Team:Calgary/28 May 2009

From 2009.igem.org

(Difference between revisions)
(New page: {{Template:CalgaryHeader}} <html> <body> <style> p{ padding: 5px 5px 5px 5px; } .heading{ font: century gothic; color: #ffffff; } .name{ font: century gothic; color: #ffffff; padding: ...)
 
(28 intermediate revisions not shown)
Line 52: Line 52:
text-align: justify;
text-align: justify;
}
}
 +
 +
.center {
 +
text-align: center;
 +
display: block;
 +
margin-left: auto;
 +
margin-right: auto;
 +
}
 +
</style>
</style>
Line 61: Line 69:
<td width="210" rowspan=30 bgcolor="#414141" valign="top">
<td width="210" rowspan=30 bgcolor="#414141" valign="top">
<br>
<br>
-
<div class="heading">NOTEBOOK PAGE INDEX</div>
+
<div class="heading">THIS MONTH</div>
<div class="desc">
<div class="desc">
-
<a href="#Carol">Carol</a><br>
+
<center>
-
<a href="#Chinmoyee">Chinmoyee</a><br>
+
</html>
-
<a href="#Emily">Emily</a><br>
+
{| style="background:transparent;"
-
<a href="#Fahd">Fahd</a><br>
+
|{{#calendar: query=preload=Team:Calgary/NotebookPreload | year=2009 | month=05 | title=Team:Calgary}}
-
<a href="#Iman">Iman</a><br>
+
|}
-
<a href="#Jamie">Jamie</a><br>
+
<html>
-
<a href="#Jeremy">Jeremy</a><br>
+
</center>
-
<a href="#Katie">Katie</a><br>
+
-
<a href="#Kevin">Kevin</a><br>
+
-
<a href="#Mandy">Mandy</a><br>
+
-
<a href="#Patrick">Patrick</a><br>
+
-
<a href="#Prima">Prima</a><br>
+
-
<a href="#Stefan">Stefan</a><br>
+
-
<a href="#Vicki">Vicki</a><br>
+
</div>
</div>
-
</p></div>
+
<br>
 +
</html>
 +
{{Template:CalgaryNotebook}}
 +
 
 +
<html>
 +
<center>
 +
</desc>
</td>
</td>
<td width="10" rowspan=30 bgcolor="#222222">
<td width="10" rowspan=30 bgcolor="#222222">
Line 85: Line 92:
<br>
<br>
<div class="heading">
<div class="heading">
-
JULY 23, 2009 (DATE)
+
MAY 28, 2009
</div>
</div>
<br>
<br>
Line 105: Line 112:
<br>
<br>
<div class="heading">
<div class="heading">
-
Descriptive Title of What You're Doing
+
Modeling Readings Continued
</div>
</div>
<br>
<br>
<div class="desc">
<div class="desc">
</html>
</html>
-
WIKI CODING HERE:
+
* Continued with reading up on things to characterize for the AI-2 system
-
 
+
* Started familiarization with Single Site-Directed Mutagenesis protocol
-
*bullet
+
* Primers for mutagenesis is ordered. The following are the sequences for the mutagenesis:
-
<br>
+
LuxCDABE-M-F:CCATTAATGAATTGCCGGATAATCTGGATTTTGAAGGCC
-
<b>bold</b>
+
LuxCDABE-M-R:GGCCTTCAAAATCCAGATTATCCGGCAATTCATTAATGG
-
<i>italics</i>
+
* Both primers are PAGE purified.
-
<u>underline</u>
+
* Received licences for Matlab and Simbiology. Downloaded program and was able to practice through examples found in the Matlab package. Focused on G protein cascase model (example in Matlab) in Yeast and prepared a presentation to show other iGEM members how Simbiology works.  
-
<br>
+
-
# Named link: [http://en.wikipedia.org Wikipedia]
+
-
<br>
+
-
link to books using ISBNs
+
-
<br>
+
-
[[Image:wiki.png]]
+
-
will end up like:<br>
+
-
[[Image:Thane4.png]]
+
-
 
