Team:Freiburg bioware/Notebook/September

From 2009.igem.org

(Difference between revisions)
 
(32 intermediate revisions not shown)
Line 10: Line 10:
  type="text/css" media="screen" />
  type="text/css" media="screen" />
</head>
</head>
-
<body>
+
<body>  
<div id="art-page-background-simple-gradient"> </div>
<div id="art-page-background-simple-gradient"> </div>
<div id="art-main">
<div id="art-main">
Line 79: Line 79:
<div class="art-Post-inner">
<div class="art-Post-inner">
<div class="art-PostMetadataHeader">
<div class="art-PostMetadataHeader">
-
<h2 class="art-PostHeaderIcon-wrapper">October<span
+
<h2 class="art-PostHeaderIcon-wrapper">September<span
  class="art-PostHeader"></span> </h2>
  class="art-PostHeader"></span> </h2>
</div>
</div>
Line 86: Line 86:
<div style="text-align: left;">
<div style="text-align: left;">
-
<h3>01.10.09, Hannes, Manu, Laura, Gerrit, Sarah, Christoph, Caro, Julia, Anika, Isabel</h3>
+
<h3>01.09.09, Manu, Hannes, Christoph, Laura</h3>
-
<br>* Tetracycline; 10 x 1ml, Concentration: 25 g/l, stored in -20°C, box with antibiotics
+
<br>*evaluation of sequencing
-
<br>* Chloramphenicol; 10 x 1ml, Concentration: 25 g/l, stored in -20°C, box with antibiotics
+
- pMA_Shortlinker, plasmid prep from 29.08.09: sequence ok<br>
-
<br>* plasmid preparation of pEx-His-FluA-Split-Fok(inactive)-RBS-Strep-Dig-Split-Fok(active) Klon 4
+
- pEx_HisDigSplitFoka, plasmid prep from 29.08.09: sequence ok<br>
-
<br>* plasmid preparation of pEX-Strep-Dig-Split-Fok(active) Klon 1
+
- pEx_HisDigSplitFoki, plasmid prep from 29.08.09: sequence ok<br>
-
<br>* glycerin stock of pEx-His-FluA-Split-Fok(inactive)-RBS-Strep-Dig-Split-Fok(active) Klon 4 (RV308), stored at -80°C
+
- pEx_StrepDigSplitFoka, plasmid prep from 29.08.09: sequence ok<br>
-
<br>
+
- pEx_StrepDigSplitFoki, plasmid prep from 29.08.09: sequence ok<br>
-
<br>* protein purification of HisFluASplitFoki (expressed in BL21de3) with NiNTA column
+
- pMA_ShortlinkerFoka, plasmid prep from 29.08.09: sequence not ok, the linker short middle and long were ordered without NgoMIV restriction sites -> has to be ordered again<br>
-
<br>* SDS gel of protein purification HisFluASplitFoki
+
- pMA_ShortlinkerFoki, plasmid prep from 31.08.09: see above<br>
 +
- pEx_HisFluASplitFoka, plasmid prep from 29.08.09: not Foka but Foki<br>
 +
- pEx_HisFluASplitFoka, plasmid prep from 28.08.09: not Foka but Foki<br>
 +
- pEx_HisFluASplitFoki, plasmid prep from 28.08.09: sequence ok<br>
 +
- pEx_Strep-Dig: sequence ok<br>
 +
- pEx_His-Dig: sequence ok<br>
 +
- pMAFoka prep II from 05.08.09: sequence ok<br>
 +
- pMAFoka prep II from 05.08.09: sequence ok<br>
 +
- pMAFoki prep II from 05.08.09: sequence ok<br>
 +
<br>*hybridization of M13 DNA ss and the fokcontrols in equal relations
 +
<br>*made SDS gels --> 4°C
 +
<br>*SDS gel of protein expression (pEx-His-FluA-SplitLi-Foki) from 28.08.09
-
[[Image:Freiburg09_011009_pg_HisFluASplitFoki011.jpg|none|thumb|SDS-Gel; HisFluASplitFoki; Lanes: NEB prestained protein marker, elution fraction 1, elution fraction 2, elution fraction 3, elution fraction 4, elution fraction 5, elution fraction 6, elution fraction 7, flow through fraction 2, washing fraction 2|400x400px]]
+
<table>
 +
<tr>
 +
<td align="center">
 +
<img src="https://static.igem.org/mediawiki/2009/a/a5/Freiburg09_010909_pg_pExHisFluASplitLiFokIvom2808_waehrend_expression012.jpg" name="bildone" width="350" heigth="175" /><br>SDS-Gel; pExHisFluASplitFoki; Lanes: NEB prestained protein marker, t0 (before induction), t1 (1 hour after induction), t2 (2 hours after induction), t3 (3 hours after induction), t4 (4 hours after induction)</td>
-
<br>* pooled fraction 2-5, dialysis over night in dialysis buffer (30mM NaCl, 20mM Tris-HCl, pH 7.4)
+
<td align="center">
-
<br>*phage display:
+
<td align="center">
-
- desalt ligation products (for electroporation)<br>
+
<img src="https://static.igem.org/mediawiki/2009/8/8e/Freiburg09_010909_pg_NiNTA_pExHisFluASplitLiFokIvom2808011.jpg" name="bildone" width="350" heigth="175" /><br>SDS-Gel; pExHisFluASplitFoki ; Lanes: NEB prestained protein marker, Elution fraction 1 (after NiNTA-column), Elution fraction 2, Elution fraction 3, Elution fraction 4, Elution fraction 5, Elution fraction 6, Elution fraction 7, Elution fraction 8, Elution faction 9 </td>
-
pool samples (~80µl 445+87/89 and ~52µl 445+87/88)<br>
+
-
add 1 volume of isopropanol, mix<br>
+
-
-80°C for 10 minutes<br>
+
-
centrifuge for 10 minutes at max rpm, 4°C; discard supernatant<br>
+
-
add 1 volume of 75% ethanol (without mixing)<br>
+
-
centrifuge for 10 minutes at max rpm, 4°C; discard supernatant<br>
+
-
let dry on heat block (50°C), lid open<br>
+
-
add 25µl water<br>
+
-
thermo shaker for 1h, 45°C, 1000rpm
+
-
- PCR (4 samples each template):<br>
+
<br>
-
buffer (with MgCl2): 5µl<br>
+
</tr>
-
primer #7: 1,5µl<br>
+
</table>
-
primer #1: 1,17µl<br>
+
-
dNTPs: 2µl<br>
+
-
Taq: 1µl<br>
+
-
MnCl2: 0,5µl<br>
+
-
MgCl2: 5µl<br>
+
-
water: 33µl<br>
+
-
DNA (425 or 428): 5µl<br>
+
-
- PCR:<br>
+
Lane 4 showed some strange bands, so we repeated the gel<br>
-
DNA templates: pJs#448 (0,3µl), pJs#449 (0,3µl), pJs#375 (1µl), pJs#413 (0,3µl), pJs#445 (0,3µl)<br>
+
<br>*made 1l buffer for AGO cleavage assay: 100mM NaCl, 10mM HEPES, 5mM MnCl2, pH 7.5
-
primers (#95, #7): 1,5µl<br>
+
<br>*came up with idea for new BioBrick standart that would allow making fusiun proteins via "mega primer" pcr technic with only a Threonine as a scar and thereby skipping the cloning procedure:
-
high fidelity buffer: 5µl<br>
+
[[Image:Freiburg 09 Superstandard.jpg|none|thumb||400x400px]]
-
dNTPs: 1µl<br>
+
The new restriction enzyme would be AcuI, that for example has no cutting site in M13mp18 and just one in pET28 and two times in pMAL-p5X core vector <br>
-
TMenzyme: 0,3µl<br>
+
AcuI cuts 14/16 bases away from its recognition sequence end would thereby cut off the whole BB prefix and most of the BB suffix (with just AC left)
-
water: 39,7µl<br>
+
<br>*purification of pExHisFluASplitFoki via Ni-NTA column
-
<br>* Overnight Culture RV308 for Competent Cells, on shaker in 37 °C room
+
<br>*inoculation of pExHisFluASplitFoki36GSlinker
-
<br>*analysis of sequences from 28.09.09
+
<br>*starter cultures of
-
<br>*digest of pExStrepDigSplitFoka prep from 30.09.09
+
- pExHisDigSplitFoka<br>
-
Plasmid: 15 µl<br>
+
- pExStrepDigSplitFoka<br>
-
water: 9 µl<br>
+
in 50 ml LB and Ampicillin from plates of 31.08.09
-
BSA: 0.5 µl NEB iGEM stock<br>
+
-
buffer: 3 µl buffer 3 NEB iGEM stock<br>
+
-
Restriction_enzyme_1 : 1,5 µl XbaI from NEB KuKlabstock<br>
+
-
Restriction_enzyme_2 : 1 µl PstI from NEB KuKlabstock <br>
+
-
<br>*digest of PCR product RBSStrepDigSplitFoka from 30.09.09
+
-
Plasmid: 10 µl <br>
+
-
water: 14 µl<br>
+
-
BSA: 0.5 µl NEB iGEM stock<br>
+
-
buffer: 3 µl buffer 3 NEB iGEM stock<br>
+
-
Restriction_enzyme_1 : 1,5 µl XbaI from NEB KuKlabstock<br>
+
-
Restriction_enzyme_2 : 1 µl PstI from NEB KuKlabstock <br>
+
-
<br>*digest of pExHisFluaSplitFoki prep from 24.08.09
+
-
Plasmid: 15 µl <br>
+
-
water: 9 µl<br>
+
-
BSA: 0.5 µl NEB iGEM stock<br>
+
-
buffer: 3 µl buffer 2 NEB iGEM stock<br>
+
-
Restriction_enzyme_1 : 1,5 µl XbaI from NEB KuKlabstock<br>
+
-
Restriction_enzyme_2 : 1 µl SpeI from NEB KuKlabstock <br>
+
-
-> put in 37°C room for 2h
+
-
->preparative gel<br>
+
-
[[Image:Freiburg09_011009_fokverdaue.JPG|none|thumb|Agarose gel; Lanes: 1.Gene ruler ladder mix of fermentas, 2.pExHisFluASplitFoki, 3.pExStrepDigSplitFoka, 4. RBS_StrepDigSplitFoka || 400x400px]]
+
-
interpretation: bands had right size but pExStrepDigSplitFoka showed unexpectedly low concentration<br>
+
-
->gelextraction <br>
+
-
ligation of<br>
+
-
- pExHisFluaSplitFoki (vector) and StrepDigSplitFoka (insert)<br>
+
-
- pExHisFluaSplitFoki (vector) and RBS_StrepDigSplitFoka (insert)<br>
+
-
<br>*Inoculation of  
+
-
- pJS419_StrepDigSplitFoka<br>
+
-
- pJS419_HisDigSplitFoka<br>
+
-
- pEx_HisFluA<br>
+
-
- pEx_HisDigMiddleLiFoka<br>
+
-
<br>*digest pMA_ShortlinkerFoki/a, pMA_MiddleLinkerFoki/a and pMA_scFa-anti_NIP for recloning
+
-
<br>*Inoculation of pEx_HisFluASplitFoki in BL21de3 with colony of transformation from 28.09.09
+
-
--> make glycerol stocks tomorrow
+
-
<br>*agarose gel (1%) of the digest of pMA_ShortlinkerFoki/a, pMA_MiddleLinkerFoki/a and pMA_scFa-anti_NIP for recloning
+
-
<br>*cut out insert bands (digestion of pEX didn't work, because there's no EcoRI recognition site any more)
+
-
<br>*gel slices stored at -4°C over night
+
-
<h3>02.10.09 Laura, Manu, Anika, Julia, Hannes, Gerrit, Isabell, Sarah, Caro, Timo, Christoph, Max</h3>
+
<h3>02.09.09, Manu, Hannes, Christoph, Gerrit, Laura, Isabel</h3>
-
<br>* phage display
+
<br>*Inoculation of expression culture
-
- OD600 of the pre-culture should be 0,2 <br>
+
- pExHisDigSplitFoka<br>
-
- 37°C shaker<br>
+
- pExStrepDigSplitFoka<br>
-
- After 70 minutes: Measure OD600 (should be about 0,6-0,7)<br>
+
in 2 times 1 liter each at 28°C , 118rpm<br>
-
- Apportion culture into 10x50 ml Falkon tubes<br>
+
-> induction of expression at OD 0,4, harvesting 4 hours later<br>
-
- 15 minutes on ice<br>
+
-> centrifugation at 4000 rpm, 4°C, 20 min
-
- Centrifuge 10 minutes at 4°C / 2500 g<br>
+
-> put pellets in -80°C freezer
-
- discard supernatant, wash pellet with 25 ml H2O (let dry upside down)<br>
+
<br>*cleaning of Ni column with 15 ml water and 10 ml Ethanol (20%)
-
- resuspend pellets in 25 ml H2O (10-> 8 tubes)<br>
+
<br>*plasmid preparation of pExHisFluASplitFoki36GSlinker, glycerol stocks and sequencing
-
- 15 minutes on ice<br>
+
<br>*repetition of SDS gel of eluate fractions (pExHisFluASplitFoki)
-
- Centrifuge 10 minutes at 4°C / 2500 g<br>
+
see picture...
-
- Discard supernatant, resuspend pellets in 25 ml H2O (8-> 4 tubes)<br>
+
-> fractions 2 and 3 showed the probable Foki fusion protein and were united and dialysed
-
- 15 minutes on ice<br>
+
-
- Centrifuge 10 min at 4°C / 2500 <br>
+
-
- Discard supernatant, resuspend pellets in 25 ml 10% DMSO (4-> 2 tubes)<br>
+
-
- 5 minutes on ice<br>
+
-
- Centrifuge 10 minutes at 4°C / 2500 g<br>
+
-
- Discard supernatant, resuspend pellets in 5 ml 10% DMSO (2 tubes)<br>
+
-
- 5 minutes on ice<br>
+
-
- Centrifuge 10 min at 4°C / 2500 g<br>
+
-
- Discard supernatant, pool pellets in 1 ml 10% DMSO<br>
+
-
- Measure OD600 (1:100 dilution), OD should be 0,4<br>
+
-
- Make aliquots à 80 µl, souse with N2<br>
+
-
- Store at -80°C<br>
+
-
<br>*glycerol stock of pEx_HisFluASplitFoki in BL21de3
+
-
<br>*SDS gel of pool (elution fraction 2-5) from protein expression (HisFluASplitFoki) from 01.10.09
+
-
--> do a Western Blot
+
-
<br>*new ampicilin 100 aliquots
+
<table>
-
<br>*preparation of M13dsDNA
+
<tr>
-
<br>*chem. competent cells aliqots
+
<td align="center">
 +
<img src="https://static.igem.org/mediawiki/2009/6/65/Freiburg09_020909_pg_pExHisFluASplitLiFokIvom2808_repeat013.jpg" name="bildone" width="350" heigth="175" /><br>SDS-Gel; pExHisFluASplitFoki ; Lanes: NEB prestained protein marker, Elution fraction 1, Elution fraction 2, Elution fraction 3, Elution fraction 4, Elution fraction 5, flow through fraction 1, flow through fraction 3, washing fraction 1 (250mM imidazole), washing fraction 3</td>
 +
<br>
 +
</tr>
 +
</table>
 +
<br>*order of new short, middle and long linkers with XbaI, NgoMIV and AgeI restriction sites
 +
<br>*made binding, washing and elution buffer (1 liter each) again for His/Ni purification
 +
<br>*prepared 2 liters of dialysis buffer (30mM NaCl, 20mM Tris/HCl, pH 7,4)
 +
<br>*centrifugation of the expression culture (20 min, 4000 rpm, 4°C), stored pellets at -20°C
 +
<br>*started dialysis over night with 200 ml dialysis buffer and 3 ml protein solution (elutions 2 and 3 were combined), stiring at 4°C<br><br>
 +
<b>Meeting</b><br>
 +
<br>*Kristian introduced GBM, please add your data to the list if you want to join the group founded for iGEM
 +
<br>*Fok
 +
- the tagged Oligo's arrived during the absence of Kristian and stayed one week in his mail box at room temperature. Christoph wanted to find out, how this affects the DNA<br>
 +
- we should repeat the Fok cutting assay with M13 dsDNA and change the origami-programm to stop at 37°C (instead of 20°C)<br>
 +
- new Oligo's for the cutting assay must be ordered with a length of 60 bp<br><br>
 +
- dialyse the his-tag purified protein solution to get the right ion concentrations for a ion exchange chromatography<br>
 +
- with the his-tag purified and dialysed protein solution we must do some tests: freeze it, thaw it and measure the stray light(photometer)<br>
 +
- prepare aliquots of the protein solution<br>
 +
- do a purification via ion exchange chromatography (MonoQ, positive charged)<br>
 +
- try a first cutting assay with our construct<br>
 +
- confirm the Oligo-Protein-interaction with a fluorescence or absorption measurement (we have to do some research on this)<br>
 +
<br>*Fok-Phage Display
 +
- we want to assemble the different parts with a PCR with overlapping primers (including the GS-linker). We should use a mix of Taq and a proof reading polymerasy and have a maximum cycle number of 20 to keep the mutations as low as possible<br>
 +
- order parts at Mr.Gene with iGEM restriction sites<br>
 +
- we must plan the PCR-primers!!!<br>
 +
<br>*AGO
 +
- first try to cut single strand DNA<br>
 +
<br>*book rooms in a hotel (Anika wanted get some info about the hotels)
-
<br>*Periplasma Project
+
<h3>03.09.09, Manuel, Hannes, Christoph, Gerrit, Timo</h3>
 +
<br>*Hybridization of M13 ssDNA with FokKontrolle 2(1:100) and 3(1:100 dil)
 +
<br>*Digestion of M13 ssDNA FokKontrolle(FokK)1-8; 1&2;2&3;1&3 with FokI <br>
 +
M13 dsDNA with FokI. made a heat inactivation of 5b (95°C 10min) and 6b without FokI
 +
<br>*Cutting assay checked by gel electrophoresis<br>
-
Digestion:<br>
+
<table>
 +
<tr>
 +
<td align="center">
 +
<img src="https://static.igem.org/mediawiki/2009/1/12/Freiburg09_09.09.03_gelcuttingassay2.JPG" name="bildone" width="350" heigth="175" /><br>Agarose gele of M13DNA digest with fokI: Marker(fermantas gene ruler mix), M13ssDNA+fokI, M13ssDNA fokk1+fokI, M13ssDNA fokk2+fokI, M13ssDNA fokk3+fokI, M13ssDNA fokk2/3+fokI, M13ssDNA fokk2/3+fokI(heatshocked), M13ssDNA fokk1/2+fokI, M13ssDNA fokk1/2, M13ssDNA fokk2/3+fokI(37°C), M13dsDNA fokk2/3+fokI</td>
 +
<br>
 +
</tr>
 +
</table>
-
- digested with xba and spe
+
*Digestion of pEX_His_FluA_Split_Foki_36GSli(prep 02.09.09 rest4 tube3) with AgeI and PstI<br>
-
--> GelBilder
+
Plasmid: 10 µl<br>
 +
water: 12.5 µl<br>
 +
BSA: 0.5 µl NEB iGEM stock<br>
 +
buffer: 3 µl buffer 1 NEB KuKlabstock<br>
 +
Restriction_enzyme_1 : 1 µl AgeI from NEB KuKlabstock<br>
 +
Restriction_enzyme_2 : 2 µl PstI from NEB KuKlabstock <br>
 +
<br>*Gel extraction of pEX_His_FluA_Split_Foki_36GSli (prep 02.09.09 rest4 tube3)<br>
 +
<br>*Ligation of vector:pEX_His_FluA_Split_Foki_36GSli(prep 02.09.09 rest4 tube3) with insert:Foka(Gelex 17.08)<br>
 +
Vector: 3 µl pEX_His_FluA_Split_Foki_36GSli from 02.09.09<br>
 +
Insert: 6 µl Foka(Gelex 17.08)<br>
 +
buffer: 10 µl Quick ligase buffer from NEB iGEM stock<br>
 +
Ligase: 1 µl Quick ligase NEB iGEM stock<br>
 +
<br>*Conzentrated AGO 5x via Vivaspin to final conzentration of 3µM (2ml)
 +
<br>*Exchanged buffer of 900µl of Aa AGO solution via dialysis
 +
<br>*Started PCR procedure to create Aa AGO as an BB part via megaprimer technic
 +
<br>*His-Dig purification of protein expression from 02.09.09 (pExHisDigSplitFoka)
 +
<br>*SDS gel of His-Dig purification HisDigSplitFoka
-
<br>* Gelextraction
+
<table>
 +
<tr>
 +
<td align="center">
 +
<img src="https://static.igem.org/mediawiki/2009/4/4f/Freiburg09_040909_pg_HisDigSplitFoka_vom030909015.jpg
 +
" name="bildone" width="350" heigth="175" /><br>SDS-Gel; pExHisDigSplitFoka ; Lanes: NEB prestained protein marker, Elution fraction 1, Elution fraction 2, Elution fraction 3, Elution fraction 4, Elution fraction 5, Elution fraction 6, flow through fraction 1, flow through fraction 3, washing fraction 1</td>
 +
<br>
 +
</tr>
 +
</table>
 +
<br>*changed dialysis buffer, again with 200 ml (10:00 o'clock)
-
Min Elute Gel Extraction Kit<br>
+
<h3>04.09.09, Manu, Hannes, Christoph, Laura, Sarah,Timo</h3>
-
- mesure mass: StrepFokA = 50 mg<be>
+
<br>*Ordered additional Oligo for M13mp18 cleavage with AGO: "Oligo A4" AAGTTTTTTGGGGTCGAGGTG should allow the Aa Argonaute protein to cut the M13mp18 ssDNA behind base 100. combination with A1 (cuts at 3100) should result in two destinc bandes on the gel with  a 1:2 size ratio
-
- JS418= 90mg<br>
+
<br>*AGO: over night dialysis to exchange buffer to the "AGO assaybuffer". NanoDrop: 0.575 mg/ml --> 6µM in ca. 1.2 ml buffer -> -20°C freezer
-
-JS419=80mg<br>
+
<br>*AGO cleavage assay with M13mp18 ssDNA was roughly performed following the original RNA assay (Ma et al.): <br>
-
- HisFokA = 250mg<br>
+
15µl of the Aa Argonaute protein in the "Ago assay buffer" were incubated 30 minutes with 1µl of 100µM of the guideoligo A1 (ACAACCATCGCCCACGCATAA)at 55°C <br>
 +
Then 20µl of M13mp18 ssDNA (248ng/µl)was added and incubated for 30 minutes at 55°C<br>
 +
One half of the solvent was treated with proteinase K solution, the other was untreated added to the agarose gele
 +
--> we obtained 2 bands which might be the circular M13 DNA and the linear M13 DNA
-
Nandropdata<br>
 
