator) 3-1.png Figure 2. This is the measurement by using an ELISA reader, graphing Fluorescence versus O.D of the Time Delay device(I) ([http://partsregistry.org/Part:BBa_K195622 BBa_K195622])

msbB gene PCR Results

NYMU MsbB.png Figure 1. This gel picture shows the result of PCR by L1~L5 is the length of msbB gene. L6 is negative control.

References

[1]Sang Chin Lee,† Mary E. Brummet,* Syed Shahabuddin,* Thasia G. Woodworth,‡ Steve N. Georas,* Kristin M. Leiferman,§ Steven C. Gilman,‡ Cristiana Stellato,* Ron P. Gladue,‡ Robert P. Schleimer,* and Lisa A. Beck2*:Cutaneous Injection of Human Subjects with Macrophage Inflammatory Protein-1a Induces Significant Recruitment of Neutrophils and Monocytes1.The Journal of Immunology, 2000, 164: 3392–3401.
[2]D. HALLER,1,2* S. BLUM,3 C. BODE,1 W. P. HAMMES,2 AND E. J. SCHIFFRIN3:Activation of Human Peripheral Blood Mononuclear Cells by Nonpathogenic Bacteria In Vitro: Evidence of NK Cells as Primary Targets.2000, American Society for Microbiology
[3]F. Porcheray,* S. Viaud,* A.-C. Rimaniol,‡C. Léone,* B. Samah,*N. Dereuddre-Bosquet,‡D.Dormont*†and G. Gras*:Macrophage activation switching: an asset for the resolution of inflammation.doi:10.1111/j.1365-2249.2005.02934.x
[4]A. Hrabák1, T. Bajor2 and I. Csuka1:The effect of various infl ammatory agents on the phagocytosis and cytokine profi le of mouse and rat macrophages.Infl amm. res. 57 (2008) 75–831023-3830/08/020075-9DOI 10.1007/s00011-007-7057-7
[5]http://partsregistry.org/wiki/index.php/Part:BBa_P1010
[6]http://partsregistry.org/Part:BBa_K145230
[7] [http://en.wikipedia.org/wiki/Lipopolysaccharide#Lipid_A/ LPS]
[8] ZHANG Hai-yu, SHAN Yu-xing, WU Ning, CHEN Guang-wei effect of LPS with different doses on CD14 surface expression in J774A.1 cell line
[9]Sudipta Tripathi, David Bruch and Dilip S Kittur*:Ginger extract inhibits LPS induced macrophage activation and function.2008 Tripathi et al; licensee BioMed Central Ltd.BMC Complementary and Alternative Medicine 2008, 8:1 doi:10.1186/1472-6882-8-1
[10][http://en.wikipedia.org/wiki/CCL3 Chemoattractant of CCL3]
[11][http://en.wikipedia.org/wiki/CCL4 Chemoattractant of CCL4]
[12][http://en.wikipedia.org/wiki/Chemokine Chemokine]
[13][http://en.wikipedia.org/wiki/Macrophage_Inflammatory_Protein function of Macrophage Inflammatory Protein]

Retrieved from "http://2009.igem.org/Team:NYMU-Taipei/Project/Removal"