+
<html>
<html>
</div>
</div>
</td>
</td>
</tr>
</tr>
-
 
-
<tr>
 
-
<td height="10px" bgcolor="#222222">
 
-
</td>
 
-
</tr>
 
-
 
-
<tr>
 
-
<td>
 
-
<a name="Chinmoyee"></a>
 
-
<br>
 
-
<div class="heading">
 
-
CHINMOYEE
 
-
</div>
 
-
<br>
 
-
<div class="heading">
 
-
Descriptive Title of What You're Doing
 
-
</div>
 
-
<br>
 
-
<div class="desc">
 
-
</html>
 
-
WIKI CODING HERE
 
-
 
-
<html>
 
-
</div>
 
-
</td>
 
-
</tr>
 
-
 
<tr>
<tr>
Line 172: Line 143:
<br>
<br>
<div class="heading">
<div class="heading">
-
Descriptive Title of What You're Doing
+
Sequencing of LuxOD47E in psB1AC3
</div>
</div>
<br>
<br>
<div class="desc">
<div class="desc">
</html>
</html>
-
WIKI CODING HERE
+
*Objective: To veriffy the presence of the ''LuxO''D47E gene in the psB1AC3 BBK vector
 +
<BR>
 +
Size of plasmid Backbone:  3055 bp
 +
<Br>
 +
Size of the gene of interest: 1362 bp
 +
<Br>
 +
Total size:                            4417 bp
 +
<Br>
 +
<Br>
 +
Sequencing needs 100ng of DNA/ 1 kb
 +
<Br>   
 +
4.4kb x 100ng/kb = 440ng
 +
<Br>
 +
Concentration of C2= 92.9ng/μL
 +
<Br>
 +
440ng/ 92.9 ng/uL = 4.8 μL DNA
 +
<Br>
 +
<Br>
 +
Diluted 4.8 μL DNA (''LuxO''D47E BBK C2) with 5.2 μL ddH20 and sent  down to Univeristy of Calgary Sequencing Labs with VF2 and VF1 primers.
 +
<Br>
 +
<Br>
 +
*Results: Sequencing came back and results indicated that the gene if interest, ''LuxO''D47E was not in the psB1AC3 vector.  We will have to go back to the gene in the pCR2.1-TOPO vector and try to get it into the psB1AC3 vector.
 +
 
 +
[[Image:2009.05.28.D47E BBkVer RD+PCR.tif|700px]]
<html>
<html>
Line 198: Line 192:
<br>
<br>
<div class="heading">
<div class="heading">
-
Descriptive Title of What You're Doing
+
Ethics paper
</div>
</div>
<br>
<br>
<div class="desc">
<div class="desc">
</html>
</html>
-
WIKI CODING HERE
+
Today I helped made our ethics paper handout that we will present the ethics workshop tomorrow. I also made follow up calls to a couple of R&D and O&G development companies.
-
 
+
-
<html>
+
-
</div>
+
-
</td>
+
-
</tr>
+
-
 
+
-
<tr>
+
-
<td height="10px" bgcolor="#222222">
+
-
</td>
+
-
</tr>
+
-
 
+
-
<tr>
+
-
<td>
+
-
<a name="Iman"></a>
+
-
<br>
+
-
<div class="heading">
+
-
IMAN
+
-
</div>
+
-
<br>
+
-
<div class="heading">
+
-
Descriptive Title of What You're Doing
+
-
</div>
+
-
<br>
+
-
<div class="desc">
+
-
</html>
+
-
WIKI CODING HERE
+
<html>
<html>
Line 250: Line 218:
<br>
<br>
<div class="heading">
<div class="heading">
-
Descriptive Title of What You're Doing
+
Sequencing <i>luxOU</i> with VF1 and VF2.
</div>
</div>
<br>
<br>
<div class="desc">
<div class="desc">
</html>
</html>
-
WIKI CODING HERE
+
*luxOU plasmid DNA was sent to the University of Calgary DNA Sequencing Facility for sequencing.
<html>
<html>
Line 276: Line 244:
<br>
<br>
<div class="heading">
<div class="heading">
-
Descriptive Title of What You're Doing
+
Send LuxO D47A in psB1AC3 Colony 2 to get sequenced
</div>
</div>
<br>
<br>
<div class="desc">
<div class="desc">
</html>
</html>
-
WIKI CODING HERE
+
Although RD and PCR are effective means of verifying the presence of a sequence of DNA, the gold standard for verification is DNA sequencing. LuxO D47A in psB1AC3 Colony 2 was sent to the University of Calgary DNA Sequencing Facility (University Core DNA Services, Calgary, Alberta, Canada). Primers used were VF2 (anneals near the BBK prefix on the BBK vector - used as a forward primer) and VF1 (anneals near the BBK suffix on the BBK vector - used as a reverse primer). The template was prepared such that there was 100ng/1kb of DNA (gene of interest + vector).
 +
<br>
 +
<br>
 +
After analyzing the sequencing results, it was evident that luxO D47A was absent from the psB1AC3 vector.
<html>
<html>
Line 302: Line 273:
<br>
<br>
<div class="heading">
<div class="heading">
-
Descriptive Title of What You're Doing
+
Continuing to Discover
</div>
</div>
<br>
<br>
<div class="desc">
<div class="desc">
</html>
</html>
-
WIKI CODING HERE
+
This week, the island has finished processing, but we do not have permission to build yet so our second life team continues to attempt to obtain a competent understanding of manipulating objects within the various public sandboxes, mainly from the Knights Bishop public group sandbox.
 +
<br>
 +
<br>
 +
I also experimented with the manipulation of avatars:
 +
 
