Team:Kyoto/CiC/Experiment

1. Home
2. Cells in Cells
3. Results & Discussion

Experiment

Construction

HIV-TAT::(LALAAAA)3 expressing vector (BBa_K210009)

†RBS+HIV-TAT+HIStag+(LALAAAA)3 was made by elongation of primer dimer.

(Forward primer;

cggaattcgcggccgcttctagagaaagaggagaaatactagATGTATGGACGTAAAAAACGTCGTGGACGTCGTCGTGGCGGCGGTCAT CATCATCATCACCATGGCGG

Reverse primer;

ctgcagcggccgctactagtaTTACGCGGCCGCCGCCAGGGCCAGCGCGGCCGCCGCCAGGGCCAGCGCGGCCGCCGCCAGG GCCAGGCCACCGCCATGGTGATGATGATG

Signal for TIM23 complex::GFP expressing vector (BBa_K210010)

†RBS+Signal for TIM23 complex::GFP+terminator was made by two-stage PCR.

First-stage PCR

Forward primer;

TTTAAACCGGCGACCCGTACCCTGTGCTCTTCTCGTTATCTGCTGcgtaaaggagaagaacttttcactggagttg

Reverse primer;

agtgagctgataccgctcgc

Second-stage PCR

Forward primer;

cggaattcgcggccgcttctagagaaagaggagaaatactagATGCTGAGCCTGCGTCAGTCTATTCGTTTTTTT AAACCGGCGACCCGTAC

Reverse primer;

agtgagctgataccgctcgc

Signal for TIM23 complex::EGFP expressing vector for HeLa cells

We made the phosphated primerdimer by below primers. And, ligate it and pEGFP-N3 (GenBank Accession #: U57609) digested by Xho1 and Pst1.

Forward primer;

TCGAGgccaccATGggtCTGAGCCTGCGTCAGTCTATTCGTTTTTTTAAACCGGCGACCCGTACCCTGTGCTCTTCTCGTTATCTGCTG

Reverse primer;

AATTCAGCAGATAACGAGAAGAGCACAGGGTACGGGTCGCCGGTTTAAAAAAACGAATAGACTGACGCAGGCTCAGaccCATg gtggcC

Making proteoliposome by RTS

1. Remove the solvent of 50mM DOPC (Di-oleyl phosphatidylcholine, resolute in chloroform: methanol=2:1) 100μl in Ar.

2. Desiccate the DOPC in vacuum

3. Add 50mM HEPES-KOH 100μl

4. Adjust liposome size by mini-extruder of 200nm pore size filter

5. Making proteoloposome by RTS

File:Kyoto RTS2.png

6. Ultracentrifuge RTS product in 5, 10, 15, 20, 25% sucrose HEPES-KOH solution.

Observation

Subgoal A

In the experiment on subgoal A, we are aimed to confirm that the liposome with HIV-TAT can intrude mammalian cells.We will mix pSB1A2-T7 promoter- HIV-TAT::(LALAAAA)3-ter and liposome with fluorochrome and translated by RTS. When HIV-TAT::(LALAAAA)3 is translated, it sticks the lipid bilayer. As a result, the liposome which has HIV-TAT on their surface is completed. Adding it to HeLa cells. Later, we will observe the fluorescence of liposome in HeLa cells.

Subgoal B

In the experiment on subgoal B, we are aimed to confirm that the recombinant of TIM23 complex can work as a protein translocater for its signal peptide. First, we confirm that the protein with the signal peptide for yeast can be taken in yeast’s and HeLa cell’s mitochondria. In the case of yeast’s mitochondria, we isolate mitochondria from yeast, translate signal GFP (BBa_K210010) by RTS and PURE system in which we have added the isolated yeast’s mitochondria. Then we will observe the localization of GFP fluorescence.

In the case of HeLa cell’s mitochondria, we transform HeLa cell by Signal for TIM23 complex::EGFP expressing vector for HeLa cells. Later, we will observe the localization of EGFP fluorescence.

Second, we make proteoliposome which has the recombinant of yeast TIM23 complex and mix it in Signal for TIM23 complex::GFP which is translated by RTS. Then we will observe the localization of GFP fluorescence.