-
<br>*Ligation
+
<table>
-
- with Quickligase
+
<tr>
 +
<td align="center">
 +
<img src="https://static.igem.org/mediawiki/2009/6/6b/Freiburg_09_AGO_M13_verdau_45min.JPG" name="bildtwo" width="350" heigth="175" /><br>Agarose gele of AGO M13 digest; Lanes: Marker:1kb ladder, AGO M13 digest, AGO M13 digest treated with Proteinase K, untreated M13 ssDNA</td>
 +
<br>
 +
</tr>
 +
</table>
-
JS119-StrepFokA<br>
+
On lane two there is a clearly visible bandshift. The band on the very bottom of lane three is most likely the guide oligo that was released when the AGO was destroyed by the proteinase.<br>
-
JS118-Strep<br>
+
Next week we will do another assay with two guide oligos (A1 and A4) that should result in two distinct bands and thereby allow as to exclude the possibility that the bandeshift is due to AGO bound to the targed ssDNA
-
JS118-HisFokA<br>
+
<br>*AGO PCR to craeat an Aa AGO BB part failed and will be repeated on Monday
-
JS19-HisFokA<br>
+
-
- 15 min at 25°C
+
<h3>06.09.09, Hannes</h3>
 +
<br>*Inoculation of:
 +
- BL21de3 pEx-StrepDigSplitFoka<br>
 +
- BL21de3 pEx-HisDigSplitFoka<br>
 +
- pEx-HisFluASplitFoki-36GS-Foka<br>
-
<br>*Transformation
+
<h3>07.09.09, Laura, Manu, Gerrit, Christoph, Isabel, Anika</h3>
-
- 2YT-Medium 950 µL to 50µl cells and DNA <br>
+
<br>*Prepared LB Medium (10l)<br>
 +
<br>*Purification via Strep-Tactin column of Strep-Dig-Split-Foka
 +
<br>*SDS Gel with eluate fractions E1 til E7 and washfractions W2 til W3 and NEB prestained proteinmarker
 +
---> see picture
 +
result: no fusioned protein StrepDigSplitFoka eluated
 +
<br>*Plamidpreparation of pEx His-FluA-Split-Foki-36GSLi-Foka, glycerol stocks and sequencing
 +
<br>*Glycerol stocks of pEx-Strep-Dig-Split-Foka and pEx-His-Dig-Split-Foka
 +
<br>*Cutting experiments and analytical agarose gel of digested M13 DNA hybridized with Fok control 1 and 2, pure oligos 1 and 2, pure ds and ss M13 DNA, 1kb ladder
 +
[[Image:2009-09-07_M13_2.Bild.jpg |none|thumb|Analytical Agarose Gel of M13 Digest; Lanes: Marker:100bp ladder, Fok Control Oligo 1, Fok Control Oligo 2, M13 ssDNA Hybridized with Fok Control 1 and 2, M13 ssDNA Hybridized with Fok Control 1 and 2, ds and ss M13 DNA|400x400px]]
 +
<br>*Starter culture of pEx-His-Flua-Split-Foki(amp plate of 25.08.09)in BL21DE3 (200 ml LB + amp)
 +
<br>*Hybridisation of long, middle and short linker
 +
<br>*pEx His-FluA-Split-Foki-36GSLi-Foka is now called <b>FokM</b> [http://www.molbiotech.uni-freiburg.de/iGEM/wiki2009/index.php/Fok_monomer Sequenz]
 +
<br>*Transformation of FokM into BL21 de3 gold
-
BL21-JS190<br>
+
<h3>08.09.09, Manu, Gerrit, Christoph, Sarah, Anika, Hannes, Laura, Isabel, Julia</h3>
-
BL21-JS119StrepFokA<br>
+
<br>*made LB Agar
-
BL21-JS118Strep<br>
+
<br>*poured amp plates (3 plates left)
-
BL21-JS118HisFokA<br>
+
<br>*ligation of short, middle and long linker (hybridized at 07.09.09) and pMA vector (gelex from 27.08.09)
-
BL21-JS19HisFokA
+
<br>*ligation of short, middle and long linker (hybridized at 07.09.09) and pMA_Foki (gelex from 28.08.09) and pMA_Foka (gelex from 27.08.09)
 +
<br>*made SDS gel of collected pellets (T0-3) from expression of StrepDigSplitFoka and HisDigSplitFoka
 +
aim: to see if induction of expression of fusioned protein was successful
-
- Plated on KM plats<br>
+
<table>
 +
<tr>
 +
<td align="center">
 +
<img src="https://static.igem.org/mediawiki/2009/3/34/Freiburg09_090909_pg_HisDigSplitFoka_SDS017.jpg" name="bildone" width="350" heigth="175" /><br>SDS-Gel; pExHisDigSplitFoka ; Lanes: NEB prestained protein marker, expression fraction T0, T1, T2, T3, T1, T2, T3</td>
-
<br>* Preparation of overnight cultures 5 ml LB medium each
+
<td align="center">
-
- pBad+Kan<br>
+
<td align="center">
-
-pET39B(+)<br>*Amp<br>
+
<img src="https://static.igem.org/mediawiki/2009/8/86/Freiburg09_090909_pg_StrepDigSplitFoka_SDS016.jpg
-
--> Stored in 37°C room
+
" name="bildone" width="350" heigth="175" /><br>SDS-Gel; pExStrepDigSplitFoka ; Lanes: NEB prestained protein marker, expression fraction T0, T1, T2, T3, T1, T2, T3 </td>
-
<br>*Digest:
+
<br>
-
- pMASplitFoka<br>
+
</tr>
-
- pMAFoka<br>
+
</table>
-
- pMAFoki<br>
+
<br>*Stripping of Ni-NTA column
-
- pMASplitFoki<br>
+
<br>*made starter culture (300ml LB+Amp+1%Glucose) with pEXHisDigSplitFoki in BL21de3
-
- pMALongLiFoka<br>
+
<br>*Made gradient PCR (+-5 in first 10 cycles; +-2.5 in last 14 cycles) to generate BB Aa AGO part. Therefor optimised pcr protocoll and made an additional approach using DMSO
-
- pMALongliFoki<br>
+
-
- pMAShortli<br>
+
-
- pMAMiddleli<br>
+
-
- pMALongli<br>
+
-
- pExStrepFluA<br>
+
-
 