 +
Skins, which are skins worn over the avatars shaped in world by the sliders, are made in any raster based image editor capable of producing .tga files, Photoshop, Paintshop Pro, GIMP being the big ones. The skins are then uploaded and worn. Using sculpted prims (sculpties) seems to be the most promising and flexible method to manipulate an avatar’s look. I also had to do a survey to obtain $150 LD.
<html>
<html>
Line 328: Line 304:
<br>
<br>
<div class="heading">
<div class="heading">
-
Descriptive of What You're Doing
+
Matlab and symbiology
</div>
</div>
<br>
<br>
<div class="desc">
<div class="desc">
</html>
</html>
-
WIKI CODING HERE
+
Familiarizing with the matlab program provided by MathWorks, and its biological tool called Symbiology.
 +
 
 +
No experiments were done on this day.
<html>
<html>
Line 354: Line 332:
<br>
<br>
<div class="heading">
<div class="heading">
-
Descriptive Title of What You're Doing
+
More building in Second Life
</div>
</div>
<br>
<br>
<div class="desc">
<div class="desc">
</html>
</html>
-
WIKI CODING HERE
+
While waiting for us to get the ability to script/build on our island, we continued in Kings Bishop. We played with a 'door' script in order to make fridges, waterbaths, and other equipment with the ability to be opened, making them more realistic. Also, with our idea to make floating spheres that people could do the biobrick simulator in, I started learning the scripts for teleportation in order for people to get in to the spheres. Also built these spheres.
-
 
+
<html>
<html>
 +
<br>
</div>
</div>
</td>
</td>
Line 371: Line 349:
</tr>
</tr>
-
<tr>
 
-
<td>
 
-
<a name="Patrick"></a>
 
-
<br>
 
-
<div class="heading">
 
-
PATRICK
 
-
</div>
 
-
<br>
 
-
<div class="heading">
 
-
Descriptive Title of What You're Doing
 
-
</div>
 
-
<br>
 
-
<div class="desc">
 
-
</html>
 
-
WIKI CODING HERE
 
-
 
-
<html>
 
-
</div>
 
-
</td>
 
-
</tr>
 
-
 
-
<tr>
 
-
<td height="10px" bgcolor="#222222">
 
-
</td>
 
-
</tr>
 
<tr>
<tr>
Line 406: Line 359:
<br>
<br>
<div class="heading">
<div class="heading">
-
Descriptive Title of What You're Doing
+
Marketing
</div>
</div>
<br>
<br>
<div class="desc">
<div class="desc">
</html>
</html>
-
WIKI CODING HERE
+
I spoke to the team about logos. We discussed logo ideas and designs. Also, I contacted the Gauntlet (U of C campus newsletter) about publishing a story on iGEM. I spoke to one of the journalists and scheduled a meeting to interview some of my teammates.
<html>
<html>
Line 425: Line 378:
<tr>
<tr>
<td>
<td>
-
<a name="Stefan"></a>
+
<a name="Vicki"></a>
<br>
<br>
<div class="heading">
<div class="heading">
-
STEFAN
+
VICKI
</div>
</div>
<br>
<br>
<div class="heading">
<div class="heading">
-
Descriptive Title of What You're Doing
+
Gel electrophoresis of PCR and restriction digest products from yesterday
</div>
</div>
<br>
<br>
<div class="desc">
<div class="desc">
</html>
</html>
-
WIKI CODING HERE
+
<b>Purpose:</b><br> To analyse the PCR and restriction digest products from yesterday by running them on the gel. This will show:
 +
*Whether or not the products are free of DNA contamination
 +
*Whether or not they actually contain LuxPQ BBk (or LuxPQ TOPO) – note that sequencing is the only way to confirm this, but this will help us eliminate products that clearly do not contain the gene of interest
-
<html>
+
<b>Materials and methods:</b><br>
-
</div>
+
*Preparation.
-
</td>
+
**Salvaging the restriction digests, which were hastily left overnight at room temperature and with no orange dye to stop the reaction. This was addressed today, when 4uL of orange dye were introduced to the 20 uL of restriction digest tube contents to deactivate the NotI restriction enzymes. 16 uL of ddHOH were added to bring the total tube volume up to 40 uL
-
</tr>
+
**Introducing a negative control. Stock LuxPQ BBk (of the uncut variety) will produce a distinct band on the gel around 7500 bp (accounting for the psB1AC3 plasmid and the LuxPQ gene), with fluctuations in levels based on the degree of coiling. Accordingly, if the NotI restriction digests did not actually digest, the digest lanes will resemble this control. This tube included 2uL of DNA, 1 uL of dye and 7 uL ddHOH
 +
**PCR products to evaluate specificity. If there are significant genetic mutations in the BBk sample, the primers will either not anneal at all (resulting in no PCR product) or anneal but give a product that is of a different size (if the mutations are beyond the primer domain).
 +
*Gel set-up
 +
**A 0.7% agarose gel was made. 10 uL of the aforementioned cocktails were loaded into each well, with the well key included in the results picture. Voltage was set at 90V and left to run for 50 minutes. A GenRuler 1 kb Plus DNA Ladder was run in parallel to provide size calibrations for our results.
-
<tr>
+
<b>Results:</b>
-
<td height="10px" bgcolor="#222222">
+
<br><br>
-
</td>
+
<center>
-
</tr>
+
[[Image:2009.05.28.LuxPQ.BBKVer.RD.PCR.jpg|700px]]
-
 
