Team:KULeuven/Wetlab/Vanillin Production
From 2009.igem.org
Bart Bosmans (Talk | contribs) |
JochemDeen (Talk | contribs) (→Steps) |
||
(15 intermediate revisions not shown) | |||
Line 1: | Line 1: | ||
- | {{Team:KULeuven/ | + | {{Team:KULeuven/Common2/BeginHeader}} |
- | {{Team:KULeuven/Common/ | + | {{Team:KULeuven/Common/SubMenu_Vanillin_Production}} |
- | {{Team:KULeuven/ | + | {{Team:KULeuven/Common2/EndHeader}} |
__NOTOC__ | __NOTOC__ | ||
- | = | + | =Vanillin Production: Planning= |
==Goal== | ==Goal== | ||
- | + | Making vanillin from tyrosine in a five-step pathway, implement a key lock function and add the LVA tag on the Sam8 and ComT enzymes. | |
- | Making vanillin from tyrosine in a five-step pathway. | + | [[Image:Vanillin_Biosynthesis_Pathway.jpg|center|thumb|365px|Making vanillin from tyrosine]] |
- | [[Image:Vanillin_Biosynthesis_Pathway.jpg| | + | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
==Required== | ==Required== | ||
Line 44: | Line 22: | ||
==Steps== | ==Steps== | ||
- | + | # Test the transformation of tyrosine to ferulic acid. The enzymes are put under a constitutive promoter and transcribed. Ferulic acid concentrations are then measured with HPLC | |
- | # | + | # Test the transformation of ferulic acid to vanillin. The enzymes are put under a constitutive promoter and transcribed. Ferulic acid concentrations are then measured with HPLC |
- | # | + | # add LVA tag to ComT (and Sam8) |
- | #If both are tested and | + | # If both constructs are tested and are working, they can be combined into one plasmid and again tested. |
- | #Then, the locks need to be added. | + | # Then, the locks need to be added. |
+ | |||
+ | |||
+ | '''The experimental setup for transformation by both biobrick constructs''' | ||
+ | |||
+ | Electrocompetent Top10 cells were electroporated with {{kulpart|K238022}} and {{kulpart|K238018}}, additionally for blanc measurement cultures with {{kulpart|K238021}} and {{kulpart|K238017}} were electroporated. These cells were plated out on agar plates with the correct AntiBiotic and grown overnight (37°C). From these, a 5ml liquid culture supplied with AB was prepared and also grown overnight at 37°C. Subsequently 1:100th was transfered to a new liquid culture containing AB and tyrosine (5mg/L or 50 mg/L) for the first 3 enzymes(Sam8, Sam5 and ComT, {{kulpart|K238022}}), Ferulic acid (5mg/L or 50mg/L) for the second 2 enzymes (ech and fcs, {{kulpart|K238018}}) And vanillin (5mg/L or 50 mg/L) to determine the degradation or transformation of vanillin by E.Coli. After certain time intervals ranging between 30 minutes and many hours samples (1-5ml) were taken and centrifuged at 13000RPM for 1 minute. The supernatant was then transfered to a new tube and placed in -20°C until it was ready for analysis. Analysis was done on HPLC (High pressure liquid chromatography) using a standard LB culture for blanco and the measurements from the experiments. | ||
- | + | {{Team:KULeuven/Common2/PageFooter}} | |
- | + |
Latest revision as of 22:49, 20 October 2009
Vanillin Production: Planning
Goal
Making vanillin from tyrosine in a five-step pathway, implement a key lock function and add the LVA tag on the Sam8 and ComT enzymes.
Required
Biobricks:
- SAM8: : coding sequence without RBS
- SAM5: : RBS site + PstI restriction site removed
- COMT: : coding sequence without RBS
- LVA tag (AANDENYALAA) attached to COMT (nucleotide code: gctgcaaacgacgaaaactacgctttagtagct)
- FCS: : RBS + fcs in pSB1A2
- ECH: : RBS + ech in pSB1A2
Where from
- SAM8, SAM5, COMT, FCS, ECH will be sent to us from the French Lab from the university Edinburgh
Steps
- Test the transformation of tyrosine to ferulic acid. The enzymes are put under a constitutive promoter and transcribed. Ferulic acid concentrations are then measured with HPLC
- Test the transformation of ferulic acid to vanillin. The enzymes are put under a constitutive promoter and transcribed. Ferulic acid concentrations are then measured with HPLC
- add LVA tag to ComT (and Sam8)
- If both constructs are tested and are working, they can be combined into one plasmid and again tested.
- Then, the locks need to be added.
The experimental setup for transformation by both biobrick constructs
Electrocompetent Top10 cells were electroporated with and , additionally for blanc measurement cultures with and were electroporated. These cells were plated out on agar plates with the correct AntiBiotic and grown overnight (37°C). From these, a 5ml liquid culture supplied with AB was prepared and also grown overnight at 37°C. Subsequently 1:100th was transfered to a new liquid culture containing AB and tyrosine (5mg/L or 50 mg/L) for the first 3 enzymes(Sam8, Sam5 and ComT, ), Ferulic acid (5mg/L or 50mg/L) for the second 2 enzymes (ech and fcs, ) And vanillin (5mg/L or 50 mg/L) to determine the degradation or transformation of vanillin by E.Coli. After certain time intervals ranging between 30 minutes and many hours samples (1-5ml) were taken and centrifuged at 13000RPM for 1 minute. The supernatant was then transfered to a new tube and placed in -20°C until it was ready for analysis. Analysis was done on HPLC (High pressure liquid chromatography) using a standard LB culture for blanco and the measurements from the experiments.