+
-
 
+
-
<br>*preparative gel
+
-
[[Image:Freiburg09_021009_umklonierung.JPG|none|thumb|Agarose gel; Lanes: pMASplitFoka, 2.pMAFoka, 3.pMAFoki, 4.pMASplitFoki, 5.pMALongLiFoka, 6.pMALongliFoki, 7.pMAShortli, 8.pMAMiddleli, 9.pMALongli, 10.pExStrepFluA<|400x400px]]
+
-
->interpretation: just the linker resulted in too short fragments, thus the hybridized linkers have to be cloned in pMA directly
+
-
<br>*gelextraction of digest from 02.10.09 and also pMAShortliFoka, pMAShortliFoki, pMAMiddleliFoka, pMAMiddleliFoki from 01.10.09
+
 +
<h3>09.09.09, Gerrit, Christoph, Sarah, Isabel, Anika, Hannes, Laura, Max, Julia, Dieter</h3>
 +
<br>*expression of pExHisFluASplitFoki in 6 times 1 ml LB and Amp
 +
- pellets were taken at T0 (time of induction with IPTG), T1, T2, T3, T4<br>
 +
- at the end culture was centrifuged down at 4000rpm, 20 min, 4°C<br>
 +
- pellets frozen in -80° C<br>
 +
<br>* Repetition of AGO cleavage assay, using oligos A1 and/or A4 to determine whether bandshift was due to AGO bound to the DNA or cleavege of the ssDNA target-->  Agarose gel revealed several promising bands (see picture). Results have to be dicussed yet.
 +
<br>* test digestion of FokM shows that vector and insert are to small
 +
<br>* test expression of FokM aborted
 +
<br>* new cloning of FokM has to be done tomorrow
 +
<br>*new measurement of concentration of HisFluASplitFoki (dialysed at 03.09.09)
 +
<br>*Agarosegel of yesterdays gradient PCR again showed none of the expected bands.<br>
-
<br>* digest and ligation into new pMA:<br>
+
<table>
-
-pMASplitFokA clone1 19.08.09<br>
+
<tr>
-
-pMAFokA clone2 05.08.09<br>
+
<td align="center">
-
-pMAFoki clone2 05.08.09<br>
+
<img src="https://static.igem.org/mediawiki/2009/5/56/Freiburg09_090909_AGO_PCR.JPG" name="bildone" width="350" heigth="175" /><br></td>
-
-pMASplitFoki clone2 06.08.09<br>
+
-
-pMAshortLi clone2 10.09.09<br>
+
-
-pMAmiddelLi clone2 10.09.09<br>
+
-
-pMAlongLi clone1 10.09.09<br>
+
-
-pMAlongLiFokA clone1 10.09.09<br>
+
-
-pMAlongLiFoki clone1 10.09.09<br>
+
-
digestion with EcoRI and SpeI (vector and insert)
+
<br>
<br>
-
<br>* Transformation of:<br>
+
</tr>
-
-pMAFokA clone2 05.08.09<br>  
+
</table>
-
-pMAFoki clone2 05.08.09<br>
+
-> Gel of the used template "Aa AGO in pET28a 27.08.09 1" revealed an unexpected strong band at app. 20kb. pET28a with the Aa AGO as an insert should be 7.5kb in size. No such band was observed.
-
-pMASplitFoki clone2 06.08.09<br>
+
<br>* Therefore a new PCR was started using the original optimised PCR protocol (first annealing temperature 55°C, second 65°C) using the sample "Aa AGO in pET28a 27.08.09 2" as a template
 +
<br>*measurement of fluorescence of FluA marked oligo, protein, and oligo and protein (quenching)
 +
<br>*inoculation of short, middle and long linker in pMA, pMAFoki and pMAFoka
-
<br>*plasmidprep of:<br>
+
<h3>10.09.09, Manu, Hannes, Christoph, Timo, Gerrit</h3>
-
1. pEX_DsbA+Strep+Dig+Split+FokA Clone1 Quick<br>
+
<br>*His-tag purification with Ni-NTA column of expression products from yesterday (09.09.09)- HisFluASplitFoki
-
2. pEX_DsbA+Strep+Dig+Split+FokA Clone2 Quick<br>
+
<br>*Glycerin Stocks of:
-
3. pEX_DsbA+Strep+Dig+Split+FokA Clone3 Quick<br><br>
+
pMA short linker 1,2 + Fok a/i 1,2 from 09.09.09<br> 
 +
pMA middle linker 4,5 + Fok a/i 4,5 from 09.09.09<br>
 +
pMA long linker 1,2 + Fok a/i 1,2 from 09.09.09<br> 
 +
<br>*Pellets of: 
 +
pMA short linker 3,4,5,6 + Fok a/i 3,4,5,6 from 09.09.09<br>  
 +
pMA middle linker 1,2,3,6 + Fok a/i 1,2,3,6 from 09.09.09<br>
 +
pMA long linker 3,4,5,6 + Fok a/i 3,4,5,6 from 09.09.09<br>
 +
<br>*digestion of pEX_His_fluA_Split_Foki of 26.08.09 with NgoMIV and PstI
 +
<br>*digestion of pMA_36GSlinker of 28.08.09 AgeI and PstI
 +
<br>*gelextraction of vector and insert
 +
<br>*quick ligation of pEX_His_FluA_Split_FokI and 36GSLi
 +
<br>*transformation of pEX_His_FluA_Split_FokI+36GSLi into RV308
 +
<br>*plasmid preparation of pMA short linker, pMA middle linker, pMA long linker
 +
<br>*plasmid preparation of pEX-short/middle/long-Linker-Fok(active/inactive)
 +
<br>*digestion of pEX-short/middle/long-Linker-Fok(active/inactive) with NgoMIV and PstI, over night at 37°C
-
4. pEX_DsbA+His+Dig+Split+FokA Clone1 Quick <br>
+
'''Nanodrop-Data:'''
-
5. pEX_DsbA+His+Dig+Split+FokA Clone2 Quick<br>
+
-
6. pEX_DsbA+His+Dig+Split+FokA Clone3 Quick<br><br>
+
-
7. pEX_DsbA+Strep+Dig+Split+FokA Clone1 --> seq 02.10.09 Gerrit1<br>
+
<table border=1 cellpadding=0 cellspacing=0 width=1055 style='border-collapse:
-
8. pEX_DsbA+Strep+Dig+Split+FokA Clone2 --> seq 02.10.09 Gerrit2<br>
+
collapse;table-layout:fixed;width:500pt'>
-
9. pEX_DsbA+Strep+Dig+Split+FokA Clone3<br><br>
+
<tr height=20 style='height:15.0pt'>
 +
  <td height=20 class=xl6323721 width=260 style='height:15.0pt;width:195pt'>Sample
 +
  ID</td>
 +
  <td class=xl6423721 width=72 style='border-left:none;width:54pt'>User ID</td>
 +
  <td class=xl6423721 width=83 style='border-left:none;width:62pt'>Date<span
 +
  style='mso-spacerun:yes'> </span></td>
 +
  <td class=xl6423721 width=64 style='border-left:none;width:48pt'>Time<span
 +
  style='mso-spacerun:yes'> </span></td>
 +
  <td class=xl6423721 width=64 style='border-left:none;width:48pt'>ng/ul<span
 +
  style='mso-spacerun:yes'> </span></td>
 +
  <td class=xl6423721 width=64 style='border-left:none;width:48pt'>A260<span
 +
  style='mso-spacerun:yes'> </span></td>
 +
  <td class=xl6423721 width=64 style='border-left:none;width:48pt'>A280<span
 +
  style='mso-spacerun:yes'> </span></td>
 +
  <td class=xl6423721 width=64 style='border-left:none;width:48pt'>260/280<span
 +
  style='mso-spacerun:yes'> </span></td>
 +
  <td class=xl6423721 width=64 style='border-left:none;width:48pt'>260/230<span
 +
  style='mso-spacerun:yes'> </span></td>
 +
  <td class=xl6423721 width=64 style='border-left:none;width:48pt'>Constant<span
 +
  style='mso-spacerun:yes'> </span></td>
 +
  </tr>
 +
<tr height=20 style='height:15.0pt'>
 +
  <td height=20 class=xl6323721 style='height:15.0pt;border-top:none'>pMA-Short_Linker
 +
  1</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>FreiGEM</td>
 +
  <td class=xl6523721 style='border-top:none;border-left:none'>10.09.2009</td>
 +
  <td class=xl6623721 style='border-top:none;border-left:none'>12:38</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>140,47</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>2,809</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,461</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,92</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>2,12</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>50</td>
 +
</tr>
 +
<tr height=20 style='height:15.0pt'>
 +
  <td height=20 class=xl6323721 style='height:15.0pt;border-top:none'>pMA-Short_Linker
 +
  2</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>FreiGEM</td>
 +
  <td class=xl6523721 style='border-top:none;border-left:none'>10.09.2009</td>
 +
  <td class=xl6623721 style='border-top:none;border-left:none'>12:39</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>117,82</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>2,356</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,234</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,91</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,99</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>50</td>
 +
  </tr>
 +
<tr height=20 style='height:15.0pt'>
 +
  <td height=20 class=xl6323721 style='height:15.0pt;border-top:none'>pMA-Long_Linker
 +
  1</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>FreiGEM</td>
 +
  <td class=xl6523721 style='border-top:none;border-left:none'>10.09.2009</td>
 +
  <td class=xl6623721 style='border-top:none;border-left:none'>12:40</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>131,21</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>2,624</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,349</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,94</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>2,18</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>50</td>
 +
</tr>
 +
<tr height=20 style='height:15.0pt'>
 +
  <td height=20 class=xl6323721 style='height:15.0pt;border-top:none'>pMA-Long_Linker
 +
  2</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>FreiGEM</td>
 +
  <td class=xl6523721 style='border-top:none;border-left:none'>10.09.2009</td>
 +
  <td class=xl6623721 style='border-top:none;border-left:none'>12:40</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>158,86</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>3,177</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,668</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,9</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,85</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>50</td>
 +
</tr>
 +
<tr height=20 style='height:15.0pt'>
 +
  <td height=20 class=xl6323721 style='height:15.0pt;border-top:none'>pMA-Middle_Linker
 +
  1</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>FreiGEM</td>
 +
  <td class=xl6523721 style='border-top:none;border-left:none'>10.09.2009</td>
 +
  <td class=xl6623721 style='border-top:none;border-left:none'>12:41</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>197,16</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>3,943</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>2,059</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,92</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>2,06</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>50</td>
 +
  </tr>
 +
<tr height=20 style='height:15.0pt'>
 +
  <td height=20 class=xl6323721 style='height:15.0pt;border-top:none'>pMA-Middle_Linker
 +
  2</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>FreiGEM</td>
 +
  <td class=xl6523721 style='border-top:none;border-left:none'>10.09.2009</td>
 +
  <td class=xl6623721 style='border-top:none;border-left:none'>12:42</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>137,14</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>2,743</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,427</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,92</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>2,19</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>50</td>
 +
  </tr>
 +
<tr height=20 style='height:15.0pt'>
 +
  <td height=20 class=xl6323721 style='height:15.0pt;border-top:none'>pMA-Long_Linker-Foka
 +
  1</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>FreiGEM</td>
 +
  <td class=xl6523721 style='border-top:none;border-left:none'>10.09.2009</td>
 +
  <td class=xl6623721 style='border-top:none;border-left:none'>12:43</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>173,32</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>3,466</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,8</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,93</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>2,25</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>50</td>
 +
  </tr>
 +
<tr height=20 style='height:15.0pt'>
 +
  <td height=20 class=xl6323721 style='height:15.0pt;border-top:none'>pMA-Long_Linker-Foka
 +
  2</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>FreiGEM</td>
 +
  <td class=xl6523721 style='border-top:none;border-left:none'>10.09.2009</td>
 +
  <td class=xl6623721 style='border-top:none;border-left:none'>12:44</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>151,38</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>3,028</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,571</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,93</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>2,24</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>50</td>
 +
</tr>
 +
<tr height=20 style='height:15.0pt'>
 +
  <td height=20 class=xl6323721 style='height:15.0pt;border-top:none'>pMA-Long_Linker-Foki
 +
  1</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>FreiGEM</td>
 +
  <td class=xl6523721 style='border-top:none;border-left:none'>10.09.2009</td>
 +
  <td class=xl6623721 style='border-top:none;border-left:none'>12:44</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>156</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>3,12</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,639</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,9</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>2,21</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>50</td>
 +
  </tr>
 +
<tr height=20 style='height:15.0pt'>
 +
  <td height=20 class=xl6323721 style='height:15.0pt;border-top:none'>pMA-Long_Linker-Foki
 +
  2</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>FreiGEM</td>
 +
  <td class=xl6523721 style='border-top:none;border-left:none'>10.09.2009</td>
 +
  <td class=xl6623721 style='border-top:none;border-left:none'>12:45</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>167,47</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>3,349</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,735</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,93</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>2,22</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>50</td>
 +
  </tr>
 +
<tr height=20 style='height:15.0pt'>
 +
  <td height=20 class=xl6323721 style='height:15.0pt;border-top:none'>pMA-Short_Linker-Foki
 +
  1</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>FreiGEM</td>
 +
  <td class=xl6523721 style='border-top:none;border-left:none'>10.09.2009</td>
 +
  <td class=xl6623721 style='border-top:none;border-left:none'>12:45</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>160,29</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>3,206</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,68</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,91</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>2,21</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>50</td>
 +
  </tr>
 +
<tr height=20 style='height:15.0pt'>
 +
  <td height=20 class=xl6323721 style='height:15.0pt;border-top:none'>pMA-Short_Linker-Foki
 +
  2</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>FreiGEM</td>
 +
  <td class=xl6523721 style='border-top:none;border-left:none'>10.09.2009</td>
 +
  <td class=xl6623721 style='border-top:none;border-left:none'>12:46</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>159,35</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>3,187</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,648</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,93</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>2,23</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>50</td>
 +
  </tr>
 +
<tr height=20 style='height:15.0pt'>
 +
  <td height=20 class=xl6323721 style='height:15.0pt;border-top:none'>pMA-Short_Linker-Foka
 +
  1</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>FreiGEM</td>
 +
  <td class=xl6523721 style='border-top:none;border-left:none'>10.09.2009</td>
 +
  <td class=xl6623721 style='border-top:none;border-left:none'>12:47</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>207,54</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>4,151</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>2,191</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,89</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>2,21</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>50</td>
 +
  </tr>
 +
<tr height=20 style='height:15.0pt'>
 +
  <td height=20 class=xl6323721 style='height:15.0pt;border-top:none'>pMA-Short_Linker-Foka
 +
  2</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>FreiGEM</td>
 +
  <td class=xl6523721 style='border-top:none;border-left:none'>10.09.2009</td>
 +
  <td class=xl6623721 style='border-top:none;border-left:none'>12:47</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>200,95</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>4,019</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>2,107</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,91</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>2,21</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>50</td>
 +
  </tr>
 +
<tr height=20 style='height:15.0pt'>
 +
  <td height=20 class=xl6323721 style='height:15.0pt;border-top:none'>pMA-Middle_Linker-Foki
 +
  1</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>FreiGEM</td>
 +
  <td class=xl6523721 style='border-top:none;border-left:none'>10.09.2009</td>
 +
  <td class=xl6623721 style='border-top:none;border-left:none'>12:48</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>185,79</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>3,716</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,939</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,92</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>2,22</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>50</td>
 +
  </tr>
 +
<tr height=20 style='height:15.0pt'>
 +
  <td height=20 class=xl6323721 style='height:15.0pt;border-top:none'>pMA-Middle_Linker-Foki
 +
  2</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>FreiGEM</td>
 +
  <td class=xl6523721 style='border-top:none;border-left:none'>10.09.2009</td>
 +
  <td class=xl6623721 style='border-top:none;border-left:none'>12:49</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>180,42</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>3,608</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,865</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,93</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>2,22</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>50</td>
 +
  </tr>
 +
<tr height=20 style='height:15.0pt'>
 +
  <td height=20 class=xl6323721 style='height:15.0pt;border-top:none'>pMA-Middle_Linker-Foka
 +
  1</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>FreiGEM</td>
 +
  <td class=xl6523721 style='border-top:none;border-left:none'>10.09.2009</td>
 +
  <td class=xl6623721 style='border-top:none;border-left:none'>12:50</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>196,37</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>3,927</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,997</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,97</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>2,19</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>50</td>
 +
  </tr>
 +
<tr height=20 style='height:15.0pt'>
 +
  <td height=20 class=xl6323721 style='height:15.0pt;border-top:none'>pMA-Middle_Linker-Foka
 +
  2</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>FreiGEM</td>
 +
  <td class=xl6523721 style='border-top:none;border-left:none'>10.09.2009</td>
 +
  <td class=xl6623721 style='border-top:none;border-left:none'>12:50</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>180,62</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>3,612</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,895</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,91</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>2,25</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>50</td>
 +
  </tr>
 +
<tr height=20 style='height:15.0pt'>
 +
  <td height=20 class=xl6323721 style='height:15.0pt;border-top:none'>NgoMIV_36GSLi_PstI</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>FreiGEM</td>
 +
  <td class=xl6523721 style='border-top:none;border-left:none'>10.09.2009</td>
 +
  <td class=xl6623721 style='border-top:none;border-left:none'>15:40</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>1,72</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>0,034</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>0</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>-336,01</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>0,01</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>50</td>
 +
  </tr>
 +
<tr height=20 style='height:15.0pt'>
 +
  <td height=20 class=xl6323721 style='height:15.0pt;border-top:none'>pEX_His_FluA-Split_FokI_AgeI_PstI</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>FreiGEM</td>
 +
  <td class=xl6523721 style='border-top:none;border-left:none'>10.09.2009</td>
 +
  <td class=xl6623721 style='border-top:none;border-left:none'>15:41</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>0,52</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>0,01</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>-0,017</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>-0,6</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>0</td>
 +
  <td class=xl6423721 style='border-top:none;border-left:none'>50</td>
 +
  </tr>
 +
</table>
-
10. pEX_DsbA+His+Dig+Split+FokA Clone1 --> seq 02.10.09 Gerrit3<br>
+
<h3>11.09.09, Manu, Hannes, Christoph, Laura, Anika</h3>
-
11. pEX_DsbA+His+Dig+Split+FokA Clone2 --> seq 02.10.09 Gerrit4<br>
+
<br>*labtalk
-
12. pEX_DsbA+His+Dig+Split+FokA Clone3<br><br>
+
<br>*SDS gel of protein purification from yesterday (10.09.09) HisFluASplitFoki
 +
<table>
 +
<tr>
 +
<td align="center">
 +
<img src="https://static.igem.org/mediawiki/2009/5/57/Freiburg09_090911_His_aufreinigungGel1.jpg" name="bildone" width="350" heigth="175" /><br>SDS-Gel; pExHisFluASplitFoki ; Lanes: NEB prestained protein marker, elution fractions E1-5, W1-2, D2-3</td>
-
<br>*testdigest of:
+
<td align="center">
-
V1. pEX_DsbA+Strep+Dig+Split+FokA Clone1 Quick<br>
+
<td align="center">
-
V2. pEX_DsbA+Strep+Dig+Split+FokA Clone2 Quick<br>
+
<img src="https://static.igem.org/mediawiki/2009/e/eb/Freiburg09_090911_His_aufreinigungGel2.jpg" name="bildone" width="350" heigth="175" /><br>SDS-Gel; pExHisFluASplitFoki ; Lanes: NEB prestained protein marker, expression fraction T0, T1, T2, T4, T5</td>
-
V3. pEX_DsbA+Strep+Dig+Split+FokA Clone3 Quick<br><br>
+
-
V4. pEX_DsbA+His+Dig+Split+FokA Clone1 Quick <br>
+
<td align="center">
-
V5. pEX_DsbA+His+Dig+Split+FokA Clone2 Quick<br>
+
<td align="center">
-
V6. pEX_DsbA+His+Dig+Split+FokA Clone3 Quick<br><br>
+
<img src="https://static.igem.org/mediawiki/2009/a/ab/Freiburg09_P7708S_prestained_proteinmarker_broad_range.gif
 +
" name="bildone" width="50" heigth="50" /><br>NEB prestained protein marker broad range</td>
 +
<br>
 +
</tr>
 +
</table>
-
V7. pEX_DsbA+Strep+Dig+Split+FokA Clone1 <br>
+
<br>*concentrations of eluate fractions 1-4 weren't measureable at photometer and nanodrop (weird spectra)
-
V8. pEX_DsbA+Strep+Dig+Split+FokA Clone2 <br>
+
<br>*Eluate fractions 1-4 were frozen at -80°C
-
V9. pEX_DsbA+Strep+Dig+Split+FokA Clone3<br><br>
+
<br>*Checking of the plates pEX_His_FluA_Split_Foki_36GsLi RV308 (Trafo of 10.09.09) showed none Bacteriagrowth, perhaps problems with the GelEX
 +
<br>*gelextraction of NgoMIV-Short/Middle/LongLinker-FokA-PstI (the Fok(inactive) digests didn't work: no bands on the gel)<br><br>
-
V10. pEX_DsbA+His+Dig+Split+FokA Clone1 <br>
+
<h3>14.09.09, Gerrit, Manu, Laura, Anika, Isabel, Timo </h3>
-
V11. pEX_DsbA+His+Dig+Split+FokA Clone2 <br>
+
<br>*fetched a new QuickLigase-Kit at the NEB-Freezer
-
V12. pEX_DsbA+His+Dig+Split+FokA Clone3<br><br>
+
<br>*aliquoted the QuickLigase Buffer to 20 µl aliquots
 +
<br>*Ligation of vector:pEX_His_FluA (gelex from 20.08.09) with insert: Short/Middle/Long-Linker-Foka(Gelex from 11.09.09)<br>
 +
Vector: 3 µl pEX_His_FluA from 20.08.09 (digested with AgeI and PstI)<br>
 +
Insert: 6 µl Short/Middle/Long-Linker(Gelex from 11.09.09, digested with NgoMIV and PstI)<br>
 +
buffer: 10 µl Quick ligase buffer from NEB iGEM stock<br>
 +
Ligase: 1 µl Quick ligase NEB iGEM stock<br>
-
V13. pEX_Strep+Dig+Split+FokA prep from 25.09.09 (tobi stock)<br>
+
<br>*Ligation of vector:pEX_His_Dig (gelex from 27.08.09) with insert: Short/Middle/Long-Linker-Foka(Gelex from 11.09.09)<br>
-
V14. pEX_His+Dig+Split+FokA prep from 25.09.09 (tobi stock)<br>
+
Vector: 3 µl pEX_His_FluA from 27.08.09 (digested with AgeI and PstI)<br>
-
with NcoI-HF and XbaI 1h at 37°C<br>
+
Insert: 6 µl Short/Middle/Long-Linker(Gelex from 11.09.09, digested with NgoMIV and PstI)<br>
 +
buffer: 10 µl Quick ligase buffer from NEB iGEM stock<br>
 +
Ligase: 1 µl Quick ligase NEB iGEM stock<br>
-
--> geldbild
+
<br>*Ligation of vector:pEX_Strep_Dig (gelex from 27.08.09) with insert: Short/Middle/Long-Linker-Foka(Gelex from 11.09.09)<br>
 +
Vector: 3 µl pEX_His_FluA from 27.08.09 (digested with AgeI and PstI)<br>
 +
Insert: 6 µl Short/Middle/Long-Linker(Gelex from 11.09.09, digested with NgoMIV and PstI)<br>
 +
buffer: 10 µl Quick ligase buffer from NEB iGEM stock<br>
 +
Ligase: 1 µl Quick ligase NEB iGEM stock<br>
-
<h3>03.10.09 Manu, Hannes, Gerrit, Caro, Timo, Christoph </h3>
+
<br>*Ligation of vector:pMA_Foki (gelex from 27.08.09) with insert: Short/Middle/Long-Linker(hybridized 07.09.09)<br>
-
<br>*plasmid prep of pET and pBad and Glytsocks(Xbl)
+
Vector: 3 µl pMA_Foki (digested with XbaI and NgoMIV)<br>
-
<br>*new aliquots Ampicilin (70%EtOH)
+
Insert: 6 µl Short/Middle/Long-Linker(cutting sites: NgoMIV and PstI)<br>
-
<br>*Test digest M13dsDNA+fokI as control for dsDNA , the pictures showed the two expected lanes(hardly visible on the printout).
+
buffer: 10 µl Quick ligase buffer from NEB iGEM stock<br>
 +
Ligase: 1 µl Quick ligase NEB iGEM stock<br>
 +
<br>*transformation of pEx-His-FluA-Short/Middle/LongLinker-Fok(active) into RV308
 +
<br>*transformation of pEx-His-Dig-Short/Middle/LongLinker-Fok(active) into RV308
 +
<br>*transformation of pEx-Strep-Dig-Short/Middle/LongLinker-Fok(active) into RV308
 +
<br>*transformation of pMA-Short/Middle/LongLinker-Fok(inactive) into RV308
 +
<br>*prepared SDS gels
 +
<br>*Digest of pMA_Foki(prep I 05.08.09) with XbaI and NgoMIV<br>
 +
Plasmid: 10 µl<br>
 +
water: 14.5 µl<br>
 +
BSA: 0.5 µl NEB iGEM stock<br>
 +
buffer: 3 µl buffer 4 igem stock<br>
 +
Restriction_enzyme_1 : 1 µl XbaI from NEB KuKlabstock<br>
 +
Restriction_enzyme_2 : 1 µl NgoMIV from NEB KuKlabstock <br>
 +
-> preparative gel, freezed gel slice in case ligation won't work again
 +
<br>*test-digest of pMA_short/middle/longlinker_Foka/i(prep 10.09.09) with FokI<br>
 +
Plasmid: 4 µl<br>
 +
buffer: 0.5 µl buffer 4 igem stock<br>
 +
Restriction_enzyme_1 : 0.5 µl FokI from igem stock<br>
-
[[Image:Freiburg09 091003 M13test 005.jpg|none|thumb|Agarose gel; M13dsDNA test digest; Lanes: DNA ladder mix ,empty , M13dsDNA02.10.09, M13dsDNA02.10.09 digest fokI |400x400px]]
+
<table>
-
<br>*digest of
+
<tr>
-
- pEx-Strep-Dig-LongLinker-Fok(inactive)<br>
+
<td align="center">
-
- pEx-Strep-Dig-MiddleLinker-Fok(inactive)<br>
+
<img src="https://static.igem.org/mediawiki/2009/c/c8/Freiburg09_14.09.09_testverdau1.JPG" name="bildone" width="350" heigth="175" /><br>Analytical agarose-Gel; Lanes: NEB 100 bp DNA ladder, pMAShortliFoka, pMAMiddleliFoka, pMALongliFoka, pMAShortliFoki, pMAMiddleliFoki, pMALongliFoki,</td>
-
- pEx-Strep-Dig-ShortLinker-Fok(inactive)<br>
+
<br>
-
- pEx-Strep-Dig-SplitLinker-Fok(inactive)<br>
+
</tr>
-
- pEx-His-Dig-SplitLinker_Fok(inactive)<br>
+
</table>
-
- pEx-His-Dig-SplitLinker_Fok(active)<br>
+
-> all probes were sent to sequencing<br>
-
- pEx-Strep-Dig-SplitLinker-Fok(active)<br>
+
<br>*ordering of fluorscin marked oligos
-
- pEx-His-Dig-LongLinker-Fok(inactive)<br>
+
<br>*preparation of competent cells: RV308, there is no antibiotic in the approach because this bacterial strain has no resistance(on shaker in 37°C romm over night until tomorrow)
-
- pEx-His-FluA-LongLinker-Fok(inactive)<br>
+
<br>*planning of Fos_bZip with freigem restricion sites
-
- pEx-His-FluA-MiddleLinker-Fok(inactive)<br>
+
-
- pEx-His-FluA-ShortLinker-Fok(inactive)<br>
+
-
- pEx-His-FluA-SplitLinker-Fok(inactive)<br>
+
-
- pEx-His-Dig<br>
+
-
- pMA<br>
+
-
with NgoMIV and SpeI
+
-
<br>*digest of
+
-
- pMA<br>
+
-
with XbaI and AgeI
+
-
<br>*Ligation of:
+
<br>* Sequencing of  
-
- Strep-Dig-LongLinker-Fok(inactive)<br>
+
-
- Strep-Dig-MiddleLinker-Fok(inactive)<br>
+
-
- trep-Dig-ShortLinker-Fok(inactive)<br>
+
-
- Strep-Dig-SplitLinker-Fok(inactive)<br>
+
-
- His-Dig-SplitLinker_Fok(inactive)<br>
+
-
- His-Dig-SplitLinker_Fok(active)<br>
+
-
- Strep-Dig-SplitLinker-Fok(active)<br>
+
-
- His-Dig-LongLinker-Fok(inactive)<br>
+
-
- His-FluA-LongLinker-Fok(inactive)<br>
+
-
- His-FluA-MiddleLinker-Fok(inactive)<br>
+
-
- His-FluA-ShortLinker-Fok(inactive)<br>
+
-
- His-FluA-SplitLinker-Fok(inactive)<br>
+
-
into pMA<br>
+
-
and<br>
+
- pMAShortlinker clone 1 plasmid prep of 10.09<br>
-
- Strep-Dig-LongLinker-Fok(inactive)<br>
+
- pMAmiddellinker clone 2(4) plasmid prep of 10.09<br>
-
- Strep-Dig-MiddleLinker-Fok(inactive)<br>
+
- pMAlonglinker clone 1 plasmid prep of 10.09<br>
-
- trep-Dig-ShortLinker-Fok(inactive)<br>
+
- pMAShortlinker+FokA clone 2 plasmid prep of 10.09<br>
-
into new pEX
+
- pMAShortlinker+FokI clone 2 plasmid prep of 10.09<br>
 +
- pMAmiddellinker+FokA clone 4(2) plasmid prep of 10.09<br>
 +
- pMAmiddellinker+FokI clone 4 plasmid prep of 10.09<br>
 +
- pMAlonglinker+FokI clone 1 plasmid prep of 10.09<br>
 +
- pMAlonglinker+FokA clone 1 plasmid prep of 10.09<br>
-
<br>*inoculation of:
+
<br>* digest with HaeII (+76, NEB IV, BSA) of 28 minipreps
-
-pMASplitFokA clone1 19.08.09<br>
+
Plasmid: 5 µl<br>
-
-pMAFokA clone2 05.08.09 (new)<br>
+
water: 3,6 µl<br>
-
-pMAFoki clone2 05.08.09 (new)<br>
+
BSA: 0.1 µl (100x)from iGEM stock<br>
-
-pMASplitFoki clone2 06.08.09 (new)<br>
+
buffer NEB IV: 1 µl buffer (10x)from iGEM stock<br>
-
-pMAshortLi clone2 10.09.09<br>
+
Restriction_enzyme_1 : 0,3 µl HaeII<br>
-
-pMAmiddelLi clone2 10.09.09<br>
+
-
-pMAlongLi clone1 10.09.09<br>
+
-
-pMAlongLiFokA clone1 10.09.09<br>
+
-
-pMAlongLiFoki clone1 10.09.09<br><br>
+
-
-pMAFokA clone2 05.08.09 (old)<br>
+
-
-pMAFoki clone2 05.08.09 (old)<br>
+
-
-pMASplitFoki clone2 06.08.09 (old)<br>
+
-
<br>*inoculation and plasmid preperation:
+
<br>*preparative gel (1%)
-
-pEX_strepFluA
+
Marker 1kb; -Eco 86/88; -Eco 86/89; TTT 86/88; TTT 86/89; Taq 86/88; Taq 86/89
-
<br>*Quenching test with HisFluASplitFoki and fluorescin-tagged oligos
+
Marker 1kb; -Eco 87/88; -Eco 87/89; TTT 87/88; TTT 87/89; Taq 87/88
-
<br>*BB Ago Pcr via Taq
+
-
<br>*Started makin new VCS M13 Phages see Protocol day 1
+
-
<h3>Plan for 04.10.09</h3>
+
<br>*gel extraction of (kit from Janina)
-
<br>*inoculation of
+
Taq 86/88, Taq 86/89, Taq 87/88, Taq 87/89 in 50 µl 70°C water
-
- pMA-Strep-Dig-LongLinker-Fok(inactive)<br>
+
-
- pMA-Strep-Dig-MiddleLinker-Fok(inactive)<br>
+
-
- pMA-Strep-Dig-ShortLinker-Fok(inactive)<br>
+
-
- pMA-Strep-Dig-SplitLinker-Fok(inactive)<br>
+
-
- pMA-His-Dig-SplitLinker_Fok(inactive)<br>
+
-
- pMA-His-Dig-SplitLinker_Fok(inactive)<br>
+
-
- pMA-Strep-Dig-SplitLinker-Fok(active)<br>
+
-
- pMA-His-Dig-LongLinker-Fok(inactive)<br>
+
-
- pMA-His-FluA-LongLinker-Fok(inactive)<br>
+
-
- pMA-His-FluA-MiddleLinker-Fok(inactive)<br>
+
-
- pMA-His-FluA-ShortLinker-Fok(inactive)<br>
+
-
- pMA-His-FluA-SplitLinker-Fok(inactive)<br>
+
-
into LB-Amp
+
-
<br>*digestion of pEx-Strep-Flua with AgeI and PstI
+
-
<br>*digestion of pMA-Short/Middle/Long/Split-Fok(active and inactive)
+
-
<br>*ligation of the above parts and transformation into RV308
+
-
<br>*plasmid preparation of...
+
-
-pMASplitFokA <br>
+
<br>*analytic gel (1%)
-
-pMAFokA <br>
+
Marker 1kb; samples 442-1, 442-2, 442-3; samples 443-1, 443-2, 443-3; 427-1 to -12; 424-1 to -12; Taq 87/89
-
-pMAFoki <br>
+
-
-pMASplitFoki <br>
+
-
-pMAshortLi<br>
+
-
-pMAmiddelLi<br>
+
-
-pMAlongLi <br>
+
-
-pMAlongLiFokA <br>
+
-
-pMAlongLiFoki <br>
+
-
-pMAFokA (old)<br>
+
-
-pMAFoki (old)<br>
+
-
-pMASplitFoki (old)<br>
+
-
<h3>04.10.09, Laura, Anika, Max</h3>
+
<br>*transformation of EcoRI-removal
-
<br>* Plasmid preparation of  
+
ligation TorA-flag and DsbA-flag, vector control
-
-pMASplitFokA <br>
+
-
-pMAFokA <br>
+
-
-pMAFoki <br>
+
-
-pMASplitFoki <br>
+
-
-pMAshortLiFokA<br>
+
-
-pMAshortLiFoki<br>
+
-
-pMAmiddelLiFokA<br>
+
-
-pMAmiddelLiFoki<br>
+
-
-pMAlongLiFokA <br>
+
-
-pMAlongLiFoki <br>
+
-
-pMAFokA (old)<br>
+
-
-pMAFoki (old)<br>
+
-
-pMASplitFoki (old)<br>
+
-
clone 1 and 2,respectively - results see notebook<br>
+
-
<br>* Glycerolstock of <br>
+
-
-pMASplitFokA <br>
+
-
-pMAFokA <br>
+
-
-pMAFoki <br>
+
-
-pMASplitFoki <br>
+
-
-pMAshortLiFokA<br>
+
-
-pMAshortLiFoki<br>
+
-
-pMAmiddelLiFokA<br>
+
-
-pMAmiddelLiFoki<br>
+
-
-pMAlongLiFokA <br>
+
-
-pMAlongLiFoki <br>
+
-
-pMAFokA (old)<br>
+
-
-pMAFoki (old)<br>
+
-
-pMASplitFoki (old)<br>
+
-
clone 3
+
-
<br>* Pellets of<br>
+
-
-pMASplitFokA <br>
+
-
-pMAFokA <br>
+
-
-pMAFoki <br>
+
-
-pMASplitFoki <br>
+
-
-pMAshortLiFokA<br>
+
-
-pMAshortLiFoki<br>
+
-
-pMAmiddelLiFokA<br>
+
-
-pMAmiddelLiFoki<br>
+
-
-pMAlongLiFokA <br>
+
-
-pMAlongLiFoki <br>
+
-
-pMAFokA (old)<br>
+
-
-pMAFoki (old)<br>
+
-
-pMASplitFoki (old)<br>
+
-
clone 1 and 2,respectively - stored in Pelletbox, -20°C
+
-
<br>*Digest of
+
-
1. pEXHisDigMiddleLFoki
+
-
2. pMaScFaantiNIP
+
-
3. prep of Ligation pEX+CAT of 09.07.09 old
+
-
4. pMAShortLFoka<br>
+
-
5. pMAShortLFoki<br>
+
-
6. pMAMiddleLFoka<br>
+
-
7. pMAMiddleLFoki<br>
+
-
8. pMALongLFoka<br>
+
-
9. pMALongLFoki<br>
+
-
10.pEXStrepFlua<br>
+
-
<br>*Preparative Gel of Digest<br>
+
-
[[Image:Freiburg09_041009_umklonierung_gel.JPG|none|thumb|Agarose gel; Lanes: 1. pEXHisDigMiddleLFoki, 2. pMaScFaantiNIP, 3. pEX+CAT, 4. pMAShortLFoka, 5. pMAShortLFoki, 6. pMAMiddleLFoka, 7. pMAMiddleLFoki, 8. pMALongLFoka, 9. pMALongLFoki,10.pEXStrepFlua|400x400px]]
+
-
Freiburg09_041009_umklonierung_gel.JPG
+
-
<br>*Gelextraction<br>
+
-
<br>*Ligation of<br>
+
-
1.pMAHisDigMiddleFoki<br>
+
-
2.pMACAT<br>
+
-
3.pEXStrepFluAShortLFokA<br>
+
-
4.pEXStrepFluAShortLFoki<br>
+
-
5.pEXStrepFluAmiddleLFokA<br>
+
-
6.pEXStrepFluAMiddleLFoki<br>
+
-
7.pEXStrepFluALongLFokA<br>
+
-
8.pEXStrepFluALongLFoki<br>
+
-
9.JS 419StrepDigSplitFokA<br>
+
-
10.JS 419HisDigSplitFokA<br>
+
-
11.JS 418HisDigSplitFokA<br>
+
-
Approach: 8µl H2O, 3 µl Vector, 6µl Insert, 2µl Quick Ligase Buffer, 1 µl Quick Ligase, 15 min, Room Temp.<br>
+
-
<br>*Dephosphorylation of pBAD Vector: <br>
+
-
Approach: 2µl Eluat, 3,1 µl Fast Ap Buffer 10x, 1µl Fast Ap, 10 min. 37°C, 5 min. 75°C<br>
+
-
<br>*Transformation of<br>
+
-
1.pMAHisDigMiddleFoki (RV)<br>
+
-
2.pMACAT(RV)<br>
+
-
3.pEXStrepFluAShortLFokA(RV)<br>
+
-
4.pEXStrepFluAShortLFoki(RV)<br>
+
-
5.pEXStrepFluAmiddleLFokA(RV)<br>
+
-
6.pEXStrepFluAMiddleLFoki(RV)<br>
+
-
7.pEXStrepFluALongLFokA(RV)<br>
+
-
8.pEXStrepFluALongLFoki(RV)<br>
+
-
9.pBAD (RV)<br>
+
-
10.pJS 419StrepDigSplitFokA(XBL)<br>
+
-
11.pJS 419HisDigSplitFokA(XBL)<br>
+
-
12.pJS 418HisDigSplitFokA(XBL)<br>
+
-
<br>*test digest of plasmid preps from today
+
-
-> run on a gel with digest pET39, xbaI, ecoRI from Tobi
+
-
<br>*starter culture of pEx_DsbA_HisDigSplitFoka
+
-
-> modified expression has to be done tomorrow
+
-
<br>*inoculation of pJS418 and pJS419 for glycerolstocks tomorrow
+
-
<br>*Taq AGO BB PCR did not work
+
<br>* Inoculation of:
 +
- startingculture His+Dig+Split+FokA (from 31.08.09)
 +
200ml LB+200µl Amp + 2g glucose --> 24°C 180rpm
-
<br>*Phageproduction day 2
+
<h3>15.09.09, Manu, Hannes, Gerrit, Anika, Sarah, Laura </h3>
 +
<br>*over-night culture of pEX-His-Dig-Split-Fok(active) showed an OD(600) of 0,132. No expression was started.
 +
<br>*the LB/Amp plates of pEx-His/Strep-Flua/Dig-Short/Middle/LongLinker-Fok(active) show only few colonies. One construct is completly missing (pEx-His-Dig-ShortLinker-Fok(active)).
 +
<br>*the LB/Amp plates of pMA-Short/Middle/LongLinker-Fok(inactive) showed many colonies.
 +
<br>* Plamidpreparation of RV308 pMA_36GSLi Klon3/4(plate from 27.08.09), glycerol stocks and sequencing
 +
<br>* continued phage display:
 +
digestion of 442-1 of 14.09.09 with XmnI and NheI<br>
 +
Plasmid: 20 µl<br>
 +
water: 3,7 µl<br>
 +
BSA: 0.3 µl (100x)from iGEM stock<br>
 +
buffer NEB IV: 3 µl buffer (10x)from iGEM stock<br>
 +
Restriction_enzyme_1 : 1,5 µl XmnI from NEB KuKlabstock<br>
 +
Restriction_enzyme_2 : 1,5 µl NheI from NEB KuKlabstock<br>
 +
digestion of 443-1 of 14.09.09 with XmnI and NheI<br>
 +
Plasmid: 18 µl<br>
 +
water: 5,7 µl<br>
 +
BSA: 0.3 µl (100x)from iGEM stock<br>
 +
buffer NEB IV: 3 µl buffer (10x)from iGEM stock<br>
 +
Restriction_enzyme_1 : 1,5 µl XmnI from NEB KuKlabstock<br>
 +
Restriction_enzyme_2 : 1,5 µl NheI from NEB KuKlabstock<br>
 +
finished transformation of 436;423-427 and V/1;V/6;V/411;V/375<br>
 +
<br>*chemical competent cells of RV308
 +
<br>*glycerol stock of RV308
 +
<br>*preparation of electrical competent cells: RV308, there is no antibiotic in the approach because this bacterial strain has no resistance(on shaker in 37°C romm over night until tomorrow)
 +
<br>*simulated Hybridization of M13 DNA - hybridization with Fok control 2 & 3 oligos<br>
 +
- 10µl M12 ssDNA<br>
 +
- 10µl MgCl from iGEm Stock<br>
 +
- 5µl Tris-HCl<br>
 +
- 2µl Fok-Kontrolle 2 (org. Tube from 28.07.09)<br>
 +
- 2µl Fok-Kontrolle 3 (org tube from 06.08.09)<br>
 +
<br>* Testdigest with FokI with:<br>
 +
10µl M13DNA+Oligo2+3<br>
 +
1,2µl Puffer4<br>
 +
1µl FokI<br>
-
<h3>05.10.09, Laura, Manu, Julia, Christophe, Caro, Hannes, Gerrit, Anika</h3>
+
Gel:<br>
 +
Marker / ssDNA+Oligo2+3+Fok / ssDNA+Oligo2+3+Fok / ssDNA+Oligo2+3 37° / ssDNA+ Oligo2+3 4°<br>
 +
BILD<br>
 +
<br>*ordered His_GSG_Fos_bZip
-
<br>* 3l LB and 2L LB Agar
+
<h3>16.09.09,Gerrit, Anika, Sarah, Laura, Isabel </h3>
-
<br>*Periplasma Project
+
<br>*made plasmid preparation of
 +
pEX-Strep-Dig-middleLinker-FokA clone 1 and clone 2<br>
 +
pEX-Strep-Dig-shortLinker-FokA clone 1 and clone 2<br>
 +
pEX-His-Dig-middleLinker-FokA clone 1 and clone 2<br>
 +
pEX-His-FluA-shortLinker-FokA clone 1 and clone 2<br>
 +
pEX-His-FluA-middleLinker-FokA clone 1 and clone 2<br>
 +
pMA-shortLinker-FokI clone 1 and clone 2<br>
 +
pMA-middleLinker-FokI clone 1 and clone 2<br>
 +
pMA-longLinker-FokI clone 1 and clone 2<br>
-
<br>*digest pExHisFluASplitFoki (prep from 24.08.09) and RBS_StrepDigSplitFoka (prep from 29.09.09)
+
glycerol stocks stored in "iGEM AA" at -80°C
-
<br>*test digests of pMAFoka, pMALongliFoki, pMAFoka old, pMAFoki old, pExHisFluASplitFokiStrepDigSplitFoka
+
-
<br>*1) Gelextraction<br>
+
-
--> Gelbild <br>
+
<br>*continued phage display
 +
- plasmid preparation of:<br>
 +
444-1,444-2,444-3;445-1,445-2,445-3;443-1;442-1<br>
 +
- sequencing of 444-1 and 445-1 with primer:sfLacP1<br>
 +
- digest of 444-1 and 445-1 with SfiI and NheI<br>
 +
'''444-1'''<br>
 +
Plasmid: 19 µl<br>
 +
water: 5 µl<br>
 +
BSA: 0.3 µl (100x)from iGEM stock<br>
 +
buffer NEB IV: 3 µl buffer (10x)from iGEM stock<br>
 +
Restriction_enzyme_1 : 1,5 µl SfiI from NEB KuKlabstock<br>
 +
Restriction_enzyme_2 : 1,5 µl NheI from NEB KuKlabstock<br>
 +
'''445-1'''<br>
 +
Plasmid: 15 µl<br>
 +
water: 9 µl<br>
 +
BSA: 0.3 µl (100x)from iGEM stock<br>
 +
buffer NEB IV: 3 µl buffer (10x)from iGEM stock<br>
 +
Restriction_enzyme_1 : 1,5 µl SfiI from NEB KuKlabstock<br>
 +
Restriction_enzyme_2 : 1,5 µl NheI from NEB KuKlabstock<br>
 +
- preparative gel (1%)of digest of 442-1 and 443-1, 440-5<br>
 +
<br>*expression cultures (4 flasks à 1l) of HisDigSplitFoka
 +
- took pellets at T0-T4<br>
 +
- centrifuged at 4000 rpm, 4°C, 20 min<br>
 +
- froozen pellets in -80°C<br>
 +
<br>*made 5l LB medium
 +
<br>* electrical competent cells of RV308, stored in box at -80°C
-
1) Vector: pEXHisFluSplitFoki<br>
+
<h3>17.09.09,Hannes, Anika, Sarah, Laura, Isabel, Timo, Manuel </h3>
-
2)Insert: RBSStrepDigSplitFokA<br>
+
<br>*Digest of pEX_His_FluA (prep 20.08.09 clone), pExHisDig (prep 27.08.09, clone 1) and  pExStrepDig (prep 27.08.09, clone 1) with AgeI and SpeI<br>
-
3)PET39b+<br>
+
Plasmid: 10 µl<br>
 +
water: 14.5 µl<br>
 +
BSA: 0.5 µl NEB iGEM stock<br>
 +
buffer: 3 µl buffer 4 NEB iGEM stock<br>
 +
Restriction_enzyme_1 : 2 µl AgeI from NEB KuKlabstock<br>
 +
Restriction_enzyme_2 : 1 µl SpeI from NEB KuKlabstock <br>
 +
<br>*Digest of pMA_Shortli_Foki (prep 10.09.09 clone 2), pMA_Middleli_Foki (prep 10.09.09 clone 4) and  pMA_Longli_Foki (prep 10.09.09 clone 1) with NgoMIV and SpeI<br>
 +
Plasmid: 10 µl<br>
 +
water: 14.5 µl<br>
 +
BSA: 0.5 µl NEB iGEM stock<br>
 +
buffer: 3 µl buffer 4 NEB iGEM stock<br>
 +
Restriction_enzyme_1 : 1 µl NgoMIV from NEB KuKlabstock<br>
 +
Restriction_enzyme_2 : 1 µl SpeI from NEB KuKlabstock <br>
 +
-> stored in -20°C
 +
<br>*preparation of binding buffer, washing buffer I and II and elution buffer for the ni-column
 +
<br>*purification of the expression cultures of 16.09.09 HisDigSplitFoka  (ni-column)
 +
<br>*'''continued the phage display:'''
 +
<br>*preparation of 425-1 to 425-10; 428-1 to 428-10; 423-1,424-1,426-1,427-1,429-1,436-1<br>
 +
<br>*test digest of all 425 and 428 probes with HaeII<br>
 +
DNA: 5 µl<br>
 +
water: 3,7 µl<br>
 +
BSA: 0.1 µl NEB iGEM stock<br>
 +
buffer: 1 µl buffer 4 NEB iGEM stock<br>
 +
Restriction_enzyme : 0,2 µl HaeII from NEB KuKlabstock<br>
 +
<br>*dephosphorylation of the vector fragments 444 and 445 with SAP to stop the digest (2x1µl for 30min 37°C and 1X20min 70°C)<br>
 +
<br>*preparative gel of the vector fragments pJs#375(digest and re-digest), 444 and 445 and gel extraction<br>
-
<br>*2)Ligation<br>
+
<h3>18.09.09 Isabel, Sarah, Laura, Manu, Timo, Hannes, Anika </h3>
-
-10ul 2 fold buffer<br>
+
'''<br>*continued phage display'''
-
- 6 µl Insert<br>
+
<br>*sequencing of 423,424,426,427,429,436<br>
-
-3µl Vector<br>
+
<br>*analytical gel of test digests of 425 (1-10) and 428 (1-10) and sequencing of
-
-1µl Quick Ligase<br>
+
<br>*ligation of V/444, V7445 and V/375 re-digest with 3 approaches:
 +
'''1)''' 1µl vector<br>
 +
5µl insert 10<br>
 +
1µl ligase buffer<br>
 +
1µl T4 ligase<br>
 +
2µl water<br>
 +
'''2)''' 1µl vector<br>
 +
5µl insert 11<br>
 +
1µl ligase buffer<br>
 +
1µl T4 ligase<br>
 +
2µl water<br>
 +
'''3)''' 1µl vector<br>
 +
1µl ligase buffer<br>
 +
1µl T4 ligase<br>
 +
7µl water<br>
-
--> 15 min at RT<br>
 