+
</center>
-
<tr>
+
-
<td>
+
-
<a name="Vicki"></a>
+
-
<br>
+
-
<div class="heading">
+
-
VICKI
+
-
</div>
+
-
<br>
+
-
<div class="heading">
+
-
Descriptive Title of What You're Doing
+
-
</div>
+
-
<br>
+
-
<div class="desc">
+
-
</html>
+
-
WIKI CODING HERE
+
<html>
<html>

Latest revision as of 03:03, 19 October 2009

University of Calgary

UNIVERSITY OF CALGARY



THIS MONTH

May
MTWTFSS
        [http://2009.igem.org/Team:Calgary/1_May_2009 1] [http://2009.igem.org/Team:Calgary/2_May_2009 2] [http://2009.igem.org/Team:Calgary/3_May_2009 3]
[http://2009.igem.org/Team:Calgary/4_May_2009 4] [http://2009.igem.org/Team:Calgary/5_May_2009 5] [http://2009.igem.org/Team:Calgary/6_May_2009 6] [http://2009.igem.org/Team:Calgary/7_May_2009 7] [http://2009.igem.org/Team:Calgary/8_May_2009 8] [http://2009.igem.org/Team:Calgary/9_May_2009 9] [http://2009.igem.org/Team:Calgary/10_May_2009 10]
[http://2009.igem.org/Team:Calgary/11_May_2009 11] [http://2009.igem.org/Team:Calgary/12_May_2009 12] [http://2009.igem.org/Team:Calgary/13_May_2009 13] [http://2009.igem.org/Team:Calgary/14_May_2009 14] [http://2009.igem.org/Team:Calgary/15_May_2009 15] [http://2009.igem.org/Team:Calgary/16_May_2009 16] [http://2009.igem.org/Team:Calgary/17_May_2009 17]
[http://2009.igem.org/Team:Calgary/18_May_2009 18] [http://2009.igem.org/Team:Calgary/19_May_2009 19] [http://2009.igem.org/Team:Calgary/20_May_2009 20] [http://2009.igem.org/Team:Calgary/21_May_2009 21] [http://2009.igem.org/Team:Calgary/22_May_2009 22] [http://2009.igem.org/Team:Calgary/23_May_2009 23] [http://2009.igem.org/Team:Calgary/24_May_2009 24]
[http://2009.igem.org/Team:Calgary/25_May_2009 25] [http://2009.igem.org/Team:Calgary/26_May_2009 26] [http://2009.igem.org/Team:Calgary/27_May_2009 27] [http://2009.igem.org/Team:Calgary/28_May_2009 28] [http://2009.igem.org/Team:Calgary/29_May_2009 29] [http://2009.igem.org/Team:Calgary/30_May_2009 30] [http://2009.igem.org/Team:Calgary/31_May_2009 31]


NOTEBOOK PAGE INDEX
Carol
Chinmoyee
Emily
Fahd
Iman
Jamie
Jeremy
Katie
Kevin
Mandy
Patrick
Prima
Stefan
Vicki



