Team:KULeuven/Wetlab/Vanillin Production


Vanillin Production: Planning


Making vanillin from tyrosine in a five-step pathway, implement a key lock function and add the LVA tag on the Sam8 and ComT enzymes.

Making vanillin from tyrosine



  • SAM8: Status: 500

Content-type: text/html

Software error:

Can't locate Bio/ in @INC (@INC contains: /synbio/lib /web-site/ /usr/local/lib64/perl5 /usr/local/share/perl5 /usr/lib64/perl5/vendor_perl /usr/share/perl5/vendor_perl /usr/lib64/perl5 /usr/share/perl5 .) at /web-site/ line 9.
BEGIN failed--compilation aborted at /web-site/ line 9.
Compilation failed in require at /web-site/ line 8.
BEGIN failed--compilation aborted at /web-site/ line 8.

For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.

coding sequence without RBS
  • SAM5: Status: 500

Content-type: text/html

Software error:

Can't locate Bio/ in @INC (@INC contains: /synbio/lib /web-site/ /usr/local/lib64/perl5 /usr/local/share/perl5 /usr/lib64/perl5/vendor_perl /usr/share/perl5/vendor_perl /usr/lib64/perl5 /usr/share/perl5 .) at /web-site/ line 9.
BEGIN failed--compilation aborted at /web-site/ line 9.
Compilation failed in require at /web-site/ line 8.
BEGIN failed--compilation aborted at /web-site/ line 8.

For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.

RBS site + PstI restriction site removed
  • COMT: Status: 500

Content-type: text/html

Software error:

Can't locate Bio/ in @INC (@INC contains: /synbio/lib /web-site/ /usr/local/lib64/perl5 /usr/local/share/perl5 /usr/lib64/perl5/vendor_perl /usr/share/perl5/vendor_perl /usr/lib64/perl5 /usr/share/perl5 .) at /web-site/ line 9.
BEGIN failed--compilation aborted at /web-site/ line 9.
Compilation failed in require at /web-site/ line 8.
BEGIN failed--compilation aborted at /web-site/ line 8.

For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.

coding sequence without RBS
    • LVA tag (AANDENYALAA) attached to COMT (nucleotide code: gctgcaaacgacgaaaactacgctttagtagct)
  • FCS: Status: 500

Content-type: text/html

Software error:

Can't locate Bio/ in @INC (@INC contains: /synbio/lib /web-site/ /usr/local/lib64/perl5 /usr/local/share/perl5 /usr/lib64/perl5/vendor_perl /usr/share/perl5/vendor_perl /usr/lib64/perl5 /usr/share/perl5 .) at /web-site/ line 9.
BEGIN failed--compilation aborted at /web-site/ line 9.
Compilation failed in require at /web-site/ line 8.
BEGIN failed--compilation aborted at /web-site/ line 8.

For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.

RBS + fcs in pSB1A2
  • ECH: Status: 500

Content-type: text/html

Software error:

Can't locate Bio/ in @INC (@INC contains: /synbio/lib /web-site/ /usr/local/lib64/perl5 /usr/local/share/perl5 /usr/lib64/perl5/vendor_perl /usr/share/perl5/vendor_perl /usr/lib64/perl5 /usr/share/perl5 .) at /web-site/ line 9.
BEGIN failed--compilation aborted at /web-site/ line 9.
Compilation failed in require at /web-site/ line 8.
BEGIN failed--compilation aborted at /web-site/ line 8.

For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.

RBS + ech in pSB1A2

Where from

  • SAM8, SAM5, COMT, FCS, ECH will be sent to us from the French Lab from the university Edinburgh


  1. Test the transformation of tyrosine to ferulic acid. The enzymes are put under a constitutive promoter and transcribed. Ferulic acid concentrations are then measured with HPLC
  2. Test the transformation of ferulic acid to vanillin. The enzymes are put under a constitutive promoter and transcribed. Ferulic acid concentrations are then measured with HPLC
  3. add LVA tag to ComT (and Sam8)
  4. If both constructs are tested and are working, they can be combined into one plasmid and again tested.
  5. Then, the locks need to be added.