-
Vector:pEXHisFluSplitFoki + Insert:RBSStrepDigSplitFokA<br>
+
<h3>19.09.09 Julia </h3>
-
<br>*3)Transformation<br>
+
<br>*Put plates from 37°C and digestion from 37°C room to the cooling room at 4°C
-
-5 µl DNA of Ligation + BL21d3 and XBL
+
<br>*Centrifuged 427-1; 424-1 down and froze the pellet at -20°C
-
<br>*'''Mini prep with with Qiagen Spin Miniprep Kit of'''
+
<h3>21.09.09 Laura, Gerrit, Isabel, Sarah, Hannes, Anika, Julia </h3>
 +
<br>*continued phage display
 +
-plasmidpreparation of 424-1,424-2,424-3 and 427-1,427-2,427-3<br>
 +
-digestion of 424-1 with XmnI and NheI (37°C) for 6h<br>
 +
DNA: 58µl<br>
 +
buffer IV:11µl<br>
 +
BSA:1,1µl<br>
 +
enzyme_1: 1,5µl<br>
 +
enzyme_2: 1,5µl<br>
 +
-new digest of 444-1 and 445-1 with SfiI (50°C)for 6h and then with NheI (37°C over night)<br>
 +
'''444-1'''
 +
DNA: 19µl<br>
 +
buffer IV:3µl<br>
 +
BSA:0,3µl<br>
 +
water:4,7µl<br>
 +
enzyme_1: 1,5µl<br>
 +
enzyme_2: 1,5µl<br>
 +
'''445-1'''
 +
DNA: 15µl<br>
 +
buffer IV:3µl<br>
 +
BSA:0,3µl<br>
 +
water:8,7µl<br>
 +
enzyme_1: 1,5µl<br>
 +
enzyme_2: 1,5µl<br>
 +
-ligation of digests of 444-1,445-1 and 375(re-digest)
 +
<br>*SDS gel of HisDigSplitFoka
-
- pMA-Strep-Dig-LongLinker-Fok(inactive)1,2,3<br>
+
<table>
-
- pMA-Strep-Dig-MiddleLinker-Fok(inactive)1,2,3<br>
+
<tr>
-
- pMA-Strep-Dig-ShortLinker-Fok(inactive)1,2,3<br>
+
<td align="center">
-
- pMA-Strep-Dig-SplitLinker-Fok(inactive)1,2,3<br>
+
<img src="https://static.igem.org/mediawiki/2009/d/de/Freiburg09_210909_pg_HisDigSplitFoka022.jpg" name="bildone" width="350" heigth="175" /><br>SDS-Gel; HisDigSplitFoka; Lanes: NEB prestained protein markerbroad range, elution fraction 1-9</td>
-
- pMA-His-Dig-SplitLinker_Fok(inactive)1,2,3<br>
+
-
- pMA-His-Dig-SplitLinker_Fok(inactive)1,2,3<br>
+
-
- pMA-Strep-Dig-SplitLinker-Fok(active)1,2,3<br>
+
-
- pMA-His-Dig-LongLinker-Fok(inactive)1,2,3<br>
+
-
- pMA-His-FluA-LongLinker-Fok(inactive)1,2,3<br>
+
-
- pMA-His-FluA-MiddleLinker-Fok(inactive)1,2,3<br>
+
-
- pMA-His-FluA-ShortLinker-Fok(inactive)1,2,3<br>
+
-
- pMA-His-FluA-SplitLinker-Fok(inactive)1,2,3<br>
+
-
- pMA-Dbsa 1,2,3
+
-
<br>*'''Made Glycerolstocks of'''
+
<td align="center">
 +
<td align="center">
 +
<img src="https://static.igem.org/mediawiki/2009/9/9f/Freiburg09_210909_pg_HisDigSplitFoka_pellets_u_wasch023.jpg
 +
" name="bildone" width="350" heigth="175" /><br>SDS-Gel; HisDigSplitFoka; Lanes: NEB prestained protein markerbroad range, t0 (before induction), t1 (1 hour after induction), t2 (2 hours after induction), t3 (3 hours after induction), t4 (4 hours after induction), flow through fraction 1, flow through fraction 3, washing fraction 1, washing fraction 3 </td>
-
<br>*700µl Cellsuspension+ 300µl Glycerol
+
<td align="center">
-
- pMA-Strep-Dig-LongLinker-Fok(inactive)1,2,3<br>
+
<td align="center">
-
- pMA-Strep-Dig-MiddleLinker-Fok(inactive)1,2,3<br>
+
<img src="https://static.igem.org/mediawiki/2009/a/ab/Freiburg09_P7708S_prestained_proteinmarker_broad_range.gif
-
- pMA-Strep-Dig-ShortLinker-Fok(inactive)1,2,3<br>
+
" name="bildone" width="50" heigth="50" /><br>NEB prestained protein marker broad range</td>
-
- pMA-Strep-Dig-SplitLinker-Fok(inactive)1,2,3<br>
+
-
- pMA-His-Dig-SplitLinker_Fok(inactive)1,2,3<br>
+
-
- pMA-His-Dig-SplitLinker_Fok(active)1,2,3<br>
+
-
- pMA-Strep-Dig-SplitLinker-Fok(active)1,2,3<br>
+
-
- pMA-His-Dig-LongLinker-Fok(inactive)1,2,3<br>
+
-
- pMA-His-FluA-LongLinker-Fok(inactive)1,2,3<br>
+
-
- pMA-His-FluA-MiddleLinker-Fok(inactive)1,2,3<br>
+
-
- pMA-His-FluA-ShortLinker-Fok(inactive)1,2,3<br>
+
-
- pMA-His-FluA-SplitLinker-Fok(inactive)1,2,3<br>
+
-
- pMA-Dbsa 1,2,3
+
-
<br>*'''Test Digestion of'''
+
<br>
 +
</tr>
 +
</table>
-
<br>*put in each sample: 5µl DNA, 2,5µl H2O, 1µl Buffer 3, 1µl EcoRI, 1µl PstI, 1µl BSA
 
-
- pMA-Strep-Dig-LongLinker-Fok(inactive)3<br>
+
<br>* Transformation with chemical and electro competent cells(RV 308):<br>
-
- pMA-Strep-Dig-MiddleLinker-Fok(inactive)1<br>
+
- did not work with chemical competent cells<br>
-
- pMA-Strep-Dig-ShortLinker-Fok(inactive)1<br>
+
- but worked with electro competent cells, absorption wavelength 400 nm (like CFP)<br>
-
- pMA-Strep-Dig-SplitLinker-Fok(inactive)3<br>
+
(pictures coming soon, not finished jet)
-
- pMA-His-Dig-SplitLinker_Fok(inactive)1<br>
+
-
- pMA-His-Dig-SplitLinker_Fok(active)2<br>
+
-
- pMA-Strep-Dig-SplitLinker-Fok(active)1<br>
+
-
- pMA-His-Dig-LongLinker-Fok(inactive)1<br>
+
-
- pMA-His-FluA-LongLinker-Fok(inactive)3<br>
+
-
- pMA-His-FluA-MiddleLinker-Fok(inactive)3<br>
+
-
- pMA-His-FluA-ShortLinker-Fok(inactive)1<br>
+
-
- pMA-His-FluA-SplitLinker-Fok(inactive)2<br>
+
-
- pMA-Dbsa 2<br>
+
-
<br>* Transformation of<br>
+
<br>*Gel extraction with GelEx Kit from Quiagen: pEX-StrepDig, pEX-HisFluA, pEX-HisDig, short-linker Foki, middle-linker Foki, long-linker Foki
-
- XBL pEXHisFluASplitFokIRBSStrepDigSplitFokA<br>
+
<br>*Ligation with QuickLigase:
-
- BL21de3 pEXHisFluASplitFokIRBSStrepDigSplitFokA<br>
+
-short-linker Foki +pEx-HisDig/+pEX-HisFluA/+pEX-StrepDig
-
<br>*Expressionsculture of pEx_DsbA_HisDigSplitFoka in 6X2l flasks in 600ml DYT medium each
+
-middle-linker Foki +pEx-HisDig/+pEX-HisFluA/+pExStrepDig
-
- induced with 0,7mM IPTG and took samples T0-T5<br>
+
-long-linker Foki +pEx-HisDig/+pEX-HisFluA/+pEX-StrepDig
-
- centrifuged in buckets 17', 4000rpm, 4°C<br>  
+
<br>*Transformation of Ligations with 100µl RV competent cells, 37°C room over night
-
- eluted in 20 ml TES in each bucket<br>
+
<br>*sorting of right and wrong sequenced parts and parts which need subsequent cloning into a different vector
-
....
+
<br>*lab talk (Kristian, Tobias, Sven, Gerrit, Laura)
 +
- DsbA-signalsequence for the exprot into the periplasma will be cloned to the Foka completed parts <br>
 +
- in vivo experiment of e.colis cotransformated with Foka and Foki completed plasmids, elektroporated, transformated with M13 DNA ss with hybridized oligos, fluroescent oligos and without oligos<br>
 +
-> plaque essay will show efficency of Fok<br>
 +
- in vitro essay will be done with Fos fusioned to Foka, JUN fusioned to GFP and Foki added to experiment<br>
-
<br>*PET 39 b+ ssDNA "PCR" with new template from digestion of yesterday -> very few product, as well as non specific ones
+
<h3>22.09.09 Gerrit, Isabel, Sarah, Max, Hannes, Caro, Timo, Julia, Laura </h3>
-
<br>*PET 39 b+ ssDNA "PCR" with more cycles and higher annealing temperature
+
<br>*continued phage display:'''
 +
<br>*plasmid prep of pEX His Dig Rest Klone 6 pellet
 +
<br>*digest of pEX His Dig plasmid prep of 22.09 with ageI and pstI
 +
<br>*digest of pEX Strep Dig plsamidprep of 27.08 with ageI and pstI
 +
<br>*digest of pEXHis FluA Split Foki 27.08 with xbaI and pstI , for rechieving a pEX vector
 +
<br>*gel extraction of the digests
-
<h3>06.10.09, Laura, Manu, Julia, Christophe, Caro, Hannes, Gerrit, Anika</h3>
 
-
<br>*digest
 
-
- pBAD vector <br>
 
-
DNA: 16.8µl<br>
 
-
enzyme: 1µl AgeI<br>
 
-
buffer: 2µl buffer 1 <br>
 
-
- pBAD insert <br>
+
<table>
-
DNA: 16.8µl<br>
+
<tr>
-
enzyme: 1µl XmaI<br>
+
<td align="center">
-
buffer: 2µl buffer 4 <br>
+
<img src="https://static.igem.org/mediawiki/2009/2/26/Freiburg_09_09.09.22_gel1.JPG" name="bildone" width="350" heigth="175" /><br>1: pMA-Strep-Dig, 2: pEX-Strep-Dig</td>
-
BSA (10X): 2µl <br>
+
<br>
 +
</tr>
 +
</table>
-
- pJS 418/419 <br>
 
-
DNA: 10µl<br>
 
-
enzyme: 1µl PstI and 1.5 µl Xba/<br>
 
-
buffer: 3µl buffer 3 <br>
 
-
BSA (10X): 3µl <br>
 
-
- pExStrepDigSplitFoka/pExHisDigSplitFoka <br>
 
-
DNA: 16.8µl<br>
 
-
enzyme: 1µl PstI and 1.5 µl Xba/<br>
 
-
buffer: 3µl buffer 3 <br>
 
-
BSA (10X): 3µl <br>
 
-
<br>*testdigest of pExHisFluASplitFoki_StrepDigSplitFoka
+
<br>*Quick ligation of pEXvector+HisFluA(gel Ex of 6.08.09) ; pEXHisDig+middle linker Foka(gel EX 11.09),
-
DNA: 5µl<br>
+
pEXStrepDig+middle linker Foka(gel EX 11.09) ,pEXStrepDig+short linker Foka(gel EX 11.09)
-
enzyme: 1µl PstI and 1.5 µl Xba/<br>
+
<br>*Transformation of the different constructs into RV308 bacteria
-
buffer: 1µl buffer 3 <br>
+
<br>*finishing of list of sequenced parts -> in folder SOPS
-
BSA (10X): 1µl <br>
+
-
<br>*preparative gels of digests
+
-
<table border="0">
+
-
<tr><td>
+
-
[[Image:Freiguburg09_061009_bad_js.JPG|none|thumb|preparative agarose gel, lanes: 1. Genruler DNA ladder mix of fermentas, 2. pBADvector, 3. pBADinsert/dummy, 4.pJS418|300x300px]]
+
-
</td>
+
-
<td>
+
-
[[Image:Freiburg09_061009_js_foka.JPG |none|thumb|preparative agarose gel, lanes: 1. Genruler DNA ladder mix of fermentas, 2. pJS419, 3. pExHisSplitFoka, 4. pExStrepDigSplitFoka |300x300px]]
+
-
</td></tr></table>
+
-
interpretation: pExStrepDigSplitFoka seemed to be a wrong construct, the other constructs showed bands of the right size even if the concentration of the PCR pBAD insert seems to be very low
+
-
<br>*testdigest of pMAdsba
+
-
DNA: 5µl<br>
+
-
enzyme: 1µl PstI and 1.5 µl Xba/<br>
+
-
buffer: 1µl buffer 3 <br>
+
-
BSA (10X): 1µl <br>
+
-
<br>*His-tag purification of HisDigSplitFoka (periplasm export) with Ni-NTA column. Washing buffer: 25mM imidazole
+
<h3>23.09.09 Gerrit, Julia, Laura, Anika, Isabel </h3>
-
-cells were sonicated for 2 x 1min before filtering with 0.45µm and 0.22µm filter
+
-
<br>*Ligation
+
'''Periplasma-project'''
-
- Dephphorylation of pBAD Gelex<br>
+
-
- 1µl Fast AP<br>
+
-
- 5.5µl fast AP buffer<br>
+
-
-1.5µl water<br>
+
-
--> Solution was given to eluat
+
<br>*Transformation of plasmid vectors in XL1blue competent cells: Tt-; Aa in pet 28a; pet 39b
 +
<br>*poured plates with Kan and Tet, 14 plates left in 4°c room
 +
<br>*put in 37°c room over night
 +
<br>*Digest of pMAStrep (prep of 09.07.09), pMAStrepFluA (prep of 06.08.09), pMAStrepDig (prep of 24.08.09) and pExStrepDig (prep of 27.08.09) with NgoMIV<br>
 +
purpose: to get rid of snd NgoMIV restriction site
 +
Plasmid: 10 µl<br>
 +
water: 16.5 µl<br>
 +
buffer: 3 µl buffer 4 NEB iGEM stock<br>
 +
Restriction_enzyme_1 : 1 µl NgoMIVI from NEB KuKlabstock<br>
 +
<br>*preparative gel and gel extraction
-
- for each ligation:<br>
+
<table>
-
- 6µl Insert<br>
+
<tr>
-
-3µl Vetor<br>
+
<td align="center">
-
-1µl Quickligase<br>
+
<img src="https://static.igem.org/mediawiki/2009/a/a7/Freiburg_09_230909_strepgel2.JPG" name="bildone" width="350" heigth="175" /><br>1: pMA-Strep-Dig, 2: pEX-Strep-Dig</td>
-
-10µl buffer<br>
+
<br>
 +
</tr>
 +
</table>
-
--> pBAD <br>* Insert (Dummy)<br>
+
<table>
-
--> pJS419+HisDigSplitFoka
+
<tr>
-
-->pJ418+HisDigSplitFoka
+
<td align="center">
-
<br>* Transformation
+
<img src="https://static.igem.org/mediawiki/2009/d/d8/Freiburg_09_230909_strepgel1.JPG" name="bildone" width="350" heigth="175" /><br>1: pMA-Strep, 2: pMA-Strep-FluA</td>
 +
<br>
 +
</tr>
 +
</table>
-
--> pBAD <br>* Insert (Dummy)<br>
 
-
--> pJS419+HisDigSplitFoka
 
-
-->pJ418+HisDigSplitFoka
 
-
- in XLblue<br>
+
<br>*ligation and transformation<br>
 +
<br>* phage display
 +
- pelleted newly grown vector constructs (AGO)
-
-pBAD was plated on AMP plates<br>
+
<h3>24.09.09 Gerrit, Julia, Laura, Hannes, Caro </h3>
-
- Both pJS... were plated on CM plates<br>
+
<br>*plasmid preparation of
 +
- pExHisDigMiddleliFoka<br>
 +
- pExStrepDigMiddleliFoka<br>
 +
- pExStrepDigShortliFoka<br>
 +
- pExHisFluA<br>
 +
-> glycerolstocks in new glycerolstocks in -80°C, pellets in -20°C in pellet box
 +
<br>*SDS-gel of eluate, flow through and wash fractions of expressed and purified HisDigSplitFoka from 17.09.09
 +
<br>*Western Blot of HisDigSplitFoka SDS Gel, incubated with anti His-Tag antibodies
 +
--> no ECL signal
 +
<br>*repetition of M13 ssDNA digest with oligos "Fokkontolle 2+3" and FokI --> didn't work
 +
<br>*digest of pExHisFluASplitFoki (clon 2, 26.08.09) and pExStrepDigSplitFoka (clon 1, 29.08.09)
 +
purpose: to ligate these parts in order to get a construct for the in vivo assay
-
<br>*'''Ligation and Transformation of'''
+
Plasmid: 10 µl pExHisFluASplitFoki<br>
 +
water: 14.5 µl<br>
 +
BSA: 0.5 µl NEB iGEM stock<br>
 +
buffer: 3 µl buffer 2 NEB iGEM stock<br>
 +
Restriction_enzyme_1 : 2 µl PstI from NEB KuKlabstock<br>
 +
Restriction_enzyme_2 : 1 µl SpeI from NEB KuKlabstock <br>
 +
Plasmid: 10 µl pExStrepDigSplitFoka<br>
 +
water: 14.5 µl<br>
 +
BSA: 0.5 µl NEB iGEM stock<br>
 +
buffer: 3 µl buffer 3 NEB iGEM stock<br>
 +
Restriction_enzyme_1 : 1 µl PstI from NEB KuKlabstock<br><br>
 +
<br>*preparative gel
-
Ligation:per sample 8µl H2O; 3µl vector; 6µl insert; 2µl Quick Ligase buffer; 1µl Quick Ligase
+
<table>
 +
<tr>
 +
<td align="center">
 +
<img src="https://static.igem.org/mediawiki/2009/e/eb/Freiburg09_240909_foki_foka.JPG" width="350" heigth="175" /><br>Agarose-gel ; Lanes: NEB 1kb DNA ladder, pExHisFluASplitFoki, pExStrepDigSplitFoka</td>
 +
<br>
 +
</tr>
 +
</table>
 +
*overnight ligation at 18°C of polycistronic construct: pExHisFluASplitFoki_StrepDigSplitFoka
 +
<br>* inoculation<br>
 +
- pEX Strep+Dig+Split+FokA 10ml LB+Amp<br>
 +
- pEX_His+Dig+Split+FokA 10ml LB+Amp<br>
 +
- pEX Strep+Dig 5ml LB+Amp<br>
 +
- pMA_Strep+Dig 5ml LB+Amp<br>
 +
- pMA_Strep 5ml LB+Amp<br>
 +
- pMA_Strep+FluA 5ml LB+Amp<br><br>
 +
<table>
 +
<tr>
 +
<td align="center">
 +
<img src="https://static.igem.org/mediawiki/2009/c/c8/Freiburg09_24.09.09_testverdau1.JPG
 +
" name="bildone" width="350" heigth="175" /><br>1: pEX-Strep-Dig-LL-Foki, 3: pEX-His-FluA-LL-Foki, 5: pEX-His-Dig-LL-Foki, 7:pEX-His-Dig-ML-Foki</td>
 +
<br>
 +
</tr>
 +
</table>
-
Transformation:<b>Defrost competent cells on ice:</b>(100 µl);
 
-
<b>add of the ligation:</b> 5 µl;
 
-
<b>DNA and cells:</b> mix softly by knocking;
 
-
<b>Incubation on ice for:</b> 20-30 min;
 
-
<b>Heat shock at:</b> 42°C for 40 sec;
 
-
<b>Cool off on ice for:</b> 5 min;
 
-
<b>add sterile LB(or dyt)medium:</b> 900 µl;
 
-
<b>Incubation in(shaker)at:</b> 37°C for 60-70 min;
 
-
<b>Plate cells on LB+antibiotic plates:</b> ampicillin;
 
-
<b>ligation:</b> 2 plates: 1. 50µl cells
 
-
<b>2. centrifuge @ 2000 rpm 3 min, discard supernatant, resuspend the restcells and plate out:</b>
 