CALENDAR

May
MTWTFSS
        [http://2009.igem.org/Team:Calgary/1_May_2009 1] [http://2009.igem.org/Team:Calgary/2_May_2009 2] [http://2009.igem.org/Team:Calgary/3_May_2009 3]
[http://2009.igem.org/Team:Calgary/4_May_2009 4] [http://2009.igem.org/Team:Calgary/5_May_2009 5] [http://2009.igem.org/Team:Calgary/6_May_2009 6] [http://2009.igem.org/Team:Calgary/7_May_2009 7] [http://2009.igem.org/Team:Calgary/8_May_2009 8] [http://2009.igem.org/Team:Calgary/9_May_2009 9] [http://2009.igem.org/Team:Calgary/10_May_2009 10]
[http://2009.igem.org/Team:Calgary/11_May_2009 11] [http://2009.igem.org/Team:Calgary/12_May_2009 12] [http://2009.igem.org/Team:Calgary/13_May_2009 13] [http://2009.igem.org/Team:Calgary/14_May_2009 14] [http://2009.igem.org/Team:Calgary/15_May_2009 15] [http://2009.igem.org/Team:Calgary/16_May_2009 16] [http://2009.igem.org/Team:Calgary/17_May_2009 17]
[http://2009.igem.org/Team:Calgary/18_May_2009 18] [http://2009.igem.org/Team:Calgary/19_May_2009 19] [http://2009.igem.org/Team:Calgary/20_May_2009 20] [http://2009.igem.org/Team:Calgary/21_May_2009 21] [http://2009.igem.org/Team:Calgary/22_May_2009 22] [http://2009.igem.org/Team:Calgary/23_May_2009 23] [http://2009.igem.org/Team:Calgary/24_May_2009 24]
[http://2009.igem.org/Team:Calgary/25_May_2009 25] [http://2009.igem.org/Team:Calgary/26_May_2009 26] [http://2009.igem.org/Team:Calgary/27_May_2009 27] [http://2009.igem.org/Team:Calgary/28_May_2009 28] [http://2009.igem.org/Team:Calgary/29_May_2009 29] [http://2009.igem.org/Team:Calgary/30_May_2009 30] [http://2009.igem.org/Team:Calgary/31_May_2009 31]


June
MTWTFSS
[http://2009.igem.org/Team:Calgary/1_June_2009 1] [http://2009.igem.org/Team:Calgary/2_June_2009 2] [http://2009.igem.org/Team:Calgary/3_June_2009 3] [http://2009.igem.org/Team:Calgary/4_June_2009 4] [http://2009.igem.org/Team:Calgary/5_June_2009 5] [http://2009.igem.org/Team:Calgary/6_June_2009 6] [http://2009.igem.org/Team:Calgary/7_June_2009 7]
[http://2009.igem.org/Team:Calgary/8_June_2009 8] [http://2009.igem.org/Team:Calgary/9_June_2009 9] [http://2009.igem.org/Team:Calgary/10_June_2009 10] [http://2009.igem.org/Team:Calgary/11_June_2009 11] [http://2009.igem.org/Team:Calgary/12_June_2009 12] [http://2009.igem.org/Team:Calgary/13_June_2009 13] [http://2009.igem.org/Team:Calgary/14_June_2009 14]
[http://2009.igem.org/Team:Calgary/15_June_2009 15] [http://2009.igem.org/Team:Calgary/16_June_2009 16] [http://2009.igem.org/Team:Calgary/17_June_2009 17] [http://2009.igem.org/Team:Calgary/18_June_2009 18] [http://2009.igem.org/Team:Calgary/19_June_2009 19] [http://2009.igem.org/Team:Calgary/20_June_2009 20] [http://2009.igem.org/Team:Calgary/21_June_2009 21]
[http://2009.igem.org/Team:Calgary/22_June_2009 22] [http://2009.igem.org/Team:Calgary/23_June_2009 23] [http://2009.igem.org/Team:Calgary/24_June_2009 24] [http://2009.igem.org/Team:Calgary/25_June_2009 25] [http://2009.igem.org/Team:Calgary/26_June_2009 26] [http://2009.igem.org/Team:Calgary/27_June_2009 27] [http://2009.igem.org/Team:Calgary/28_June_2009 28]
[http://2009.igem.org/Team:Calgary/29_June_2009 29] [http://2009.igem.org/Team:Calgary/30_June_2009 30]