The experimental setup for transformation by both biobrick constructs

Electrocompetent Top10 cells were electroporated with Status: 500 Content-type: text/html

Software error:

Can't locate Bio/ in @INC (@INC contains: /synbio/lib /web-site/ /usr/local/lib64/perl5 /usr/local/share/perl5 /usr/lib64/perl5/vendor_perl /usr/share/perl5/vendor_perl /usr/lib64/perl5 /usr/share/perl5 .) at /web-site/ line 9.
BEGIN failed--compilation aborted at /web-site/ line 9.
Compilation failed in require at /web-site/ line 8.
BEGIN failed--compilation aborted at /web-site/ line 8.

For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.

and Status: 500

Content-type: text/html

Software error:

Can't locate Bio/ in @INC (@INC contains: /synbio/lib /web-site/ /usr/local/lib64/perl5 /usr/local/share/perl5 /usr/lib64/perl5/vendor_perl /usr/share/perl5/vendor_perl /usr/lib64/perl5 /usr/share/perl5 .) at /web-site/ line 9.
BEGIN failed--compilation aborted at /web-site/ line 9.
Compilation failed in require at /web-site/ line 8.
BEGIN failed--compilation aborted at /web-site/ line 8.

For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.

, additionally for blanc measurement cultures with Status: 500 Content-type: text/html

Software error:

Can't locate Bio/ in @INC (@INC contains: /synbio/lib /web-site/ /usr/local/lib64/perl5 /usr/local/share/perl5 /usr/lib64/perl5/vendor_perl /usr/share/perl5/vendor_perl /usr/lib64/perl5 /usr/share/perl5 .) at /web-site/ line 9.
BEGIN failed--compilation aborted at /web-site/ line 9.
Compilation failed in require at /web-site/ line 8.
BEGIN failed--compilation aborted at /web-site/ line 8.

For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.

and Status: 500

Content-type: text/html

Software error:

Can't locate Bio/ in @INC (@INC contains: /synbio/lib /web-site/ /usr/local/lib64/perl5 /usr/local/share/perl5 /usr/lib64/perl5/vendor_perl /usr/share/perl5/vendor_perl /usr/lib64/perl5 /usr/share/perl5 .) at /web-site/ line 9.
BEGIN failed--compilation aborted at /web-site/ line 9.
Compilation failed in require at /web-site/ line 8.
BEGIN failed--compilation aborted at /web-site/ line 8.

For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.

were electroporated. These cells were plated out on agar plates with the correct AntiBiotic and grown overnight (37°C). From these, a 5ml liquid culture supplied with AB was prepared and also grown overnight at 37°C. Subsequently 1:100th was transfered to a new liquid culture containing AB and tyrosine (5mg/L or 50 mg/L) for the first 3 enzymes(Sam8, Sam5 and ComT, Status: 500

Content-type: text/html

Software error:

Can't locate Bio/ in @INC (@INC contains: /synbio/lib /web-site/ /usr/local/lib64/perl5 /usr/local/share/perl5 /usr/lib64/perl5/vendor_perl /usr/share/perl5/vendor_perl /usr/lib64/perl5 /usr/share/perl5 .) at /web-site/ line 9.
BEGIN failed--compilation aborted at /web-site/ line 9.
Compilation failed in require at /web-site/ line 8.
BEGIN failed--compilation aborted at /web-site/ line 8.

For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.

), Ferulic acid (5mg/L or 50mg/L) for the second 2 enzymes (ech and fcs, Status: 500 Content-type: text/html

Software error:

Can't locate Bio/ in @INC (@INC contains: /synbio/lib /web-site/ /usr/local/lib64/perl5 /usr/local/share/perl5 /usr/lib64/perl5/vendor_perl /usr/share/perl5/vendor_perl /usr/lib64/perl5 /usr/share/perl5 .) at /web-site/ line 9.
BEGIN failed--compilation aborted at /web-site/ line 9.
Compilation failed in require at /web-site/ line 8.
BEGIN failed--compilation aborted at /web-site/ line 8.

For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.

) And vanillin (5mg/L or 50 mg/L) to determine the degradation or transformation of vanillin by E.Coli. After certain time intervals ranging between 30 minutes and many hours samples (1-5ml) were taken and centrifuged at 13000RPM for 1 minute. The supernatant was then transfered to a new tube and placed in -20°C until it was ready for analysis. Analysis was done on HPLC (High pressure liquid chromatography) using a standard LB culture for blanco and the measurements from the experiments.