-
-pMA HisDig Middle Linker Foki<br>
+
<br>* Periplasma Project
-
-pMA CAT<br>
+
-
-pEX Strep FluA SL FokA<br>
+
-
-pEX Strep FluA LL Foki<br>
+
-
-pEX Strep FluA ML Foki<br>
+
-
-pEX Strep FluA ML Foka<br>
+
-
-pEX Strep FluA LL Foka<br>
+
 +
<br>*1) Inoculation
-
<br>*Sequencing:
+
- Pet39bXLblue in 100ml LB + 100µl KAN + 100µl TET<br>
 +
- aa in pet28aXL1blue in 100µl KAN + 100µl TET<br>
 +
- Tt- XL1blue in 100µl KAN + 100µl TET<br>
 +
- Incubation (37°C) for 6 hours<br>
-
27µl H2O; 3µl DNA
+
<br>*2)Transformation
 +
--> XL1 blue pBadRDF<br>
-
-pMA Dbsa clone 2<br>
+
-Plasmid DNA 0,6µl
-
-pMA HisDigSplitFokA clone 2<br>
+
-cells 40 µl
-
-pMA HisFluASL Foki clone 1<br>
+
-100 µl and rest platet out on AMP/Tet Plats
-
-pMA HisFluASplitFoki clone 2<br>
+
-
-pMA StrepDigLLFoki clone 3<br>
+
-
-pMA HisFluaMLFoki clone 3<br>
+
-
-pMA StrepDigSplitFokA clone 1<br>
+
-
-pMA StrepDigMLFoki clone 1<br>
+
-
-pMA StrepDigSLFoki clone 2<br>
+
-
-pMA HisDigLLFoki clone 1<br>
+
-
-pMA StrepDigSplitFoki clone 3<br>
+
-
-pMA HisDigSplitFoki clone 1<br>
+
-
-pMA HisFluaLLFoki clone 3<br>
+
-
<br>*Inoculation
+
<br>* 3)Miniprep
 +
- pJS419
 +
- pJS418
 +
- Concentrations determined with Nanodrop <br>
-
of ER2738 M13: 250ml Erlenmeyerkolben+ 50ml LB+TET in 37°c room overnight<br>
+
<br>*3) Testdigest
-
<br>*Yesterdays improved pcr resulted in a lot of product, but still unspecific ones.. made new one with even higher annealing temperature (69°C) and a bit less cycles (35)
+
2:pEX Strep Dig split FokA<br>
 +
-digested with: XbaI and NgoniV<br>
 +
n: Fermentas GeneRuler DNA Ladder Mix |400x400px]]
-
<br>*New AGO M13 ssDNA assay using 5`-phosphorylated Oligos A1 and A4 _see gele_
+
-To 1) DNA  22,97 [µl]<br>
-
no differend results were obtained compaired to the assays using unphorphorylated oligos
+
NEB4 3,0[µl]<br>
 +
XbaI 1,5[µl]<br>
 +
NganIV 1,5[µl]<br>
 +
BSA 0,5[µl]<br>
 +
H20 0,53[µl]<br>
-
<br>*Started dialysis to transfer the  leftover AGO-proteins into the assay buffer
+
- To 2) DNA  21,97 [µl]<br>
 +
NEB4 3,0[µl]<br>
 +
XbaI 1,5[µl]<br>
 +
NganIV 1,5[µl]<br>
 +
BSA 0,5[µl]<br>
 +
H20 2,25[µl]<br>
-
<h3>07.10.09 Laura,Christoph, Hannes, Timo, Julia, Caro, Anika</h3>
+
- Purification: 0,8% Agarosegel<br>
-
<br>*SDS gel of protein purification of HisDigSplitFoka (periplasm) from 06.10.09
+
- Quigen Gelex SpinKit<br>
 +
<h3>25.09.09 Gerrit,Laura,Hannes,Isabel,Max,Anika,Caro, Timo </h3>
-
[[Image:Freiburg09_071009_pg_DsbAHisDigSplitFokA_28grad006.jpg|none|thumb|SDS gel, pEx_DsbA_HisDigSplitFoka, lanes: NEB prestained protein marker broad range, Elution fraction 1, Elution fraction 2, Elution fraction 3, Elution fraction 4, Elution fraction 4, Elution fraction 5, Elution fraction 6, flow through fraction 3, washing fraction 2, periplasm extract (frozen over night at -80°C)|400x400px]]
+
<br>*Periplasma Project
 +
1) Ligation with Quick Ligase from NEB<br>
-
<br>* Inoculation
+
- 2fold Quick Ligase Buffer 10µl<br>
-
4 Clones respectively:<br>
+
- DNA ( Insert(0,5µl)+Vector(9µl))<br>
-
- pMA-His-Dig-MiddleLinker-Foki in XLBlue<br>
+
- Ligase 1µl<br>
-
- pJS419-HIs-Dig-Split-Foka-  in XLBlue<br>
+
-
- pJS418-HIs-DIg-Split-Foka-  in XLBlue<br>
+
-
- pEX-Strep-FluA-MiddleLinker-Foki in XL1blue rest<br>
+
-
- pEX-Strep-FluA-LongLinker-Foki in XL1blue rest<br>
+
-
- pMA-CAT in XLblue 10µl<br>
+
-
-pEX-Strep-FluA-MiddleLinker-FokA in XL1blue rest<br>
+
-
2 Clones respectively:<br>
+
-10 min Ligation at RT<br><br>
-
-pEX-His-FluA-Split-Foki + Glycerolstock vom 26.08.09
+
-
- pEX-Strep-Dig-Split-Foka + Glycerolstock vom 29.08.09
+
 +
2) Miniprep <br>
-
<br>* Starter culture of pEx-DsbAHisDigSplitFoka in Bl21de3
+
pEX His Dig Split FokA<br>
-
<br>*two step PCR assembly of DsbA, His_Fos, and SplitFoka
+
-
- program name: Assembly<br>
+
-
- three different samples: 1. without DMSO, 2. with DMSO, 3. without DMSO and with last primers just added after first step
+
-
<br>*preparative gel of the PCR samples
+
-
-> primer haven't been diluted an probably made all secondary structures, has to be repeated
+
-
<br>*digest of pBAD with AgeI and new PCR with insert digested with XmaI
+
-
<br>*preparative gel with digest and
+
-
<br>*test digest of pJS419_HisDigSplitFoka and pJS419_StrepDigSplitFoka
+
-
DNA: 5µl<br>
+
-
Enzymes: 0.5µl of BamHI and MfeI each<br>
+
-
Buffer: 1µl buffer 4<br>
+
-
BSA (10fold): 1µl<br>
+
-
Water: 2µl<br>
+
-
-> pJS419_HisDigSplitFoka showed bands of the right size and was sequenced with primer sf_lac P1<br>
+
-
<br>*plasmidpreparation of
+
-
- pEXHisFluASplitFoki<br>
+
-
- pExStrepDigSplitFoka<br>
+
-
-> low concentrations<br>
+
-
<br>*digest of pExHisFluASplitFoki, pExStrepDigSplitFoka and RBS_StrepDigSplitFoka
+
-
pExHisFluASplitFoki: 15µl<br>
+
-
Enzymes: 1µl of PstI and 1.5µl SpeI<br>
+
-
Buffer: 3µl buffer 2<br>
+
-
BSA (100fold): 0.5µl<br>
+
-
Water: 9µl<br>
+
-
pExStrepDigSplitFoka: 15µl<br>
+
pEX Strep Dig Split FokA<br>
-
Enzymes: 1µl of XbaI and 1.5µl PstI<br>
+
-
Buffer: 3µl buffer 3<br>
+
-
BSA (100fold): 0.5µl<br>
+
-
Water: 9µl<br>
+
-
pExStrepDigSplitFoka: 10µl<br>
+
Nanodrop Data
-
Enzymes: 1µl of XbaI and 1.5µl PstI<br>
+
[[Image:Freiburg_09 Nanodrop 25-9.jpg |none|thumb|The two last lines only|400x400px]]<br><br>
-
Buffer: 3µl buffer 3<br>
+
-
BSA (100fold): 0.5µl<br>
+
-
Water: 14µl<br>
+
-
<br>* Gelextraction of digest
+
-
1) Insert: pEX-Strep-Dig-Split-Foka( digested with xba and pst) <br>
+
-
2)Vector: pEX-His-Flua-Split-Foki (digested with spe, pst)<br>
+
-
3)PCR Product: RBS-Strep-Dig-Split-FokA(digested with pst, xba)<br>
+
 +
Stored: Plasmidbox in freezer<br>
 +
<br>* Amp preparation, -20°C<br>
 +
<br>* Plasmidprep<br>
 +
- pEXStrep+Dig Clone 1+2  (Tube 1+2)<br>
 +
- pMA_Strep+Dig Clone 1+2  (Tube 3+4)<br>
 +
- pMA_Strep Clone 1+2 (Tube 5+6)<br>
 +
- pMA_Step+FluA Clone 1+2 (Tube 7+8)<br>
 +
--> -80°C<br><br>
 +
<br>* pellets of:<br>
 +
- pEX_Strep+Dig Clone 3+4  (Tube 9+10)<br>
 +
- pMA_Strep+Dig Clone 3+4  (Tube 11+12)<br>
 +
- pMA_Strep Clone 3+4 (Tube 13+14)<br>
 +
- pMA_Step+FluA Clone 3+4 (Tube 15+16)<br>
 +
--> -20°C<br><br>
-
<br>*preparative gels of digests
+
<br>* Transformation of<br>
-
<table border="0">
+
pEX_His+FluA+Split+Foki+Strep+Dig+Dig+Split+FokA into RV308 and XBL<br>
-
<tr><td>
+
-
[[Image:|none|thumb|preparative agarose gel, lanes: 1. Insert2. pEX-Vector, 3. PCR- RBS Product]]
+
-
</td>
+
-
<td>
+
-
[[Image: |none|thumb|preparative agarose gel, lanes: 1. Genruler DNA ladder mix of fermentas, 2. pJS419, 3. pExHisSplitFoka, 4. pExStrepDigSplitFoka |300x300px]]
+
-
</td></tr></table>  
+
-
RBS PCR Product: m= 90 mg<br>
+
<br>* phage display
-
vector: 0 0 130 mg<br>
+
- error prone PCR<br>
 +
water: 29,3µl<br>
 +
DNA: 1,8µl<br>
 +
buffer: 5µl (10x, without MgCl2)<br>
 +
primers (87/88 or 87/89): 1,5µl each<br>
 +
dNTPs: 1,5µl (10mM each)<br>
 +
Taq: 1µl<br>
 +
MgCl2: 12µl (25mM)<br>
 +
MnCl2: 5µl (5mM)<br>
-
<br>* Ligation
+
<h3>26.09.09 Caro </h3>
-
- 6µl Insert<br>
+
<br>* Inoculation
-
-3µl Vetor<br>
+
-
-1µl Quickligase<br>
+
-
-10µl buffer<br>
+
-
pEX-Strep-Dig-Split-Foka-RBS-Strep-Dig-Split-Foka<br>
+
- 4 clones respectively of:<br>
-
<br>*Transformation
+
-pEX His dig ML FokA <br>
 +
-pEX Strep Dig SL FokA <br>
 +
-pEX His FluA<br>
 +
-pEX Strep Dig ML FokA <br><br>
-
- All in XL1blue<br>
+
-pEX His FluA Split Foki Strep Dig Split FokA aus RV308<br>
-
- Vector: pEX-strep-Duig-Split-Foka<br>
+
-pEX His FluA Split Foki Strep Dig Split FokA aus XL<br>
-
- Ligation: pEX-Strep-Dig-Split-Foka-RBS-Strep-Dig-Split-Foka<br>
+
-
<br>*Stardet production of Phages baering the phagmid vektors with pJS_TorA-flag-AGO-noAmber-CDg3p and the pJS_TorA-flag-AGO-CDg3p, 480 ml each. see phageproduction protocoll day 1
+
- Medium: <br>
-
<br>*prepaired ELISA with anti-flag antibodies
+
- 200 ml LB <br>
-
<br>*made electro competent cells for transformation with the ago phagmidbibliothek
+
- 2g Glucose (sterile filtered)<br>
 +
- 200 µl AMP<br><br>
-
<h3>08.10.09 Manu, Christoph, Julia, Caro, Timo, Hannes </h3>
+
<br>* new DsbA SS insertion in front of FokA constructs<br>
-
<br>*Poured SDS-Gels<br>
+
- 3 h digestion of pEX_His_Dig_Split_FokA (prep 25.9.) & pEX_Strep_Dig_Split_FokA using 1.5 µL XbaI, NgoMIV in 30 µL final<br>
-
<br>*Phage ss DNA
+
- 0.8 % agarose gel<br>
 +
- GelEx, 30 µL elution<br>
 +
- Quickligation using 1:3 ratio, 10'<br>
 +
- transformed XL1 & BL21 chemically using 10 µL ligation rx. (low conc.) & 50 µL cells<br>
 +
<br>
-
-Over night cultured ER2738 in 100ml LB+Tet dilute on OD600=0,4 in 50ml LB+Tet<br>
+
<h3>27.09.09 Anika, Hannes </h3>
-
-Transfomation with 3µl M13 Phage stock (-80°) at 10:30Uhr , incubated for 4-5 hours at 37°C in shaker<br>
+
<br>* Miniprep
-
-Centrifuge in 50ml Falcon tube at 5000rpm for 20 min, 4°C<br>
+
[[Image:Freiburg09_270909_Minipreps.jpg|none|thumb||600x600px]]
-
-Phages are in the supernatant, add 1/7 PEG/NaCl (for 50ml culture 7ml precipitation over night on ice in -4°C room<br>
+
-
<br>*Miniprep
 
-
- 2 clones respectively:<br>
 
-
-A = pEX strep dig split foka
 
-
<br>*Finished Phage production(see protocol day 2): We obtained approximately 3.8<br>*10^12 pJS_TorA-flag-AGO-noAmber-CDg3p (449) and 1.1<br>*10^13 pJS_TorA-flag-AGO-CDg3p (448) -> aplyed all of them to the anti-Flag ELISA<br>
+
<br>* test digest of DsbA ss insertion
-
<br>*Anti-Flag ELISA was successfull with a slight but detctable signal via anti M13 VCS Antibodies (with peroxidase):<br>
 
-
see 405 nm absorption in wells G9-10 (448) and G7-8 (449) compaired to positive control (G5-6) and negative control (G3-4 and D3-10) detected about half an hour after the ABTS substrat was addet.
 
-
<>    1    2    3    4    5    6    7    8    9    10    11    12    <br>
+
- 800 ng DNA, 0.5 µL AvaI & XbaI, 15 µL total, 30'<br>
-
A      0.0470 0.0420 0.0440 0.0430 0.0480 0.0510 0.0460 0.0470 0.0470 0.0480 0.0450 0.0460<br>
+
- 2 % high-res agarose gel, 100 bp ladder (expected: 237 bp for His, 242 bp for Strep, failure = 184 bp)
-
B      0.0470 0.0460 0.0480 0.0480 0.0460 0.0450 0.0470 0.0560 0.0470 0.0450 0.0450 0.0440<br>
+
-
C      0.0460 0.0470 0.0500 0.0450 0.0430 0.0460 0.0450 0.0460 0.0430 0.0420 0.0440 0.0470<br>
+
-
D      0.0490 0.0470 0.1590 0.1610 0.1920 0.1720 0.2210 0.2500 0.2130 0.2680 0.0460 0.0480<br>
+
-
E      0.0490 0.0490 0.0450 0.0490 0.0430 0.0490 0.0460 0.0430 0.0460 0.0420 0.0450 0.0440<br>
+
-
F      0.0490 0.0430 0.0470 0.0440 0.0470 0.0470 0.0440 0.0450 0.0500 0.0460 0.0450 0.0450<br>
+
-
G      0.0500 0.0440 0.2530 0.2510 3.9180 3.8800 0.9560 0.9380 1.2420 1.2360 0.0440 0.0460<br>
+
-
H      0.0480 0.0430 0.0510 0.0470 0.0480 0.0460 0.0470 0.0450 0.0450 0.0440 0.0460 0.0460<br>
+
-
<br>* Made new PCR for ssDNA from pET39b+ fragment and gained approximately 200 ng of ssDNA after PCR and gelextraction
+
<br>* all new DsbA insertion transformations successful, control plate empty
 +
--> o/n cultures in LB (Glu, Amp), 4 each (DsbA_His_Dig_Split_FokA & DsbA_Strep_Dig_Split_FokA, XL1 & BL21)<br>
-
<br>*digest of pExHisFluASplitFoki, pExStrepDigSplitFoka and RBS_StrepDigSplitFoka
+
<br>*Inoculation of starter culture for expression
-
pExHisFluASplitFoki: 15µl<br>
+
-pExHisFluASplitFoki in BL21de3 (300ml LB Amp, 1% glucose)<br>
-
Enzymes: 1µl of PstI and 1.5µl SpeI<br>
+
--> 26°C
-
Buffer: 3µl buffer 2<br>
+
-
BSA (100fold): 0.5µl<br>
+
-
Water: 9µl<br>
+
-
pExHisDigSplitFoka: 15µl<br>
+
<br>*inoculation of
-
Enzymes: 1µl of XbaI and 1.5µl PstI<br>
+
-pEx_DsbAss_HisDigSplitFoka in XL1<br>
-
Buffer: 3µl buffer 3<br>
+
-pEx_DsbAss_StrepDigSplitFoka in XL1<br>
-
BSA (100fold): 0.5µl<br>
+
-pEx_DsbAss_HisDigSplitFoka in BL21<br>
-
Water: 14µl<br>
+
-pEx_DsbAss_StrepDigSplitFoka in BL21<br>
-
RBSStrepDigSplitFoka: 5µl<br>
+
in 5ml LB Amp, 1% glucose
-
Enzymes: 1µl of XbaI and 1.5µl PstI<br>
+
-
Buffer: 3µl buffer 3<br>
+
-
BSA (100fold): 0.5µl<br>
+
-
Water: 19µl<br>
+
-
->made two digest of PCR construct<br>
+
-
<br>* Gelextraction of digest
+
-
1) Insert: His-Dig-Split-Foka( digested with xba and pst) <br>
+
-
2)Vector: pEX-His-Flua-Split-Foki (digested with spe, pst)<br>
+
-
3)PCR Product: RBS-Strep-Dig-Split-FokA(digested with pst, xba)<br>
+
-
and also PCR purification of RBS-Strep-Dig-Split-FokA
+
-
<br>*preparative gels of digests
+
-
->see picture<br>
+
-
<br>*ligation of
+
-
-pEX-His-Flua-Split-Foki_His-Dig-Split-Foka<br>
+
-
-pEX-His-Flua-Split-Foki_RBS_Strep-Dig-Split-Foka (from gelex)<br>
+
-
-pEX-His-Flua-Split-Foki_RBS_Strep-Dig-Split-Foka (from PCR purification)<br>
+
-
<br>*transformation of ligations
+
-
<br>*inoculation of pJS419_HisDigSplitFoka in LB + chloramphenicol
+
-
<br>*new two step PCR with all three plasmids for Fos construct (pMADsbA, pMAFos, pMASplitFoka, this time with right primer dilution and preparative agarose gel
+
-
->interpretation: no band of 921bp was visible<br>
+
-
<br>*one step PCR of pMADsbA, pMAFos, pMASplitFoka separated and preparative agarose gel
+
-
->see picture<br>
+
-
->interpretation: pMAFos and pMASplitFoka showed bands of the right size (230bp and 657bp respectively), of pMADsbA no product was visible<br>
+
-
<br>*new one step PCR of pMADsba with newly prepared 1:1000 dilution
+
-
<br>*test digest of plasmidpreparations from today
+
-
->see picture<br>
+
-
<h3>09.10.09 Manu, Julia, Caro, Laura, Christopherus, Hannes, Timo, Max, Anika </h3>
+
<h3>28.09.09 Isabel, Sarah, Gerrit, Anika, Hannes, Timo, Caro, Max </h3>
-
<br>*Phage ss DNA<br>
+
<br>*plasmid preparation of pEX_DsbAss-His-Dig-Split-FokA (clone 1-5) and pEX-DsbAss-Strep-Dig-Split-FokA (clone 1-5)
-
-Over night in 4°C room precipitated phages: centrifuged for 20 min at 5000rpm and 4°C<br>
+
<br>*continued phage display
-
-Discard supernatant, resuspended pellet in 2ml TBS (no pellet recognized)<br>
+
- plasmid preparation of pJs#440 <br>
-
-Separated solution in 2 Eppendorf tubes, centrifuged for 10 min at 13000rpm<br>
+
- error prone PCR<br>
-
-Decant the supernatant into new eppis, precipitate with 170µl PEG/NaCl and leave for 1 hour on ice<br>
+
water: 21,75µl<br>
 +
template: 1,5µl<br>
 +
primers (87/88 or 87/89): 1,5µl (10µM) each<br>
 +
dNTPs: 1,5µl (10mM each)<br>
 +
Taq: 1µl<br>
 +
buffer(10x): 5µl<br>
 +
MnCl2: 5µl (5mM)<br>
 +
MgCl2: 12µl (25mM)<br>
 +
-> 4 samples of 87/88 and 87/89 each<br>
 +
water: 26µl<br>
 +
pcr-product ("template"): 2µl<br>
 +
primers (87/88 or 87/89): 1,5µl each<br>
 +
dNTPs: 1,5µl (10mM each)<br>
 +
Taq: 1µl<br>
 +
buffer: 5µl<br>
 +
MnCl2: 2,5µl<br>
 +
MgCl2: 9µl<br>
 +
-> 4 samples of 87/88 and 87/89 each<br>
-
<br>*Miniprep
+
<br>*transformation of pEx_HisFluASplitFoki in BL21de3
-
- pJS 419-his-dig-split-foka (clon 1+2)<br>
+
<br>*inoculation of
-
- Glycerolstock of clon1 and 2<br>
+
-pEx_HisDigSplitFoka in XL1blue (?)<br>
-
- 300µl Glycerol<br>
+
-pEx_StrepDigSplitFoka in XL1blue (?)<br>
-
- 700 µl culture<br>
+
-
- Pellets from clones 3,5,6<br>
+
<h3>29.09.09 Gerrit, Anika, Hannes, Caro, Laura, Christoph, Max </h3>
 +
<br>*Identified the mutation that was revealed by the latest sequencing: All plasmids bared a mutation that led to an exchange in amino acid sequence: 371 L->S. The aa 371 (indicated in pink on the right) is part of an peripheral alpha helix in the mid-domain of the argonaute protein and has no contacts to aa outside of the alpha helix and should the thereby not have major influence of the structure or function of the protein.
 +
[[Image:Freiburg 09 Mutation in AGO.png|none|thumb||600x600px]]
 +
<br>*because the ligation pExHisFluASplitFoki_StrepDigSplitFoka didn't work a new digest of pExHisFluASplitFoki and pExStrepDigSplitFoka was done:
 +
Plasmid: 10 µl pExHisFluASplitFoki, clone 1 (100µl) from 26.08.09<br>
 +
water: 14.5 µl<br>
 +
BSA: 0.5 µl NEB iGEM stock<br>
 +
buffer: 3 µl buffer 2 NEB iGEM stock<br>
 +
Restriction_enzyme_1 : 2 µl PstI from NEB KuKlabstock<br>
 +
Restriction_enzyme_2 : 1 µl SpeI from NEB KuKlabstock <br>
-
Nanodrop data:<br>  
+
Plasmid: 10 µl pExStrepDigSplitFoka, clone from 29.08.09<br>
-
pJS 419-his-dig-split-foka-clon1= 509.5 ng/µl<br>
+
water: 14.5 µl<br>
-
pJS 419-his-dig-split-foka-clon2 =468 ng/µl<br>
+
BSA: 0.5 µl NEB iGEM stock<br>
 +
buffer: 3 µl buffer 3 NEB iGEM stock<br>
 +
Restriction_enzyme_1 : 2 µl XbaI from NEB KuKlabstock<br>
 +
Restriction_enzyme_2 : 1 µl PstI from NEB KuKlabstock <br>
 +
->put in 37°C for 2h
 +
<br>*dephosphorylation of vector pExHisFluASplitFoki by SAP
 +
DNA: 30µl<br>
 +
SAP: 0,5µl<br>
 +
SAP buffer: 3,5µl<br>
 +
water: 1µl<br>
 +
- 37°C for 30min<br>
 +
- 70°C for 20min<br>
 +
- PCR purification Kit (normally direct digest would have been sufficient<br>
 +
<br>*preparative gel of digest to gain vector and insert
-
<br>*Inoculation of ER2738 in 2x 2L conical flask with 1L LB+1ml Tet, over night in 37°C room
 
-
<br>*send to sequencing:<br>
 
-
pMA Dig Plasmidprep 22.07.09 Timo1<br>
 
-
pEx StrepDigSplitFoka Plasmidprep clone1 08.10.09 Timo2<br>
 
-
pEx HisFluaSplitFoki Plasmidprep clone1 08.10.09 Timo3<br>
 
-
pEx StrepFluAMiddleLinkerFoki Plasmidprep clone1 08.10.09 Timo4<br>
 
-
pEx StrepFluAMiddleLinkerFoka Plasmidprep clone1 08.10.09 Timo5<br>
 
-
pEx StrepFluALongLinkerFoki Plasmidprep clone1 08.10.09 Timo6<br>
 
-
pMA Cat plasmidprep clone1 08.10.09 Timo7<br>
 
-
pJs 419 HisDigSplitFoka plasmidprep09.10.09 clone1 Timo8<br>
 
-
pJs 419 HisDigSplitFoka plasmidprep09.10.09 clone2 Timo9<br>
 
-
pJs 419 HisDigSplitFoka plasmidprep09.10.09 clone5 Timo12<br>
 
-
<br>* concentrated pET39b+ ssDNA via sodiumacetat and ethanol precipitation
+
<table>
-
<br>* electrical trafo of the 449 ago phagmid bibliothek into XL1
+
<tr>
-
<br>* prepaired immutubes with streptavidin for ago phages test panning tomorrow
+
<td align="center">
 +
<img src="https://static.igem.org/mediawiki/2009/6/6b/Freiburg_09_290909_foki_foka_verdau.JPG" width="350" heigth="175" /><br>1: pEx-HisA-FluA-splitli-Fok_i, 2: pEX-Strep-Dig-Split-Fok_a </td>
 +
<br>
 +
</tr>
 +
</table>
 +
<br>*gel extraction
-
<h3>10.10.09 Julia, Caro, Laura, Christoph</h3>
+
<table>
 +
<tr>
 +
<td align="center">
 +
<img src="https://static.igem.org/mediawiki/2009/1/11/Freiburg09_29.09.09_gelex1.JPG" width="350" heigth="175" /><br>1:Streo-Dig-Split-FokA, 2: pJS419, 3:His-Dig-Split-Fok_a, 4: RBS-Strep-Dig-Split-Fok_a</td>
 +
<br>
 +
</tr>
 +
</table>
-
<br>*Measured OD600 of over night ER2738 culture abs.1)0.218 (1:10);2)0.23 (1:10), diluted to OD600 abs.0,1 in 1000ml LB+Tet<br>
 