July
MTWTFSS
    [http://2009.igem.org/Team:Calgary/1_July_2009 1] [http://2009.igem.org/Team:Calgary/2_July_2009 2] [http://2009.igem.org/Team:Calgary/3_July_2009 3] [http://2009.igem.org/Team:Calgary/4_July_2009 4] [http://2009.igem.org/Team:Calgary/5_July_2009 5]
[http://2009.igem.org/Team:Calgary/6_July_2009 6] [http://2009.igem.org/Team:Calgary/7_July_2009 7] [http://2009.igem.org/Team:Calgary/8_July_2009 8] [http://2009.igem.org/Team:Calgary/9_July_2009 9] [http://2009.igem.org/Team:Calgary/10_July_2009 10] [http://2009.igem.org/Team:Calgary/11_July_2009 11] [http://2009.igem.org/Team:Calgary/12_July_2009 12]
[http://2009.igem.org/Team:Calgary/13_July_2009 13] [http://2009.igem.org/Team:Calgary/14_July_2009 14] [http://2009.igem.org/Team:Calgary/15_July_2009 15] [http://2009.igem.org/Team:Calgary/16_July_2009 16] [http://2009.igem.org/Team:Calgary/17_July_2009 17] [http://2009.igem.org/Team:Calgary/18_July_2009 18] [http://2009.igem.org/Team:Calgary/19_July_2009 19]
[http://2009.igem.org/Team:Calgary/20_July_2009 20] [http://2009.igem.org/Team:Calgary/21_July_2009 21] [http://2009.igem.org/Team:Calgary/22_July_2009 22] [http://2009.igem.org/Team:Calgary/23_July_2009 23] [http://2009.igem.org/Team:Calgary/24_July_2009 24] [http://2009.igem.org/Team:Calgary/25_July_2009 25] [http://2009.igem.org/Team:Calgary/26_July_2009 26]
[http://2009.igem.org/Team:Calgary/27_July_2009 27] [http://2009.igem.org/Team:Calgary/28_July_2009 28] [http://2009.igem.org/Team:Calgary/29_July_2009 29] [http://2009.igem.org/Team:Calgary/30_July_2009 30] [http://2009.igem.org/Team:Calgary/31_July_2009 31]


August
MTWTFSS
          [http://2009.igem.org/Team:Calgary/1_August_2009 1] [http://2009.igem.org/Team:Calgary/2_August_2009 2]
[http://2009.igem.org/Team:Calgary/3_August_2009 3] [http://2009.igem.org/Team:Calgary/4_August_2009 4] [http://2009.igem.org/Team:Calgary/5_August_2009 5] [http://2009.igem.org/Team:Calgary/6_August_2009 6] [http://2009.igem.org/Team:Calgary/7_August_2009 7] [http://2009.igem.org/Team:Calgary/8_August_2009 8] [http://2009.igem.org/Team:Calgary/9_August_2009 9]
[http://2009.igem.org/Team:Calgary/10_August_2009 10] [http://2009.igem.org/Team:Calgary/11_August_2009 11] [http://2009.igem.org/Team:Calgary/12_August_2009 12] [http://2009.igem.org/Team:Calgary/13_August_2009 13] [http://2009.igem.org/Team:Calgary/14_August_2009 14] [http://2009.igem.org/Team:Calgary/15_August_2009 15] [http://2009.igem.org/Team:Calgary/16_August_2009 16]
[http://2009.igem.org/Team:Calgary/17_August_2009 17] [http://2009.igem.org/Team:Calgary/18_August_2009 18] [http://2009.igem.org/Team:Calgary/19_August_2009 19] [http://2009.igem.org/Team:Calgary/20_August_2009 20] [http://2009.igem.org/Team:Calgary/21_August_2009 21] [http://2009.igem.org/Team:Calgary/22_August_2009 22] [http://2009.igem.org/Team:Calgary/23_August_2009 23]
[http://2009.igem.org/Team:Calgary/24_August_2009 24] [http://2009.igem.org/Team:Calgary/25_August_2009 25] [http://2009.igem.org/Team:Calgary/26_August_2009 26] [http://2009.igem.org/Team:Calgary/27_August_2009 27] [http://2009.igem.org/Team:Calgary/28_August_2009 28] [http://2009.igem.org/Team:Calgary/29_August_2009 29] [http://2009.igem.org/Team:Calgary/30_August_2009 30]
[http://2009.igem.org/Team:Calgary/31_August_2009 31]


September
MTWTFSS
  [http://2009.igem.org/Team:Calgary/1_September_2009 1] [http://2009.igem.org/Team:Calgary/2_September_2009 2] [http://2009.igem.org/Team:Calgary/3_September_2009 3] [http://2009.igem.org/Team:Calgary/4_September_2009 4] [http://2009.igem.org/Team:Calgary/5_September_2009 5] [http://2009.igem.org/Team:Calgary/6_September_2009 6]
[http://2009.igem.org/Team:Calgary/7_September_2009 7] [http://2009.igem.org/Team:Calgary/8_September_2009 8] [http://2009.igem.org/Team:Calgary/9_September_2009 9] [http://2009.igem.org/Team:Calgary/10_September_2009 10] [http://2009.igem.org/Team:Calgary/11_September_2009 11] [http://2009.igem.org/Team:Calgary/12_September_2009 12] [http://2009.igem.org/Team:Calgary/13_September_2009 13]
[http://2009.igem.org/Team:Calgary/14_September_2009 14] [http://2009.igem.org/Team:Calgary/15_September_2009 15] [http://2009.igem.org/Team:Calgary/16_September_2009 16] [http://2009.igem.org/Team:Calgary/17_September_2009 17] [http://2009.igem.org/Team:Calgary/18_September_2009 18] [http://2009.igem.org/Team:Calgary/19_September_2009 19] [http://2009.igem.org/Team:Calgary/20_September_2009 20]
[http://2009.igem.org/Team:Calgary/21_September_2009 21] [http://2009.igem.org/Team:Calgary/22_September_2009 22] [http://2009.igem.org/Team:Calgary/23_September_2009 23] [http://2009.igem.org/Team:Calgary/24_September_2009 24] [http://2009.igem.org/Team:Calgary/25_September_2009 25] [http://2009.igem.org/Team:Calgary/26_September_2009 26] [http://2009.igem.org/Team:Calgary/27_September_2009 27]
[http://2009.igem.org/Team:Calgary/28_September_2009 28] [http://2009.igem.org/Team:Calgary/29_September_2009 29] [http://2009.igem.org/Team:Calgary/30_September_2009 30]


October
MTWTFSS
      [http://2009.igem.org/Team:Calgary/1_October_2009 1] [http://2009.igem.org/Team:Calgary/2_October_2009 2] [http://2009.igem.org/Team:Calgary/3_October_2009 3] [http://2009.igem.org/Team:Calgary/4_October_2009 4]
[http://2009.igem.org/Team:Calgary/5_October_2009 5] [http://2009.igem.org/Team:Calgary/6_October_2009 6] [http://2009.igem.org/Team:Calgary/7_October_2009 7] [http://2009.igem.org/Team:Calgary/8_October_2009 8] [http://2009.igem.org/Team:Calgary/9_October_2009 9] [http://2009.igem.org/Team:Calgary/10_October_2009 10] [http://2009.igem.org/Team:Calgary/11_October_2009 11]
[http://2009.igem.org/Team:Calgary/12_October_2009 12] [http://2009.igem.org/Team:Calgary/13_October_2009 13] [http://2009.igem.org/Team:Calgary/14_October_2009 14] [http://2009.igem.org/Team:Calgary/15_October_2009 15] [http://2009.igem.org/Team:Calgary/16_October_2009 16] [http://2009.igem.org/Team:Calgary/17_October_2009 17] [http://2009.igem.org/Team:Calgary/18_October_2009 18]
[http://2009.igem.org/wiki/index.php?title=Team:Calgary/19_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 19] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/20_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 20] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/21_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 21] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/22_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 22] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/23_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 23] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/24_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 24] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/25_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 25]
[http://2009.igem.org/wiki/index.php?title=Team:Calgary/26_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 26] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/27_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 27] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/28_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 28] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/29_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 29] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/30_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 30] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/31_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 31]



MAY 28, 2009


CAROL

Modeling Readings Continued

  • Continued with reading up on things to characterize for the AI-2 system
  • Started familiarization with Single Site-Directed Mutagenesis protocol
  • Primers for mutagenesis is ordered. The following are the sequences for the mutagenesis: 
LuxCDABE-M-F:CCATTAATGAATTGCCGGATAATCTGGATTTTGAAGGCC
LuxCDABE-M-R:GGCCTTCAAAATCCAGATTATCCGGCAATTCATTAATGG
  • Both primers are PAGE purified.
  • Received licences for Matlab and Simbiology. Downloaded program and was able to practice through examples found in the Matlab package. Focused on G protein cascase model (example in Matlab) in Yeast and prepared a presentation to show other iGEM members how Simbiology works.


EMILY

Sequencing of LuxOD47E in psB1AC3

  • Objective: To veriffy the presence of the LuxOD47E gene in the psB1AC3 BBK vector


Size of plasmid Backbone: 3055 bp
Size of the gene of interest: 1362 bp
Total size: 4417 bp

Sequencing needs 100ng of DNA/ 1 kb
4.4kb x 100ng/kb = 440ng
Concentration of C2= 92.9ng/μL
440ng/ 92.9 ng/uL = 4.8 μL DNA

Diluted 4.8 μL DNA (LuxOD47E BBK C2) with 5.2 μL ddH20 and sent down to Univeristy of Calgary Sequencing Labs with VF2 and VF1 primers.