-
<br>*Measured OD600 of Christophs culture:abs. 0.37 (1:10), diluted to abs.0.07 in 60ml DYT+Tet+CM
 
-
<br>*Growed Er2738 up to OD600 abs.0.6  8x 250ml in 1L Erlenmeyer flasks and infected with 15µl M13 phage, shake for 4 hours at 37°C
 
-
<br>*Decanted to 16x50ml falcon tubes, centrifuged for 20min at 5000rpm and 4°C, decanted supernatant into new 16x50ml falcons with each 7ml PEG/NaCl
 
-
<br>*Precipitaion over night in 4°C room
 
-
<br>*plasmidpreparation of
 
-
- pBADQuick clones 1-6<br>
 
-
- pBADT4 clones 1-6<br>
 
-
- pMAYFP clone 1-2<br>
 
-
- pMACFP clone 1<br>
 
-
- pMASplitlinker clones 1-2<br>
 
-
- HisTag clones 1-2 (but test digest was negative -> thrown away)<br<
 
-
<br>*digest for recloning of pMA constructs:
 
-
pMAShortlinkerFoka clone 1, prep from 03.10.09, pMAMiddlelinkerFoka clone 2, prep from 03.10.09, pMALonglinkerFoka clone 1, prep from 10.09.09, pExDsbAHisDigSplitFoka, clone 1 from 02.10.09, pExDsbAStrepDigSplitFoka, clone 1 from 02.10.09: 10µl<br>
+
<br>*ligation of pExHisFluASplitFoki and StrepDigSplitFoka, pExHisFluASplitFoki (as negativ control)
-
Enzymes: 1µl of NgoMIVI and 1.5µl PstI<br>
+
<br>*transformation of pExHisFluASplitFoki_StrepDigSplitFoka and pExHisFluASplitFoki (negative control)
-
Buffer: 3µl buffer 1<br>
+
<br>*PCR primer forward and reverse for the in vivo assay/ polycistronic assay arrived
-
BSA (10fold): 3µl<br>
+
-> PCR with pEXStrepDigSplitFoka was done to amplificate the gene and insert a RBS site simultanously
-
Water: 10,5µl<br>
+
<br>*Inoculation of starter culture for expression and glycerol stocks:
 +
- pEx_HisFluASplitFoki in BL21de3 (300ml 2YT Amp, 1% Gluc) --> 26°C<br>
 +
<br>*Inoculation of
 +
- pET-39b+ in XL1blue (15ml LB+Kan) --> plasmidprep for cleavage assays with AGO tomorrow<br>
 +
--> 37°C over night<br>
 +
<br>*sequencing of HisFluASplitFoki clone 1 (100µl) from 26.08.09
-
pMAHisDig clone 2, prep from 24.08.09, pMAStrepDig clone 2, prep from 25.09., pExStrepDig clone 2, prep from 25.09.09, pMABB057 from 01.10.09: 10µl each<br>
+
<h3>30.09.09 Gerrit, Hannes, Caro, Anika, Max, Isabel, Christoph, Julia </h3>
-
Enzymes: 1µl of AgeI and 1.5µl PstI<br>
+
<br>*cloning His_ & Strep_ Dig_Split_FokA into pJS 419 phagemid vector
-
Buffer: 3µl buffer 1<br>
+
- digested pEX vectors & pJS419 w/ XbaI, NotI using 16 µL DNA<br>
-
BSA (10fold): 3µl<br>
+
--> 1 % agarose gel
-
Water: 10,5µl<br>
+
<br>*ssDNA production
-
<br>*PCR assembly with pMADsbA, different approaches (Taq Polymerase or Phusion Polymerase, differnt Tm) and combination PCR with pMADsba and pMAFos together
+
- digestion of pET-39b(+): EcoRI, XbaI<br>
-
<br>*analytical gel of PCRs -> didn't work
+
-
<br>*preparative gels of digests
+
-
-> see picture
+
-
-> no inserts with pExDSba_Foka constructs because they have no NgoMIV site any more
+
-
<br>*ligation of
+
-
-pMAStrepDigShortLiFoka<br>
+
-
-pMAStrepDigMiddleLiFoka<br>
+
-
-pMAStrepDigLongLiFoka<br>
+
-
-pExStrepDigShortLiFoka<br>
+
-
-pExStrepDigMiddleLiFoka<br>
+
-
-pExStrepDigLongLiFoka<br>
+
-
-pMAHisDigShortLiFoka<br>
+
-
-pMAHisDigMiddleLiFoka<br>
+
-
-pMAHisDigLongLiFoka<br>
+
-
-pMACATNd4 (MQI)<br>
+
-
-pMACATNd4 (MQII)<br>
+
-
-pMA Kontrolle (M)<br>
+
-
-> in XLBlue<br>
+
-
- pEx_CATNd4 (EQI)<br>
+
-
- pEx_CATNd4 (EQII)<br>
+
-
- pEx_Kontrolle(E)<br>
+
-
->RV308
+
-
Insert: 6µl <br>
+
-
vector: 3µl <br>
+
-
Ouick ligase buffer: 10µl <br>
+
-
Quick ligase: 1µl <br>
+
-
+
-
<br>*transformation of ligations in XBL on LB/Amp/1%glucose plates
+
-
<br>*cotransformation of
+
-
<br>*testdigest of the pET39b+ ssDNA. looks like a success... see 4pk in picture<br>
+
-
[[Image:Freiburg09 101009pet39b+ssdnaagoassay.JPG|none|thumb|gele of the AGO pETb+ ssDNA cleavage assay. Lanes: Marker ,ssDNA,1,3,2,4,1pk,3pk,2pk,4pk,ssDNA|400x400px]]
+
-
<br>*cotransformation of pExHisFluASplitFoki and pJSStrepDigSplitFoka in XBL on LB/Amp/CM/1%glucose plates
+
-
<br>*inoculation of pExDsbAStrepDigSplitFoka and pExDsbAHisDigSplitFoka, glystock from 02.10.09
+
-
<h3> 11.10.09, Timo, Hannes, Max, Anika</h3>
+
<table>
 +
<tr>
 +
<td align="center">
 +
<img src="https://static.igem.org/mediawiki/2009/c/c8/Freiburg09_30.09.09christoph.JPG" width="350" heigth="175" /><br> </td>
 +
<br>
 +
</tr>
 +
</table>
-
<br>* Digestion of
 
-
1.pEXHisFluA (27.09.09, Klon1), XbaI - PstI<br>
 
-
2.pMAFos_HlsbZip, XbaI - AgI<br>
 
-
3.pMASplitFoka (04.10.09, Klon2), NgoIV - PstI<br>
 
-
4.pEXDsbaHisDigSplitFoka (02.10.09, Klon1), XbaI - PstI<br>
 
-
5.pEXDsbaStrepDigSplitFoka (02.10.09, Klon1), XbaI - PstI<br>
 
-
6.pMA_BB057, XbaI - PstI (01.10.09)<br>
 
-
<br>*gel extraction of
 
-
- pMA<br>
 
-
- pEx<br>
 
-
- ...
 
-
<br>* Testdigestion of
 
-
7.pMA_YFP 2 (10.10.09, Caro)<br>
 
-
8.pMA_CFP (10.10.09, Caro)<br>
 
-
9.pMASplitLi1 (10.10.09, Caro)<br>
 
-
10.pMASplitLi2 (10.10.09, Caro)<br>
 
-
...image..
 
-
<br>* 1% Agarosegel of constructs above
 
-
<br>* Phage breeding day 2
 
-
<br>* Starter culture of pEx_DsbA_StrepDigSplitFoka (Bl21de3)
 
-
<br>* plasmid prep of pEx_DsbA_StrepDigSplitFoka
+
- digestion of M13 dsDNA: BspTI (isoschizomer of AflII), NarI<br>
-
<br>* plasmid prep of pEx_HisDigSplitFoka
+
<br>* Miniprep. of pET-39b+ ,stored in -20°C
 +
<br>* Miniprep. of RV_Test ,stored in -20°C
 +
<br>* phage display
 +
- error prone PCR<br>
 +
50µl PCR buffer (10x) without MgCl2<br>
 +
50µl MnCl2 (5mM)<br>
 +
120µl MgCl2 (25mM)<br>
 +
15µl primer #7<br>
 +
11,7µl primer #1<br>
 +
20µl dNTPs (each 10mM)<br>
 +
10µl Taq<br>
 +
218,3µl water<br>
 +
apportion total into 2 tubes à 245µl<br>
 +
add 5 µl of plasmid 425-2 and 428-6 (each 50ng/µl)<br>
 +
make aliquots à 50µl<br>
-
<br>* M13 ssDNA produced with bacterial of Julia and tried another variance with 100ml+tet(1:1000)+ER2738 grow to OD 0,2 then infected with <br> M13phage particles and let it grow for 2h. After this followed the qiagen M13 protocol for M13Dna
+
- ligation<br>
 +
2 samples:<br>
 +
2µl vector<br>
 +
12µl insert (digest 87/88)<br>
 +
1µl Ligase<br>
 +
2µl Ligase buffer<br>
 +
3µl water<br>
-
<h3> 12.10.09, Laura, Caro, Christoph, Anika, Hannes, Julia, Timo, Gerrit</h3>
+
3 samples:<br>
-
<br>* protein expression of pEx_DsbA_StrepDigSplitFoka (periplasm) in BL21de3 at 22°C.
+
2µl vector<br>
-
<br>* made 5 litres of DYT
+
20,4µl insert (digest 87/89)<br>
-
<br>*digest of pMASplitFoka clone 1 and 2 from 04.10.09
+
1µl Ligase<br>
-
DNA:10µl
+
2,6µl Ligase buffer<br>
-
Enzymes: 1µl of NgoMIVI and 1.5µl PstI<br>
+
<br>*digest of pExStrepDigSplitFoka from 29.08.09 clon 1b because ligation or trafo didn't work and concentration of insert after gelex was probably too low
-
Buffer: 3µl buffer 1<br>
+
-
BSA (100fold): 0.5µl<br>
+
-
Water: 14.5µl<br>
+
-
<br>* Plasmidprep. of: <br>
+
-
1.pMAFokA (old)<br>
+
-
2.pMA-CAT Ndelta4 (MQII)1<br>
+
-
3.pMA-CAT Ndelta4 (MQII)2<br>
+
-
4.pMA-CAT Ndelta4 (MQII)3<br>
+
-
5.pMA-CAT Ndelta4 (MQII)4<br>
+
-
6.pMA-CAT Ndelta4 (MQII)5<br>
+
-
7.pMA-CAT Ndelta4 (MQII)6<br>
+
-
8.pMAFoka clone 1 from 04.10.<br>
+
-
<br>*Made new BB-AGO PCR using digested AGO Gene without the vector-> still no expected bands to be seen...
+
-
<br>*Made new PCR to generate more pET39b+ ssDNA because yesterdays had insufficient concentration for the AGO cleavage assay
+
-
<br>*Made digest of errorprone PCR product of the AGO-G3P constructs (from 02.10.; one with, one without Amber) via NheI and SfiI to gain new Phagmid library
+
-
<br>*Send to sequencing:[[Protocols#DNA_Sequencing]]<br>
 
-
Julia 1-6:<br>
 
-
1)pBADQuick clone 3<br>
 
-
2)pBAD T4 clone 2<br>
 
-
3)pBAD T4 clone 1<br>
 
-
4)pMA YFP clone 1<br>
 
-
5)pMA CFP clone 1<br>
 
-
6)pMA Split Linker clone 2<br><br>
 
-
Gerrit1: pMA_cat-Nd4
 
-
<br>*Prepared ELISA[[Protocols#ELISA]] and two immuno tubes for Panning Simulation for tomorrow
+
<table>
-
<br>*made chemical competent cells of cotransformed XBlue with pJS419HisDigSplitFoka, pExHisFluASplitFoki
+
<tr>
-
->will prepare electrocompetent cells tomorrow<br>
+
<td align="center">
-
<br>*inoculation of cotransformed XBlue with pJS419HisDigSplitFoka, pExHisFluASplitFoki in LB+Amp+Tet+CM and pMAFos in LB+Amp
+
<img src="https://static.igem.org/mediawiki/2009/3/34/Freiburg09_30.09.09pexstrepdigsplitfoka_verdau.JPG" width="350" heigth="175" /><br>Agarose-gel ; Lanes: NEB 1kb DNA ladder, pExHisFluASplitFoki, pExStrepDigSplitFoka</td>
-
<br>*PCR of pMADsba repeated with different (higher) template dilutions
+
<br>
-
->analytical gel (see picture)<br>
+
</tr>
-
->didn't work again<br>
+
</table>
-
<br>*poured IPTG/XGal plates for in vivo plaque assay test run
+
-
<br>*transformation of:<br>
 
-
- pBAD_FokA (Quick)<br>
 
-
- pBAD_CAT(Quick)<br>
 
-
- pBAD_FokA (T4)<br>
 
-
- pBAD_CAT (T4)<br>
 
-
- pEX_FokA+YFP<br>
 
-
- pEX_DsbA+FokA+YFP<br>
 
-
into BL21 de3 gold<br>
 
-
Plates: LB+ AMP +1%Glucose<br>
 
-
<br>*cultivation of
 
-
pma strep dig split foka<br>
 
-
pma long linker<br>
 
-
pma his flua split foki<br>
 
-
<h3> 13.10.09, Laura, Caro, Christoph,Manu, Hannes, Julia</h3>
+
Plasmid: 10 µl pExStrepDigSplitFoka, clone from 29.08.09<br>
 +
water: 14.5 µl<br>
 +
BSA: 0.5 µl NEB iGEM stock<br>
 +
buffer: 3 µl buffer 3 NEB iGEM stock<br>
 +
Restriction_enzyme_1 : 2 µl XbaI from NEB KuKlabstock<br>
 +
Restriction_enzyme_2 : 1 µl PstI from NEB KuKlabstock <br>
 +
->put in 37°C for 2h
 +
<br>*preparative gel of digest -> didn't work (no insert could be seen)
-
<br>*Miniprep
 
-
-pMA-fos 1<br>
 
-
-pMA-fos 2<br>
 
-
-pMA his flua split fokI<br>
 
-
- pMA strep dig split foka <br>
 
-
-pMA long linker<br>
 
-
 
-
<br>*testdigest of Plasmidprep from today
 
-
 
-
15 µl for 6µl loading dye
 
-
-buffer 2 1µl<br>
 
-
-xbaI 0.5µl<br>
 
-
-pstI 0.75µl<br>
 
-
-DNA 2 µl<br>
 
-
-water 9.75µl<br>
 
-
-BSA 1µl<br>
 
-
 
-
--> Gelbild
 
-
 
-
- Glycerolstocks are in in box of 5/10/2009
 
-
<br>*made electrocompetent XL1 Blue cotransformed cells (pExHisFluASplitFoki and pJS419HisDigSplitFoka)
 
-
->stored in -80°C
 
-
<br>*culture of ER2738 in LB Tet for cotransformation in afternoon
 
-
<br>*test in vivo assay
 
-
- electroporation with new electrocompetent cells and M13 ssDNA at 1.7kV<br>
 
-
- 1.5h on 37°C shaker at 750rpm<br>
 
-
- precipitation of phages<br>
 
-
- infection of ER2738 with different dilutions of phages<br>
 
-
- mixed cells with Top agar and plated them on IPTG/XGAL plates -> 37° shaker<br>
 
-
<br>*inoculation of
 
-
-pMASplitFoka clone 1 from prep 04.10.09<br>
 
-
-pMAStrepDig clone 2 from prep 25.09.09<br>
 
-
-pMAMiddleFoka clone 2 from prep 04.10.09<br>
 
-
-pMAShortFoka clone 2 from prep 04.10.09<br>
 
-
-pMAFoka clone 1 from prep 04.10.09<br>
 
-
-pExDsbAStrepDigSplitFoka clone 1 from prep 02.10.09<br>
 
-
-pMALongFoka clone1 prep from 10.09.09<br>
 
-
-pMAFos 13.10.09<br>
 
-
-pBAD_CAT 13.10.09<br>
 
-
-pBAD_Foka 13.10.09<br>
 
-
-pMADsbAHisDigSplitFoka 13.10.09<br>
 
-
-pMADsbAStrepDigSplitFoka 13.10.09<br>
 
-
-pExFosSplitFoka 13.10.09<br>
 
-
-pMAFosSplitFoka 13.10.09<br>
 
-
<br>*protein purification of DsbA_StrepDigSplitFoka with Strep column
 
-
 
-
<br>*digestion, 1% agarose gel and gel extraction of
 
-
- pMA-LongLinker-FokA (10.09., clone 1) with EcoRI + SpeI<br>
 
-
- pMA-His-FluA-Split-FokI (13.10.) with SpeI + PstI<br>
 
-
- pMA-SplitLinker-FokA (04.10., clone 2) with NgoMIV + PstI => wasn't ok on the gel, inoculated clone 1<br>
 
-
- pMA-ShortLinker-FokA (04.10., clone 2) with NgoMIV + PstI<br>
 
-
- pMA-MiddleLinker-FokA (04.10., clone 1) with NgoMIV + PstI<br>
 
-
- pMA-His-Dig (24.08., clone 2) with AgeI + PstI<br>
 
-
- pMA-Strep-Dig (25.09., clone 2) with AgeI + PstI<br>
 
-
- pEx-Strep-FluA-MiddleLinker-FokI (08.10., clone 1) with XbaI + AgeI<br>
 
-
- pEx-Strep-FluA-MiddleLinker-FokA (08.10., clone 1) with XbaI + AgeI<br>
 
-
- pEx-Strep-FluA-LongLinker-FokI (08.10., Klon 1) with XbaI + AgeI
 
-
- pMA (01.10., c=500ng/µl) with XbaI + AgeI
 
-
- pMA (01.10., c=500ng/µl) with EcoRI + SpeI
 
-
 
-
 
-
<br>*ligations:
 
-
Vector: 3 µl pMA (01.10., c=500ng/µl) with EcoRI + SpeI<br>
 
-
Insert: 6 µl LongLinker-FokA (10.09., clone 1) with EcoRI + SpeI<br>
 
-
Buffer: 10 µl, QuickLigase Buffer NEB<br>
 
-
QuickLigase: 1 µl<br><br>
 
-
 
-
Vector: 3 µl pMA-His-Dig (24.08., clone 2) with AgeI + PstI<br>
 
-
Insert: 6 µl ShortLinker-FokA (04.10., clone 2) with NgoMIV + PstI<br>
 
-
Buffer: 10 µl, QuickLigase Buffer NEB<br>
 
-
QuickLigase: 1 µl<br><br>
 
-
 
-
Vector: 3 µl pMA-His-Dig (24.08., clone 2) with AgeI + PstI<br>
 
-
Insert: 6 µl MiddleLinker-FokA (04.10., clone 1) with NgoMIV + PstI<br>
 
-
Buffer: 10 µl, QuickLigase Buffer NEB<br>
 
-
QuickLigase: 1 µl<br><br>
 
-
 
-
Vector: 3 µl pMA-Strep-Dig (25.09., clone 2) with AgeI + PstI<br>
 
-
Insert: 6 µl ShortLinker-FokA (04.10., clone 2) with NgoMIV + PstI<br>
 
-
Buffer: 10 µl, QuickLigase Buffer NEB<br>
 
-
QuickLigase: 1 µl<br><br>
 
-
 
-
Vector: 3 µl pMA-Strep-Dig (25.09., clone 2) with AgeI + PstI<br>
 
-
Insert: 6 µl MiddleLinker-FokA (04.10., clone 1) with NgoMIV + PstI<br>
 
-
Buffer: 10 µl, QuickLigase Buffer NEB<br>
 
-
QuickLigase: 1 µl<br><br>
 
-
 
-
Vector: 3 µl pMA (01.10., c=500ng/µl) with XbaI + AgeI<br>
 
-
Insert: 6 µl Strep-FluA-MiddleLinker-FokI (08.10., clone 1) with XbaI + AgeI<br>
 
-
Buffer: 10 µl, QuickLigase Buffer NEB<br>
 
-
QuickLigase: 1 µl<br><br>
 
-
 
-
Vector: 3 µl pMA (01.10., c=500ng/µl) with XbaI + AgeI<br>
 
-
Insert: 6 µl Strep-FluA-MiddleLinker-FokA (08.10., clone 1) with XbaI + AgeI<br>
 
-
Buffer: 10 µl, QuickLigase Buffer NEB<br>
 
-
QuickLigase: 1 µl<br><br>
 
-
 
-
Vector: 3 µl pMA (01.10., c=500ng/µl) with XbaI + AgeI<br>
 
-
Insert: 6 µl Strep-FluA-LongLinker-FokI (08.10., Klon 1) with XbaI + AgeI<br>
 
-
Buffer: 10 µl, QuickLigase Buffer NEB<br>
 
-
QuickLigase: 1 µl<br><br>
 
-
 
-
Vector: 3 µl pMA (01.10., c=500ng/µl) with XbaI + AgeI<br>
 
-
Insert: 2 µl ShortLinker, hybridised, with XbaI + AgeI<br>
 
-
Buffer: 14 µl, QuickLigase Buffer NEB<br>
 
-
QuickLigase: 1 µl<br><br>
 
-
 
-
Vector: 3 µl pMA (01.10., c=500ng/µl) with XbaI + AgeI<br>
 
-
Insert: 2 µl MiddleLinker, hybridised, with XbaI + AgeI<br>
 
-
Buffer: 14 µl, QuickLigase Buffer NEB<br>
 
-
QuickLigase: 1 µl<br><br>
 
-
 
-
Vector: 3 µl pMA (01.10., c=500ng/µl) with XbaI + AgeI<br>
 
-
Insert: 2 µl LongLinker, hybridised, with XbaI + AgeI<br>
 
-
Buffer: 14 µl, QuickLigase Buffer NEB<br>
 
-
QuickLigase: 1 µl<br><br>
 
-
 
-
<br>*did transformations of the ligations in RV308, plated on LB-Amp + 1% Gluc
 
-
 
-
 
-
<br>*ELISA
 
-
-Blocking<br>
 
-
-Washing with TBST-EDTA 5x<br>
 
-
-Loaded immunotubes (1.5ml) and wells 100µl each with 0.5mM biotin-target DNA<br>
 
-
-Incubation at 20°C in shaking<br>
 
-
-Incubatet Phages with Oligo for 30min at 55°c waterbath<br>
 
-
-Washing of wells and immunotubes with TBST-EDTA 5x<br>
 
-
-Loaded 2 wells+controls with 449 phages+Oligo, 1+control with P1 phage+Oligo and 1+control as a control<br>
 
-
-Incubation in shaker at 20°C<br>
 
-
-Loaded immunotubes (each 1.5 ml) with 50µl P1, 25µl 449Phage+ Oligo in TBST-EDTA<br>
 
-
-Incubation in shaker at 20°C<br>
 
-
-Washing of wells and immunotubes with TBST-EDTA 5x
 
-
-Loaded 100µl/well anti-M13 ab(1:1000), incubated for 1 hour at 20°C in shaker<br>
 
-
-Immunotubes for panning: 1)2x 1ml TBS+MnCl2(5mM in 5ml), shaker for 20 min, decanted supernatant into eppis, washed with TBS 3x<br>
 
-
-2)2x 1ml TBS-T+MnCl2 (5mM in 5ml), shaker for 20 min, decanted supernatant into eppis, washed with TBS-T 3x<br>
 
-
-3)2x 1ml DNAse shaker for 20 min, decanted supernatant into eppis<br>
 
-
 
-
<br>*Made new "AGO BB PCR" this time just using the ad-on-tail-primer for the bb pre- and suffix, so that hte EcoRI site should remain. Still the same not fitting bands were obtained-> the problem might be caused by multimerising of the primers, even so we were not able to predict any of tose using vectir nti or compairable programms...
 