  • Results: Sequencing came back and results indicated that the gene if interest, LuxOD47E was not in the psB1AC3 vector. We will have to go back to the gene in the pCR2.1-TOPO vector and try to get it into the psB1AC3 vector.

File:2009.05.28.D47E BBkVer RD+PCR.tif


FAHD

Ethics paper

Today I helped made our ethics paper handout that we will present the ethics workshop tomorrow. I also made follow up calls to a couple of R&D and O&G development companies.


JAMIE

Sequencing luxOU with VF1 and VF2.

  • luxOU plasmid DNA was sent to the University of Calgary DNA Sequencing Facility for sequencing.


JEREMY

Send LuxO D47A in psB1AC3 Colony 2 to get sequenced

Although RD and PCR are effective means of verifying the presence of a sequence of DNA, the gold standard for verification is DNA sequencing. LuxO D47A in psB1AC3 Colony 2 was sent to the University of Calgary DNA Sequencing Facility (University Core DNA Services, Calgary, Alberta, Canada). Primers used were VF2 (anneals near the BBK prefix on the BBK vector - used as a forward primer) and VF1 (anneals near the BBK suffix on the BBK vector - used as a reverse primer). The template was prepared such that there was 100ng/1kb of DNA (gene of interest + vector).

After analyzing the sequencing results, it was evident that luxO D47A was absent from the psB1AC3 vector.


KATIE

Continuing to Discover

This week, the island has finished processing, but we do not have permission to build yet so our second life team continues to attempt to obtain a competent understanding of manipulating objects within the various public sandboxes, mainly from the Knights Bishop public group sandbox.

I also experimented with the manipulation of avatars:

Skins, which are skins worn over the avatars shaped in world by the sliders, are made in any raster based image editor capable of producing .tga files, Photoshop, Paintshop Pro, GIMP being the big ones. The skins are then uploaded and worn. Using sculpted prims (sculpties) seems to be the most promising and flexible method to manipulate an avatar’s look. I also had to do a survey to obtain $150 LD.


KEVIN

Matlab and symbiology

Familiarizing with the matlab program provided by MathWorks, and its biological tool called Symbiology.

No experiments were done on this day.


MANDY

More building in Second Life

While waiting for us to get the ability to script/build on our island, we continued in Kings Bishop. We played with a 'door' script in order to make fridges, waterbaths, and other equipment with the ability to be opened, making them more realistic. Also, with our idea to make floating spheres that people could do the biobrick simulator in, I started learning the scripts for teleportation in order for people to get in to the spheres. Also built these spheres.

PRIMA

Marketing

I spoke to the team about logos. We discussed logo ideas and designs. Also, I contacted the Gauntlet (U of C campus newsletter) about publishing a story on iGEM. I spoke to one of the journalists and scheduled a meeting to interview some of my teammates.


VICKI

Gel electrophoresis of PCR and restriction digest products from yesterday

Purpose:
To analyse the PCR and restriction digest products from yesterday by running them on the gel. This will show:

  • Whether or not the products are free of DNA contamination
  • Whether or not they actually contain LuxPQ BBk (or LuxPQ TOPO) – note that sequencing is the only way to confirm this, but this will help us eliminate products that clearly do not contain the gene of interest

Materials and methods:

  • Preparation.
    • Salvaging the restriction digests, which were hastily left overnight at room temperature and with no orange dye to stop the reaction. This was addressed today, when 4uL of orange dye were introduced to the 20 uL of restriction digest tube contents to deactivate the NotI restriction enzymes. 16 uL of ddHOH were added to bring the total tube volume up to 40 uL
    • Introducing a negative control. Stock LuxPQ BBk (of the uncut variety) will produce a distinct band on the gel around 7500 bp (accounting for the psB1AC3 plasmid and the LuxPQ gene), with fluctuations in levels based on the degree of coiling. Accordingly, if the NotI restriction digests did not actually digest, the digest lanes will resemble this control. This tube included 2uL of DNA, 1 uL of dye and 7 uL ddHOH
    • PCR products to evaluate specificity. If there are significant genetic mutations in the BBk sample, the primers will either not anneal at all (resulting in no PCR product) or anneal but give a product that is of a different size (if the mutations are beyond the primer domain).
  • Gel set-up
    • A 0.7% agarose gel was made. 10 uL of the aforementioned cocktails were loaded into each well, with the well key included in the results picture. Voltage was set at 90V and left to run for 50 minutes. A GenRuler 1 kb Plus DNA Ladder was run in parallel to provide size calibrations for our results.

Results:

2009.05.28.LuxPQ.BBKVer.RD.PCR.jpg

Retrieved from "http://2009.igem.org/Team:Calgary/28_May_2009"