-
<br>* AGO assay using different targets-> were not able to reproduce the presumed cutting event from Saturdays assay probably due to the lower DNA concentration
 
-
<br>* Made ELISA with strep-biotinylated target oligo coated surface-> no binding of AGO bearing phages was detected using anti-M13 HRP and ABTS
 
-
<br>* Made test panning just like the ELISA above and eludet with TBS-MnCl2 (5mM), then TBST-MnCl2 (5mM) and then with DNase I
 
-
<br>* Ligated product of the errore-prone PCR of the AGO-G3P construct into an phagmidvektor with the Tor-A signalling sequence
 
 +
<br>*sequence of pExHisFluASplitFoki from 26.08.09, clone 100ul checked: ok
 +
<br>*protein expression of pEx_HisFluASplitFoki in BL21de3 --> pellets frozen at -80°C
 +
<br>*phosphorylised AGO A1 guide oligo via T4 Polynucleotid Kinase (with T4 Ligase Buffer) Final 20µl with 2.5 µM Oligo
 +
<br>*Started making Phages with wt Aa AGO: DsbA-flag-AGO-CDg3p; DsbA-flag-AGO-noAmber-CDg3p; TorA-flag-AGO-CDg3p; TorA-flag-AGO-noAmber-CDg3p
 +
->  Cells with the DsbA Phagmid-vektor showed very poor growth
 +
<br>* Prepared Phage ELISA via Anti-Flag as well as Strep-Biotinylated target Oligo
 +
<br>
</div>
</div>
<div style="text-align: left;"><br />
<div style="text-align: left;"><br />

Latest revision as of 23:33, 21 October 2009

FREiGEM 2009

September


01.09.09, Manu, Hannes, Christoph, Laura


*evaluation of sequencing - pMA_Shortlinker, plasmid prep from 29.08.09: sequence ok
- pEx_HisDigSplitFoka, plasmid prep from 29.08.09: sequence ok
- pEx_HisDigSplitFoki, plasmid prep from 29.08.09: sequence ok
- pEx_StrepDigSplitFoka, plasmid prep from 29.08.09: sequence ok
- pEx_StrepDigSplitFoki, plasmid prep from 29.08.09: sequence ok
- pMA_ShortlinkerFoka, plasmid prep from 29.08.09: sequence not ok, the linker short middle and long were ordered without NgoMIV restriction sites -> has to be ordered again
- pMA_ShortlinkerFoki, plasmid prep from 31.08.09: see above
- pEx_HisFluASplitFoka, plasmid prep from 29.08.09: not Foka but Foki
- pEx_HisFluASplitFoka, plasmid prep from 28.08.09: not Foka but Foki
- pEx_HisFluASplitFoki, plasmid prep from 28.08.09: sequence ok
- pEx_Strep-Dig: sequence ok
- pEx_His-Dig: sequence ok
- pMAFoka prep II from 05.08.09: sequence ok
- pMAFoka prep II from 05.08.09: sequence ok
- pMAFoki prep II from 05.08.09: sequence ok

*hybridization of M13 DNA ss and the fokcontrols in equal relations
*made SDS gels --> 4°C
*SDS gel of protein expression (pEx-His-FluA-SplitLi-Foki) from 28.08.09

SDS-Gel; pExHisFluASplitFoki; Lanes: NEB prestained protein marker, t0 (before induction), t1 (1 hour after induction), t2 (2 hours after induction), t3 (3 hours after induction), t4 (4 hours after induction)
SDS-Gel; pExHisFluASplitFoki ; Lanes: NEB prestained protein marker, Elution fraction 1 (after NiNTA-column), Elution fraction 2, Elution fraction 3, Elution fraction 4, Elution fraction 5, Elution fraction 6, Elution fraction 7, Elution fraction 8, Elution faction 9
Lane 4 showed some strange bands, so we repeated the gel

*made 1l buffer for AGO cleavage assay: 100mM NaCl, 10mM HEPES, 5mM MnCl2, pH 7.5
*came up with idea for new BioBrick standart that would allow making fusiun proteins via "mega primer" pcr technic with only a Threonine as a scar and thereby skipping the cloning procedure: [[Image:Freiburg 09 Superstandard.jpg|none|thumb||400x400px]] The new restriction enzyme would be AcuI, that for example has no cutting site in M13mp18 and just one in pET28 and two times in pMAL-p5X core vector
AcuI cuts 14/16 bases away from its recognition sequence end would thereby cut off the whole BB prefix and most of the BB suffix (with just AC left)
*purification of pExHisFluASplitFoki via Ni-NTA column
*inoculation of pExHisFluASplitFoki36GSlinker
*starter cultures of - pExHisDigSplitFoka
- pExStrepDigSplitFoka
in 50 ml LB and Ampicillin from plates of 31.08.09

02.09.09, Manu, Hannes, Christoph, Gerrit, Laura, Isabel


*Inoculation of expression culture - pExHisDigSplitFoka
- pExStrepDigSplitFoka
in 2 times 1 liter each at 28°C , 118rpm
-> induction of expression at OD 0,4, harvesting 4 hours later
-> centrifugation at 4000 rpm, 4°C, 20 min -> put pellets in -80°C freezer
*cleaning of Ni column with 15 ml water and 10 ml Ethanol (20%)
*plasmid preparation of pExHisFluASplitFoki36GSlinker, glycerol stocks and sequencing
*repetition of SDS gel of eluate fractions (pExHisFluASplitFoki) see picture... -> fractions 2 and 3 showed the probable Foki fusion protein and were united and dialysed

SDS-Gel; pExHisFluASplitFoki ; Lanes: NEB prestained protein marker, Elution fraction 1, Elution fraction 2, Elution fraction 3, Elution fraction 4, Elution fraction 5, flow through fraction 1, flow through fraction 3, washing fraction 1 (250mM imidazole), washing fraction 3

*order of new short, middle and long linkers with XbaI, NgoMIV and AgeI restriction sites
*made binding, washing and elution buffer (1 liter each) again for His/Ni purification
*prepared 2 liters of dialysis buffer (30mM NaCl, 20mM Tris/HCl, pH 7,4)
*centrifugation of the expression culture (20 min, 4000 rpm, 4°C), stored pellets at -20°C
*started dialysis over night with 200 ml dialysis buffer and 3 ml protein solution (elutions 2 and 3 were combined), stiring at 4°C

Meeting

*Kristian introduced GBM, please add your data to the list if you want to join the group founded for iGEM
*Fok - the tagged Oligo's arrived during the absence of Kristian and stayed one week in his mail box at room temperature. Christoph wanted to find out, how this affects the DNA
- we should repeat the Fok cutting assay with M13 dsDNA and change the origami-programm to stop at 37°C (instead of 20°C)
- new Oligo's for the cutting assay must be ordered with a length of 60 bp

- dialyse the his-tag purified protein solution to get the right ion concentrations for a ion exchange chromatography
- with the his-tag purified and dialysed protein solution we must do some tests: freeze it, thaw it and measure the stray light(photometer)
- prepare aliquots of the protein solution
- do a purification via ion exchange chromatography (MonoQ, positive charged)
- try a first cutting assay with our construct
- confirm the Oligo-Protein-interaction with a fluorescence or absorption measurement (we have to do some research on this)

*Fok-Phage Display - we want to assemble the different parts with a PCR with overlapping primers (including the GS-linker). We should use a mix of Taq and a proof reading polymerasy and have a maximum cycle number of 20 to keep the mutations as low as possible
- order parts at Mr.Gene with iGEM restriction sites
- we must plan the PCR-primers!!!

*AGO - first try to cut single strand DNA

*book rooms in a hotel (Anika wanted get some info about the hotels)

03.09.09, Manuel, Hannes, Christoph, Gerrit, Timo


*Hybridization of M13 ssDNA with FokKontrolle 2(1:100) and 3(1:100 dil)
*Digestion of M13 ssDNA FokKontrolle(FokK)1-8; 1&2;2&3;1&3 with FokI
M13 dsDNA with FokI. made a heat inactivation of 5b (95°C 10min) and 6b without FokI
*Cutting assay checked by gel electrophoresis


Agarose gele of M13DNA digest with fokI: Marker(fermantas gene ruler mix), M13ssDNA+fokI, M13ssDNA fokk1+fokI, M13ssDNA fokk2+fokI, M13ssDNA fokk3+fokI, M13ssDNA fokk2/3+fokI, M13ssDNA fokk2/3+fokI(heatshocked), M13ssDNA fokk1/2+fokI, M13ssDNA fokk1/2, M13ssDNA fokk2/3+fokI(37°C), M13dsDNA fokk2/3+fokI
*Digestion of pEX_His_FluA_Split_Foki_36GSli(prep 02.09.09 rest4 tube3) with AgeI and PstI
Plasmid: 10 µl
water: 12.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 1 NEB KuKlabstock
Restriction_enzyme_1 : 1 µl AgeI from NEB KuKlabstock
Restriction_enzyme_2 : 2 µl PstI from NEB KuKlabstock

*Gel extraction of pEX_His_FluA_Split_Foki_36GSli (prep 02.09.09 rest4 tube3)

*Ligation of vector:pEX_His_FluA_Split_Foki_36GSli(prep 02.09.09 rest4 tube3) with insert:Foka(Gelex 17.08)
Vector: 3 µl pEX_His_FluA_Split_Foki_36GSli from 02.09.09
Insert: 6 µl Foka(Gelex 17.08)
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock

*Conzentrated AGO 5x via Vivaspin to final conzentration of 3µM (2ml)
*Exchanged buffer of 900µl of Aa AGO solution via dialysis
*Started PCR procedure to create Aa AGO as an BB part via megaprimer technic
*His-Dig purification of protein expression from 02.09.09 (pExHisDigSplitFoka)
*SDS gel of His-Dig purification HisDigSplitFoka

SDS-Gel; pExHisDigSplitFoka ; Lanes: NEB prestained protein marker, Elution fraction 1, Elution fraction 2, Elution fraction 3, Elution fraction 4, Elution fraction 5, Elution fraction 6, flow through fraction 1, flow through fraction 3, washing fraction 1

*changed dialysis buffer, again with 200 ml (10:00 o'clock)

04.09.09, Manu, Hannes, Christoph, Laura, Sarah,Timo


*Ordered additional Oligo for M13mp18 cleavage with AGO: "Oligo A4" AAGTTTTTTGGGGTCGAGGTG should allow the Aa Argonaute protein to cut the M13mp18 ssDNA behind base 100. combination with A1 (cuts at 3100) should result in two destinc bandes on the gel with a 1:2 size ratio
*AGO: over night dialysis to exchange buffer to the "AGO assaybuffer". NanoDrop: 0.575 mg/ml --> 6µM in ca. 1.2 ml buffer -> -20°C freezer
*AGO cleavage assay with M13mp18 ssDNA was roughly performed following the original RNA assay (Ma et al.):
15µl of the Aa Argonaute protein in the "Ago assay buffer" were incubated 30 minutes with 1µl of 100µM of the guideoligo A1 (ACAACCATCGCCCACGCATAA)at 55°C
Then 20µl of M13mp18 ssDNA (248ng/µl)was added and incubated for 30 minutes at 55°C
One half of the solvent was treated with proteinase K solution, the other was untreated added to the agarose gele --> we obtained 2 bands which might be the circular M13 DNA and the linear M13 DNA

Agarose gele of AGO M13 digest; Lanes: Marker:1kb ladder, AGO M13 digest, AGO M13 digest treated with Proteinase K, untreated M13 ssDNA
On lane two there is a clearly visible bandshift. The band on the very bottom of lane three is most likely the guide oligo that was released when the AGO was destroyed by the proteinase.
Next week we will do another assay with two guide oligos (A1 and A4) that should result in two distinct bands and thereby allow as to exclude the possibility that the bandeshift is due to AGO bound to the targed ssDNA
*AGO PCR to craeat an Aa AGO BB part failed and will be repeated on Monday

06.09.09, Hannes


*Inoculation of: - BL21de3 pEx-StrepDigSplitFoka
- BL21de3 pEx-HisDigSplitFoka
- pEx-HisFluASplitFoki-36GS-Foka

07.09.09, Laura, Manu, Gerrit, Christoph, Isabel, Anika


*Prepared LB Medium (10l)

*Purification via Strep-Tactin column of Strep-Dig-Split-Foka
*SDS Gel with eluate fractions E1 til E7 and washfractions W2 til W3 and NEB prestained proteinmarker ---> see picture result: no fusioned protein StrepDigSplitFoka eluated
*Plamidpreparation of pEx His-FluA-Split-Foki-36GSLi-Foka, glycerol stocks and sequencing
*Glycerol stocks of pEx-Strep-Dig-Split-Foka and pEx-His-Dig-Split-Foka
*Cutting experiments and analytical agarose gel of digested M13 DNA hybridized with Fok control 1 and 2, pure oligos 1 and 2, pure ds and ss M13 DNA, 1kb ladder [[Image:2009-09-07_M13_2.Bild.jpg |none|thumb|Analytical Agarose Gel of M13 Digest; Lanes: Marker:100bp ladder, Fok Control Oligo 1, Fok Control Oligo 2, M13 ssDNA Hybridized with Fok Control 1 and 2, M13 ssDNA Hybridized with Fok Control 1 and 2, ds and ss M13 DNA|400x400px]]
*Starter culture of pEx-His-Flua-Split-Foki(amp plate of 25.08.09)in BL21DE3 (200 ml LB + amp)
*Hybridisation of long, middle and short linker
*pEx His-FluA-Split-Foki-36GSLi-Foka is now called FokM [http://www.molbiotech.uni-freiburg.de/iGEM/wiki2009/index.php/Fok_monomer Sequenz]
*Transformation of FokM into BL21 de3 gold

08.09.09, Manu, Gerrit, Christoph, Sarah, Anika, Hannes, Laura, Isabel, Julia


*made LB Agar
*poured amp plates (3 plates left)
*ligation of short, middle and long linker (hybridized at 07.09.09) and pMA vector (gelex from 27.08.09)
*ligation of short, middle and long linker (hybridized at 07.09.09) and pMA_Foki (gelex from 28.08.09) and pMA_Foka (gelex from 27.08.09)
*made SDS gel of collected pellets (T0-3) from expression of StrepDigSplitFoka and HisDigSplitFoka aim: to see if induction of expression of fusioned protein was successful

SDS-Gel; pExHisDigSplitFoka ; Lanes: NEB prestained protein marker, expression fraction T0, T1, T2, T3, T1, T2, T3
SDS-Gel; pExStrepDigSplitFoka ; Lanes: NEB prestained protein marker, expression fraction T0, T1, T2, T3, T1, T2, T3

*Stripping of Ni-NTA column
*made starter culture (300ml LB+Amp+1%Glucose) with pEXHisDigSplitFoki in BL21de3
*Made gradient PCR (+-5 in first 10 cycles; +-2.5 in last 14 cycles) to generate BB Aa AGO part. Therefor optimised pcr protocoll and made an additional approach using DMSO

09.09.09, Gerrit, Christoph, Sarah, Isabel, Anika, Hannes, Laura, Max, Julia, Dieter


*expression of pExHisFluASplitFoki in 6 times 1 ml LB and Amp - pellets were taken at T0 (time of induction with IPTG), T1, T2, T3, T4
- at the end culture was centrifuged down at 4000rpm, 20 min, 4°C
- pellets frozen in -80° C

* Repetition of AGO cleavage assay, using oligos A1 and/or A4 to determine whether bandshift was due to AGO bound to the DNA or cleavege of the ssDNA target--> Agarose gel revealed several promising bands (see picture). Results have to be dicussed yet.
* test digestion of FokM shows that vector and insert are to small
* test expression of FokM aborted
* new cloning of FokM has to be done tomorrow
*new measurement of concentration of HisFluASplitFoki (dialysed at 03.09.09)
*Agarosegel of yesterdays gradient PCR again showed none of the expected bands.
-> Gel of the used template "Aa AGO in pET28a 27.08.09 1" revealed an unexpected strong band at app. 20kb. pET28a with the Aa AGO as an insert should be 7.5kb in size. No such band was observed.
* Therefore a new PCR was started using the original optimised PCR protocol (first annealing temperature 55°C, second 65°C) using the sample "Aa AGO in pET28a 27.08.09 2" as a template
*measurement of fluorescence of FluA marked oligo, protein, and oligo and protein (quenching)
*inoculation of short, middle and long linker in pMA, pMAFoki and pMAFoka

10.09.09, Manu, Hannes, Christoph, Timo, Gerrit


*His-tag purification with Ni-NTA column of expression products from yesterday (09.09.09)- HisFluASplitFoki
*Glycerin Stocks of: pMA short linker 1,2 + Fok a/i 1,2 from 09.09.09
pMA middle linker 4,5 + Fok a/i 4,5 from 09.09.09
pMA long linker 1,2 + Fok a/i 1,2 from 09.09.09

*Pellets of: pMA short linker 3,4,5,6 + Fok a/i 3,4,5,6 from 09.09.09
pMA middle linker 1,2,3,6 + Fok a/i 1,2,3,6 from 09.09.09
pMA long linker 3,4,5,6 + Fok a/i 3,4,5,6 from 09.09.09

*digestion of pEX_His_fluA_Split_Foki of 26.08.09 with NgoMIV and PstI
*digestion of pMA_36GSlinker of 28.08.09 AgeI and PstI
*gelextraction of vector and insert
*quick ligation of pEX_His_FluA_Split_FokI and 36GSLi
*transformation of pEX_His_FluA_Split_FokI+36GSLi into RV308
*plasmid preparation of pMA short linker, pMA middle linker, pMA long linker
*plasmid preparation of pEX-short/middle/long-Linker-Fok(active/inactive)
*digestion of pEX-short/middle/long-Linker-Fok(active/inactive) with NgoMIV and PstI, over night at 37°C '''Nanodrop-Data:'''
Sample ID User ID Date Time ng/ul A260 A280 260/280 260/230 Constant
pMA-Short_Linker 1 FreiGEM 10.09.2009 12:38 140,47 2,809 1,461 1,92 2,12 50
pMA-Short_Linker 2 FreiGEM 10.09.2009 12:39 117,82 2,356 1,234 1,91 1,99 50
pMA-Long_Linker 1 FreiGEM 10.09.2009 12:40 131,21 2,624 1,349 1,94 2,18 50
pMA-Long_Linker 2 FreiGEM 10.09.2009 12:40 158,86 3,177 1,668 1,9 1,85 50
pMA-Middle_Linker 1 FreiGEM 10.09.2009 12:41 197,16 3,943 2,059 1,92 2,06 50
pMA-Middle_Linker 2 FreiGEM 10.09.2009 12:42 137,14 2,743 1,427 1,92 2,19 50
pMA-Long_Linker-Foka 1 FreiGEM 10.09.2009 12:43 173,32 3,466 1,8 1,93 2,25 50
pMA-Long_Linker-Foka 2 FreiGEM 10.09.2009 12:44 151,38 3,028 1,571 1,93 2,24 50
pMA-Long_Linker-Foki 1 FreiGEM 10.09.2009 12:44 156 3,12 1,639 1,9 2,21 50
pMA-Long_Linker-Foki 2 FreiGEM 10.09.2009 12:45 167,47 3,349 1,735 1,93 2,22 50
pMA-Short_Linker-Foki 1 FreiGEM 10.09.2009 12:45 160,29 3,206 1,68 1,91 2,21 50
pMA-Short_Linker-Foki 2 FreiGEM 10.09.2009 12:46 159,35 3,187 1,648 1,93 2,23 50
pMA-Short_Linker-Foka 1 FreiGEM 10.09.2009 12:47 207,54 4,151 2,191 1,89 2,21 50
pMA-Short_Linker-Foka 2 FreiGEM 10.09.2009 12:47 200,95 4,019 2,107 1,91 2,21 50
pMA-Middle_Linker-Foki 1 FreiGEM 10.09.2009 12:48 185,79 3,716 1,939 1,92 2,22 50
pMA-Middle_Linker-Foki 2 FreiGEM 10.09.2009 12:49 180,42 3,608 1,865 1,93 2,22 50
pMA-Middle_Linker-Foka 1 FreiGEM 10.09.2009 12:50 196,37 3,927 1,997 1,97 2,19 50
pMA-Middle_Linker-Foka 2 FreiGEM 10.09.2009 12:50 180,62 3,612 1,895 1,91 2,25 50
NgoMIV_36GSLi_PstI FreiGEM 10.09.2009 15:40 1,72 0,034 0 -336,01 0,01 50
pEX_His_FluA-Split_FokI_AgeI_PstI FreiGEM 10.09.2009 15:41 0,52 0,01 -0,017 -0,6 0 50

11.09.09, Manu, Hannes, Christoph, Laura, Anika


*labtalk
*SDS gel of protein purification from yesterday (10.09.09) HisFluASplitFoki

SDS-Gel; pExHisFluASplitFoki ; Lanes: NEB prestained protein marker, elution fractions E1-5, W1-2, D2-3
SDS-Gel; pExHisFluASplitFoki ; Lanes: NEB prestained protein marker, expression fraction T0, T1, T2, T4, T5
NEB prestained protein marker broad range

*concentrations of eluate fractions 1-4 weren't measureable at photometer and nanodrop (weird spectra)
*Eluate fractions 1-4 were frozen at -80°C
*Checking of the plates pEX_His_FluA_Split_Foki_36GsLi RV308 (Trafo of 10.09.09) showed none Bacteriagrowth, perhaps problems with the GelEX
*gelextraction of NgoMIV-Short/Middle/LongLinker-FokA-PstI (the Fok(inactive) digests didn't work: no bands on the gel)

14.09.09, Gerrit, Manu, Laura, Anika, Isabel, Timo


*fetched a new QuickLigase-Kit at the NEB-Freezer
*aliquoted the QuickLigase Buffer to 20 µl aliquots
*Ligation of vector:pEX_His_FluA (gelex from 20.08.09) with insert: Short/Middle/Long-Linker-Foka(Gelex from 11.09.09)
Vector: 3 µl pEX_His_FluA from 20.08.09 (digested with AgeI and PstI)
Insert: 6 µl Short/Middle/Long-Linker(Gelex from 11.09.09, digested with NgoMIV and PstI)
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock

*Ligation of vector:pEX_His_Dig (gelex from 27.08.09) with insert: Short/Middle/Long-Linker-Foka(Gelex from 11.09.09)
Vector: 3 µl pEX_His_FluA from 27.08.09 (digested with AgeI and PstI)
Insert: 6 µl Short/Middle/Long-Linker(Gelex from 11.09.09, digested with NgoMIV and PstI)
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock

*Ligation of vector:pEX_Strep_Dig (gelex from 27.08.09) with insert: Short/Middle/Long-Linker-Foka(Gelex from 11.09.09)
Vector: 3 µl pEX_His_FluA from 27.08.09 (digested with AgeI and PstI)
Insert: 6 µl Short/Middle/Long-Linker(Gelex from 11.09.09, digested with NgoMIV and PstI)
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock

*Ligation of vector:pMA_Foki (gelex from 27.08.09) with insert: Short/Middle/Long-Linker(hybridized 07.09.09)
Vector: 3 µl pMA_Foki (digested with XbaI and NgoMIV)
Insert: 6 µl Short/Middle/Long-Linker(cutting sites: NgoMIV and PstI)
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock

*transformation of pEx-His-FluA-Short/Middle/LongLinker-Fok(active) into RV308
*transformation of pEx-His-Dig-Short/Middle/LongLinker-Fok(active) into RV308
*transformation of pEx-Strep-Dig-Short/Middle/LongLinker-Fok(active) into RV308
*transformation of pMA-Short/Middle/LongLinker-Fok(inactive) into RV308
*prepared SDS gels
*Digest of pMA_Foki(prep I 05.08.09) with XbaI and NgoMIV
Plasmid: 10 µl
water: 14.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 4 igem stock
Restriction_enzyme_1 : 1 µl XbaI from NEB KuKlabstock
Restriction_enzyme_2 : 1 µl NgoMIV from NEB KuKlabstock
-> preparative gel, freezed gel slice in case ligation won't work again
*test-digest of pMA_short/middle/longlinker_Foka/i(prep 10.09.09) with FokI
Plasmid: 4 µl
buffer: 0.5 µl buffer 4 igem stock
Restriction_enzyme_1 : 0.5 µl FokI from igem stock


Analytical agarose-Gel; Lanes: NEB 100 bp DNA ladder, pMAShortliFoka, pMAMiddleliFoka, pMALongliFoka, pMAShortliFoki, pMAMiddleliFoki, pMALongliFoki,
-> all probes were sent to sequencing

*ordering of fluorscin marked oligos
*preparation of competent cells: RV308, there is no antibiotic in the approach because this bacterial strain has no resistance(on shaker in 37°C romm over night until tomorrow)
*planning of Fos_bZip with freigem restricion sites
* Sequencing of - pMAShortlinker clone 1 plasmid prep of 10.09
- pMAmiddellinker clone 2(4) plasmid prep of 10.09
- pMAlonglinker clone 1 plasmid prep of 10.09
- pMAShortlinker+FokA clone 2 plasmid prep of 10.09
- pMAShortlinker+FokI clone 2 plasmid prep of 10.09
- pMAmiddellinker+FokA clone 4(2) plasmid prep of 10.09
- pMAmiddellinker+FokI clone 4 plasmid prep of 10.09
- pMAlonglinker+FokI clone 1 plasmid prep of 10.09
- pMAlonglinker+FokA clone 1 plasmid prep of 10.09

* digest with HaeII (+76, NEB IV, BSA) of 28 minipreps Plasmid: 5 µl
water: 3,6 µl
BSA: 0.1 µl (100x)from iGEM stock
buffer NEB IV: 1 µl buffer (10x)from iGEM stock
Restriction_enzyme_1 : 0,3 µl HaeII

*preparative gel (1%) Marker 1kb; -Eco 86/88; -Eco 86/89; TTT 86/88; TTT 86/89; Taq 86/88; Taq 86/89 Marker 1kb; -Eco 87/88; -Eco 87/89; TTT 87/88; TTT 87/89; Taq 87/88
*gel extraction of (kit from Janina) Taq 86/88, Taq 86/89, Taq 87/88, Taq 87/89 in 50 µl 70°C water
*analytic gel (1%) Marker 1kb; samples 442-1, 442-2, 442-3; samples 443-1, 443-2, 443-3; 427-1 to -12; 424-1 to -12; Taq 87/89
*transformation of EcoRI-removal ligation TorA-flag and DsbA-flag, vector control
* Inoculation of: - startingculture His+Dig+Split+FokA (from 31.08.09) 200ml LB+200µl Amp + 2g glucose --> 24°C 180rpm

15.09.09, Manu, Hannes, Gerrit, Anika, Sarah, Laura


*over-night culture of pEX-His-Dig-Split-Fok(active) showed an OD(600) of 0,132. No expression was started.
*the LB/Amp plates of pEx-His/Strep-Flua/Dig-Short/Middle/LongLinker-Fok(active) show only few colonies. One construct is completly missing (pEx-His-Dig-ShortLinker-Fok(active)).
*the LB/Amp plates of pMA-Short/Middle/LongLinker-Fok(inactive) showed many colonies.
* Plamidpreparation of RV308 pMA_36GSLi Klon3/4(plate from 27.08.09), glycerol stocks and sequencing
* continued phage display: digestion of 442-1 of 14.09.09 with XmnI and NheI
Plasmid: 20 µl
water: 3,7 µl
BSA: 0.3 µl (100x)from iGEM stock
buffer NEB IV: 3 µl buffer (10x)from iGEM stock
Restriction_enzyme_1 : 1,5 µl XmnI from NEB KuKlabstock
Restriction_enzyme_2 : 1,5 µl NheI from NEB KuKlabstock
digestion of 443-1 of 14.09.09 with XmnI and NheI
Plasmid: 18 µl
water: 5,7 µl
BSA: 0.3 µl (100x)from iGEM stock
buffer NEB IV: 3 µl buffer (10x)from iGEM stock
Restriction_enzyme_1 : 1,5 µl XmnI from NEB KuKlabstock
Restriction_enzyme_2 : 1,5 µl NheI from NEB KuKlabstock
finished transformation of 436;423-427 and V/1;V/6;V/411;V/375

*chemical competent cells of RV308
*glycerol stock of RV308
*preparation of electrical competent cells: RV308, there is no antibiotic in the approach because this bacterial strain has no resistance(on shaker in 37°C romm over night until tomorrow)
*simulated Hybridization of M13 DNA - hybridization with Fok control 2 & 3 oligos
- 10µl M12 ssDNA
- 10µl MgCl from iGEm Stock
- 5µl Tris-HCl
- 2µl Fok-Kontrolle 2 (org. Tube from 28.07.09)
- 2µl Fok-Kontrolle 3 (org tube from 06.08.09)

* Testdigest with FokI with:
10µl M13DNA+Oligo2+3
1,2µl Puffer4
1µl FokI
Gel:
Marker / ssDNA+Oligo2+3+Fok / ssDNA+Oligo2+3+Fok / ssDNA+Oligo2+3 37° / ssDNA+ Oligo2+3 4°
BILD

*ordered His_GSG_Fos_bZip

16.09.09,Gerrit, Anika, Sarah, Laura, Isabel


*made plasmid preparation of pEX-Strep-Dig-middleLinker-FokA clone 1 and clone 2
pEX-Strep-Dig-shortLinker-FokA clone 1 and clone 2
pEX-His-Dig-middleLinker-FokA clone 1 and clone 2
pEX-His-FluA-shortLinker-FokA clone 1 and clone 2
pEX-His-FluA-middleLinker-FokA clone 1 and clone 2
pMA-shortLinker-FokI clone 1 and clone 2
pMA-middleLinker-FokI clone 1 and clone 2
pMA-longLinker-FokI clone 1 and clone 2
glycerol stocks stored in "iGEM AA" at -80°C
*continued phage display - plasmid preparation of:
444-1,444-2,444-3;445-1,445-2,445-3;443-1;442-1
- sequencing of 444-1 and 445-1 with primer:sfLacP1
- digest of 444-1 and 445-1 with SfiI and NheI
'''444-1'''
Plasmid: 19 µl
water: 5 µl
BSA: 0.3 µl (100x)from iGEM stock
buffer NEB IV: 3 µl buffer (10x)from iGEM stock
Restriction_enzyme_1 : 1,5 µl SfiI from NEB KuKlabstock
Restriction_enzyme_2 : 1,5 µl NheI from NEB KuKlabstock
'''445-1'''
Plasmid: 15 µl
water: 9 µl
BSA: 0.3 µl (100x)from iGEM stock
buffer NEB IV: 3 µl buffer (10x)from iGEM stock
Restriction_enzyme_1 : 1,5 µl SfiI from NEB KuKlabstock
Restriction_enzyme_2 : 1,5 µl NheI from NEB KuKlabstock
- preparative gel (1%)of digest of 442-1 and 443-1, 440-5

*expression cultures (4 flasks à 1l) of HisDigSplitFoka - took pellets at T0-T4
- centrifuged at 4000 rpm, 4°C, 20 min
- froozen pellets in -80°C

*made 5l LB medium
* electrical competent cells of RV308, stored in box at -80°C

17.09.09,Hannes, Anika, Sarah, Laura, Isabel, Timo, Manuel


*Digest of pEX_His_FluA (prep 20.08.09 clone), pExHisDig (prep 27.08.09, clone 1) and pExStrepDig (prep 27.08.09, clone 1) with AgeI and SpeI
Plasmid: 10 µl
water: 14.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 4 NEB iGEM stock
Restriction_enzyme_1 : 2 µl AgeI from NEB KuKlabstock
Restriction_enzyme_2 : 1 µl SpeI from NEB KuKlabstock

*Digest of pMA_Shortli_Foki (prep 10.09.09 clone 2), pMA_Middleli_Foki (prep 10.09.09 clone 4) and pMA_Longli_Foki (prep 10.09.09 clone 1) with NgoMIV and SpeI
Plasmid: 10 µl
water: 14.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 4 NEB iGEM stock
Restriction_enzyme_1 : 1 µl NgoMIV from NEB KuKlabstock
Restriction_enzyme_2 : 1 µl SpeI from NEB KuKlabstock
-> stored in -20°C
*preparation of binding buffer, washing buffer I and II and elution buffer for the ni-column
*purification of the expression cultures of 16.09.09 HisDigSplitFoka (ni-column)
*'''continued the phage display:'''
*preparation of 425-1 to 425-10; 428-1 to 428-10; 423-1,424-1,426-1,427-1,429-1,436-1

*test digest of all 425 and 428 probes with HaeII
DNA: 5 µl
water: 3,7 µl
BSA: 0.1 µl NEB iGEM stock
buffer: 1 µl buffer 4 NEB iGEM stock
Restriction_enzyme : 0,2 µl HaeII from NEB KuKlabstock

*dephosphorylation of the vector fragments 444 and 445 with SAP to stop the digest (2x1µl for 30min 37°C and 1X20min 70°C)

*preparative gel of the vector fragments pJs#375(digest and re-digest), 444 and 445 and gel extraction

18.09.09 Isabel, Sarah, Laura, Manu, Timo, Hannes, Anika

'''
*continued phage display'''
*sequencing of 423,424,426,427,429,436

*analytical gel of test digests of 425 (1-10) and 428 (1-10) and sequencing of
*ligation of V/444, V7445 and V/375 re-digest with 3 approaches: '''1)''' 1µl vector
5µl insert 10
1µl ligase buffer
1µl T4 ligase
2µl water
'''2)''' 1µl vector
5µl insert 11
1µl ligase buffer
1µl T4 ligase
2µl water
'''3)''' 1µl vector
1µl ligase buffer
1µl T4 ligase
7µl water

19.09.09 Julia


*Put plates from 37°C and digestion from 37°C room to the cooling room at 4°C
*Centrifuged 427-1; 424-1 down and froze the pellet at -20°C

21.09.09 Laura, Gerrit, Isabel, Sarah, Hannes, Anika, Julia


*continued phage display -plasmidpreparation of 424-1,424-2,424-3 and 427-1,427-2,427-3
-digestion of 424-1 with XmnI and NheI (37°C) for 6h
DNA: 58µl
buffer IV:11µl
BSA:1,1µl
enzyme_1: 1,5µl
enzyme_2: 1,5µl
-new digest of 444-1 and 445-1 with SfiI (50°C)for 6h and then with NheI (37°C over night)
'''444-1''' DNA: 19µl
buffer IV:3µl
BSA:0,3µl
water:4,7µl
enzyme_1: 1,5µl
enzyme_2: 1,5µl
'''445-1''' DNA: 15µl
buffer IV:3µl
BSA:0,3µl
water:8,7µl
enzyme_1: 1,5µl
enzyme_2: 1,5µl
-ligation of digests of 444-1,445-1 and 375(re-digest)
*SDS gel of HisDigSplitFoka

SDS-Gel; HisDigSplitFoka; Lanes: NEB prestained protein markerbroad range, elution fraction 1-9
SDS-Gel; HisDigSplitFoka; Lanes: NEB prestained protein markerbroad range, t0 (before induction), t1 (1 hour after induction), t2 (2 hours after induction), t3 (3 hours after induction), t4 (4 hours after induction), flow through fraction 1, flow through fraction 3, washing fraction 1, washing fraction 3
NEB prestained protein marker broad range

* Transformation with chemical and electro competent cells(RV 308):
- did not work with chemical competent cells
- but worked with electro competent cells, absorption wavelength 400 nm (like CFP)
(pictures coming soon, not finished jet)
*Gel extraction with GelEx Kit from Quiagen: pEX-StrepDig, pEX-HisFluA, pEX-HisDig, short-linker Foki, middle-linker Foki, long-linker Foki
*Ligation with QuickLigase: -short-linker Foki +pEx-HisDig/+pEX-HisFluA/+pEX-StrepDig -middle-linker Foki +pEx-HisDig/+pEX-HisFluA/+pExStrepDig -long-linker Foki +pEx-HisDig/+pEX-HisFluA/+pEX-StrepDig
*Transformation of Ligations with 100µl RV competent cells, 37°C room over night
*sorting of right and wrong sequenced parts and parts which need subsequent cloning into a different vector
*lab talk (Kristian, Tobias, Sven, Gerrit, Laura) - DsbA-signalsequence for the exprot into the periplasma will be cloned to the Foka completed parts
- in vivo experiment of e.colis cotransformated with Foka and Foki completed plasmids, elektroporated, transformated with M13 DNA ss with hybridized oligos, fluroescent oligos and without oligos
-> plaque essay will show efficency of Fok
- in vitro essay will be done with Fos fusioned to Foka, JUN fusioned to GFP and Foki added to experiment

22.09.09 Gerrit, Isabel, Sarah, Max, Hannes, Caro, Timo, Julia, Laura


*continued phage display:'''
*plasmid prep of pEX His Dig Rest Klone 6 pellet
*digest of pEX His Dig plasmid prep of 22.09 with ageI and pstI
*digest of pEX Strep Dig plsamidprep of 27.08 with ageI and pstI
*digest of pEXHis FluA Split Foki 27.08 with xbaI and pstI , for rechieving a pEX vector
*gel extraction of the digests

1: pMA-Strep-Dig, 2: pEX-Strep-Dig

*Quick ligation of pEXvector+HisFluA(gel Ex of 6.08.09) ; pEXHisDig+middle linker Foka(gel EX 11.09), pEXStrepDig+middle linker Foka(gel EX 11.09) ,pEXStrepDig+short linker Foka(gel EX 11.09)
*Transformation of the different constructs into RV308 bacteria
*finishing of list of sequenced parts -> in folder SOPS

23.09.09 Gerrit, Julia, Laura, Anika, Isabel

'''Periplasma-project'''
*Transformation of plasmid vectors in XL1blue competent cells: Tt-; Aa in pet 28a; pet 39b
*poured plates with Kan and Tet, 14 plates left in 4°c room
*put in 37°c room over night
*Digest of pMAStrep (prep of 09.07.09), pMAStrepFluA (prep of 06.08.09), pMAStrepDig (prep of 24.08.09) and pExStrepDig (prep of 27.08.09) with NgoMIV
purpose: to get rid of snd NgoMIV restriction site Plasmid: 10 µl
water: 16.5 µl
buffer: 3 µl buffer 4 NEB iGEM stock
Restriction_enzyme_1 : 1 µl NgoMIVI from NEB KuKlabstock

*preparative gel and gel extraction

1: pMA-Strep-Dig, 2: pEX-Strep-Dig


1: pMA-Strep, 2: pMA-Strep-FluA

*ligation and transformation

* phage display - pelleted newly grown vector constructs (AGO)

24.09.09 Gerrit, Julia, Laura, Hannes, Caro


*plasmid preparation of - pExHisDigMiddleliFoka
- pExStrepDigMiddleliFoka
- pExStrepDigShortliFoka
- pExHisFluA
-> glycerolstocks in new glycerolstocks in -80°C, pellets in -20°C in pellet box
*SDS-gel of eluate, flow through and wash fractions of expressed and purified HisDigSplitFoka from 17.09.09
*Western Blot of HisDigSplitFoka SDS Gel, incubated with anti His-Tag antibodies --> no ECL signal
*repetition of M13 ssDNA digest with oligos "Fokkontolle 2+3" and FokI --> didn't work
*digest of pExHisFluASplitFoki (clon 2, 26.08.09) and pExStrepDigSplitFoka (clon 1, 29.08.09) purpose: to ligate these parts in order to get a construct for the in vivo assay Plasmid: 10 µl pExHisFluASplitFoki
water: 14.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 2 NEB iGEM stock
Restriction_enzyme_1 : 2 µl PstI from NEB KuKlabstock
Restriction_enzyme_2 : 1 µl SpeI from NEB KuKlabstock
Plasmid: 10 µl pExStrepDigSplitFoka
water: 14.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 3 NEB iGEM stock
Restriction_enzyme_1 : 1 µl PstI from NEB KuKlabstock


*preparative gel

Agarose-gel ; Lanes: NEB 1kb DNA ladder, pExHisFluASplitFoki, pExStrepDigSplitFoka
*overnight ligation at 18°C of polycistronic construct: pExHisFluASplitFoki_StrepDigSplitFoka
* inoculation
- pEX Strep+Dig+Split+FokA 10ml LB+Amp
- pEX_His+Dig+Split+FokA 10ml LB+Amp
- pEX Strep+Dig 5ml LB+Amp
- pMA_Strep+Dig 5ml LB+Amp
- pMA_Strep 5ml LB+Amp
- pMA_Strep+FluA 5ml LB+Amp



1: pEX-Strep-Dig-LL-Foki, 3: pEX-His-FluA-LL-Foki, 5: pEX-His-Dig-LL-Foki, 7:pEX-His-Dig-ML-Foki

* Periplasma Project
*1) Inoculation - Pet39bXLblue in 100ml LB + 100µl KAN + 100µl TET
- aa in pet28aXL1blue in 100µl KAN + 100µl TET
- Tt- XL1blue in 100µl KAN + 100µl TET
- Incubation (37°C) for 6 hours

*2)Transformation --> XL1 blue pBadRDF
-Plasmid DNA 0,6µl -cells 40 µl -100 µl and rest platet out on AMP/Tet Plats
* 3)Miniprep - pJS419 - pJS418 - Concentrations determined with Nanodrop

*3) Testdigest 2:pEX Strep Dig split FokA
-digested with: XbaI and NgoniV
n: Fermentas GeneRuler DNA Ladder Mix |400x400px]] -To 1) DNA 22,97 [µl]
NEB4 3,0[µl]
XbaI 1,5[µl]
NganIV 1,5[µl]
BSA 0,5[µl]
H20 0,53[µl]
- To 2) DNA 21,97 [µl]
NEB4 3,0[µl]
XbaI 1,5[µl]
NganIV 1,5[µl]
BSA 0,5[µl]
H20 2,25[µl]
- Purification: 0,8% Agarosegel
- Quigen Gelex SpinKit

25.09.09 Gerrit,Laura,Hannes,Isabel,Max,Anika,Caro, Timo


*Periplasma Project 1) Ligation with Quick Ligase from NEB
- 2fold Quick Ligase Buffer 10µl
- DNA ( Insert(0,5µl)+Vector(9µl))
- Ligase 1µl
-10 min Ligation at RT

2) Miniprep
pEX His Dig Split FokA
pEX Strep Dig Split FokA
Nanodrop Data [[Image:Freiburg_09 Nanodrop 25-9.jpg |none|thumb|The two last lines only|400x400px]]

Stored: Plasmidbox in freezer

* Amp preparation, -20°C

* Plasmidprep
- pEXStrep+Dig Clone 1+2 (Tube 1+2)
- pMA_Strep+Dig Clone 1+2 (Tube 3+4)
- pMA_Strep Clone 1+2 (Tube 5+6)
- pMA_Step+FluA Clone 1+2 (Tube 7+8)
--> -80°C


* pellets of:
- pEX_Strep+Dig Clone 3+4 (Tube 9+10)
- pMA_Strep+Dig Clone 3+4 (Tube 11+12)
- pMA_Strep Clone 3+4 (Tube 13+14)
- pMA_Step+FluA Clone 3+4 (Tube 15+16)
--> -20°C


* Transformation of
pEX_His+FluA+Split+Foki+Strep+Dig+Dig+Split+FokA into RV308 and XBL

* phage display - error prone PCR
water: 29,3µl
DNA: 1,8µl
buffer: 5µl (10x, without MgCl2)
primers (87/88 or 87/89): 1,5µl each
dNTPs: 1,5µl (10mM each)
Taq: 1µl
MgCl2: 12µl (25mM)
MnCl2: 5µl (5mM)

26.09.09 Caro


* Inoculation - 4 clones respectively of:
-pEX His dig ML FokA
-pEX Strep Dig SL FokA
-pEX His FluA
-pEX Strep Dig ML FokA

-pEX His FluA Split Foki Strep Dig Split FokA aus RV308
-pEX His FluA Split Foki Strep Dig Split FokA aus XL
- Medium:
- 200 ml LB
- 2g Glucose (sterile filtered)
- 200 µl AMP


* new DsbA SS insertion in front of FokA constructs
- 3 h digestion of pEX_His_Dig_Split_FokA (prep 25.9.) & pEX_Strep_Dig_Split_FokA using 1.5 µL XbaI, NgoMIV in 30 µL final
- 0.8 % agarose gel
- GelEx, 30 µL elution
- Quickligation using 1:3 ratio, 10'
- transformed XL1 & BL21 chemically using 10 µL ligation rx. (low conc.) & 50 µL cells

27.09.09 Anika, Hannes


* Miniprep [[Image:Freiburg09_270909_Minipreps.jpg|none|thumb||600x600px]]
* test digest of DsbA ss insertion - 800 ng DNA, 0.5 µL AvaI & XbaI, 15 µL total, 30'
- 2 % high-res agarose gel, 100 bp ladder (expected: 237 bp for His, 242 bp for Strep, failure = 184 bp)
* all new DsbA insertion transformations successful, control plate empty --> o/n cultures in LB (Glu, Amp), 4 each (DsbA_His_Dig_Split_FokA & DsbA_Strep_Dig_Split_FokA, XL1 & BL21)

*Inoculation of starter culture for expression -pExHisFluASplitFoki in BL21de3 (300ml LB Amp, 1% glucose)
--> 26°C
*inoculation of -pEx_DsbAss_HisDigSplitFoka in XL1
-pEx_DsbAss_StrepDigSplitFoka in XL1
-pEx_DsbAss_HisDigSplitFoka in BL21
-pEx_DsbAss_StrepDigSplitFoka in BL21
in 5ml LB Amp, 1% glucose

28.09.09 Isabel, Sarah, Gerrit, Anika, Hannes, Timo, Caro, Max


*plasmid preparation of pEX_DsbAss-His-Dig-Split-FokA (clone 1-5) and pEX-DsbAss-Strep-Dig-Split-FokA (clone 1-5)
*continued phage display - plasmid preparation of pJs#440
- error prone PCR
water: 21,75µl
template: 1,5µl
primers (87/88 or 87/89): 1,5µl (10µM) each
dNTPs: 1,5µl (10mM each)
Taq: 1µl
buffer(10x): 5µl
MnCl2: 5µl (5mM)
MgCl2: 12µl (25mM)
-> 4 samples of 87/88 and 87/89 each
water: 26µl
pcr-product ("template"): 2µl
primers (87/88 or 87/89): 1,5µl each
dNTPs: 1,5µl (10mM each)
Taq: 1µl
buffer: 5µl
MnCl2: 2,5µl
MgCl2: 9µl
-> 4 samples of 87/88 and 87/89 each

*transformation of pEx_HisFluASplitFoki in BL21de3
*inoculation of -pEx_HisDigSplitFoka in XL1blue (?)
-pEx_StrepDigSplitFoka in XL1blue (?)

29.09.09 Gerrit, Anika, Hannes, Caro, Laura, Christoph, Max


*Identified the mutation that was revealed by the latest sequencing: All plasmids bared a mutation that led to an exchange in amino acid sequence: 371 L->S. The aa 371 (indicated in pink on the right) is part of an peripheral alpha helix in the mid-domain of the argonaute protein and has no contacts to aa outside of the alpha helix and should the thereby not have major influence of the structure or function of the protein. [[Image:Freiburg 09 Mutation in AGO.png|none|thumb||600x600px]]
*because the ligation pExHisFluASplitFoki_StrepDigSplitFoka didn't work a new digest of pExHisFluASplitFoki and pExStrepDigSplitFoka was done: Plasmid: 10 µl pExHisFluASplitFoki, clone 1 (100µl) from 26.08.09
water: 14.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 2 NEB iGEM stock
Restriction_enzyme_1 : 2 µl PstI from NEB KuKlabstock
Restriction_enzyme_2 : 1 µl SpeI from NEB KuKlabstock
Plasmid: 10 µl pExStrepDigSplitFoka, clone from 29.08.09
water: 14.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 3 NEB iGEM stock
Restriction_enzyme_1 : 2 µl XbaI from NEB KuKlabstock
Restriction_enzyme_2 : 1 µl PstI from NEB KuKlabstock
->put in 37°C for 2h
*dephosphorylation of vector pExHisFluASplitFoki by SAP DNA: 30µl
SAP: 0,5µl
SAP buffer: 3,5µl
water: 1µl
- 37°C for 30min
- 70°C for 20min
- PCR purification Kit (normally direct digest would have been sufficient

*preparative gel of digest to gain vector and insert

1: pEx-HisA-FluA-splitli-Fok_i, 2: pEX-Strep-Dig-Split-Fok_a

*gel extraction

1:Streo-Dig-Split-FokA, 2: pJS419, 3:His-Dig-Split-Fok_a, 4: RBS-Strep-Dig-Split-Fok_a

*ligation of pExHisFluASplitFoki and StrepDigSplitFoka, pExHisFluASplitFoki (as negativ control)
*transformation of pExHisFluASplitFoki_StrepDigSplitFoka and pExHisFluASplitFoki (negative control)
*PCR primer forward and reverse for the in vivo assay/ polycistronic assay arrived -> PCR with pEXStrepDigSplitFoka was done to amplificate the gene and insert a RBS site simultanously
*Inoculation of starter culture for expression and glycerol stocks: - pEx_HisFluASplitFoki in BL21de3 (300ml 2YT Amp, 1% Gluc) --> 26°C

*Inoculation of - pET-39b+ in XL1blue (15ml LB+Kan) --> plasmidprep for cleavage assays with AGO tomorrow
--> 37°C over night

*sequencing of HisFluASplitFoki clone 1 (100µl) from 26.08.09

30.09.09 Gerrit, Hannes, Caro, Anika, Max, Isabel, Christoph, Julia


*cloning His_ & Strep_ Dig_Split_FokA into pJS 419 phagemid vector - digested pEX vectors & pJS419 w/ XbaI, NotI using 16 µL DNA
--> 1 % agarose gel
*ssDNA production - digestion of pET-39b(+): EcoRI, XbaI
- digestion of M13 dsDNA: BspTI (isoschizomer of AflII), NarI

* Miniprep. of pET-39b+ ,stored in -20°C
* Miniprep. of RV_Test ,stored in -20°C
* phage display - error prone PCR
50µl PCR buffer (10x) without MgCl2
50µl MnCl2 (5mM)
120µl MgCl2 (25mM)
15µl primer #7
11,7µl primer #1
20µl dNTPs (each 10mM)
10µl Taq
218,3µl water
apportion total into 2 tubes à 245µl
add 5 µl of plasmid 425-2 and 428-6 (each 50ng/µl)
make aliquots à 50µl
- ligation
2 samples:
2µl vector
12µl insert (digest 87/88)
1µl Ligase
2µl Ligase buffer
3µl water
3 samples:
2µl vector
20,4µl insert (digest 87/89)
1µl Ligase
2,6µl Ligase buffer

*digest of pExStrepDigSplitFoka from 29.08.09 clon 1b because ligation or trafo didn't work and concentration of insert after gelex was probably too low

Agarose-gel ; Lanes: NEB 1kb DNA ladder, pExHisFluASplitFoki, pExStrepDigSplitFoka
Plasmid: 10 µl pExStrepDigSplitFoka, clone from 29.08.09
water: 14.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 3 NEB iGEM stock
Restriction_enzyme_1 : 2 µl XbaI from NEB KuKlabstock
Restriction_enzyme_2 : 1 µl PstI from NEB KuKlabstock
->put in 37°C for 2h
*preparative gel of digest -> didn't work (no insert could be seen)
*sequence of pExHisFluASplitFoki from 26.08.09, clone 100ul checked: ok
*protein expression of pEx_HisFluASplitFoki in BL21de3 --> pellets frozen at -80°C
*phosphorylised AGO A1 guide oligo via T4 Polynucleotid Kinase (with T4 Ligase Buffer) Final 20µl with 2.5 µM Oligo
*Started making Phages with wt Aa AGO: DsbA-flag-AGO-CDg3p; DsbA-flag-AGO-noAmber-CDg3p; TorA-flag-AGO-CDg3p; TorA-flag-AGO-noAmber-CDg3p -> Cells with the DsbA Phagmid-vektor showed very poor growth
* Prepared Phage ELISA via Anti-Flag as well as Strep-Biotinylated target Oligo






Retrieved from "http://2009.igem.org/Team:Freiburg_bioware/Notebook/September"