From 2009.igem.org
(Difference between revisions)
|
|
Line 488: |
Line 488: |
| <br> | | <br> |
| <div class="heading"> | | <div class="heading"> |
- | Descriptive Title of What You're Doing
| + | Building Engineered Cells in the Synthetic Kingdom |
| </div> | | </div> |
| <br> | | <br> |
| <div class="desc"> | | <div class="desc"> |
| </html> | | </html> |
- | WIKI CODING HERE
| + | Construction of a GFP activity has been completed in Second Life. Clicking a jellyfish will dispense GFP, which the person can then put in their inventory. Then they can open the inventory of a bacteria in the area and place the GFP inside. As a result, the bacteria will glow green for a period of time after which the script will reset until the next person places the protein inside. This activity will also serve as a tutorial for inventory management for people new to Second Life. A note card will be added later on explaining the protein so others will understand how it can be expressed in the bacteria even though it has been extracted from a jellyfish. |
| | | |
| <html> | | <html> |
Revision as of 15:45, 29 July 2009
University of Calgary
|
CAROL
Analyzing ''E.coli'' Colonies
- Minimal growth of E.Coli on LB plates with Kan resistance. There were only 5 colonies found. None of the colonies were glowing. We are not sure what 'glowing' would look like.
- Ordered primers that would allow us to clone part BBa_B0040 in front of the luciferase operon. The following is the primers that were ordered.
XhoI-R40-F: GCGCTCGAGTCCCTATCAGTGATAGAG
BamHI-R40-R: GCGGGATCCGTGCTCAGTATCTCTATC
- These primers would allow us to attach XhoI and BamHI sites onto part BBa_B0040 by PCR and then we are able to clone this part into pCS26 vector with luciferase as the reporter. This should allow us to see the glowing from the luciferase operon in the plasmid.
|
|
CHINMOYEE
Descriptive Title of What You're Doing
|
|
EMILY
Descriptive Title of What You're Doing
|
|
FAHD
Calling Oil & Gas and Research & Development Pharmaceutical Companies
Following is a list of Research & Development Pharmaceutical Companies I contacted and researched on today:
1) Life Technologies Inc.
2) Charles River Labs
3) Boheringer Ingelheim Canada Ltd.
4) EMD Chemicals
5) Paladin Labs
6) VWR Canada
Following is a list of Oil & Gas Companies I contacted and researched on today:
1) Teck Coal Ltd.
2) Focus Corporation
3) Imperial oil resources
4) Enbridge Pipelines
5) Bietz Resources
6) Bow Valley Energy Ltd.
7) Ithaca Energy Inc.
For today, Boheringer Ingelhiem Canada was the only Research & Development Pharmaceutical Company that said that it might be able to help us. I will do a follow-up on our 2009 iGEM sponsorship proposal next week.
|
|
IMAN
Descriptive Title of What You're Doing
|
|
JAMIE
Descriptive Title of What You're Doing
|
|
JEREMY
Descriptive Title of What You're Doing
|
|
KATIE
Descriptive Title of What You're Doing
|
|
KEVIN
Descriptive of What You're Doing
|
|
MANDY
Descriptive Title of What You're Doing
|
|
PATRICK
Descriptive Title of What You're Doing
|
|
PRIMA
Descriptive Title of What You're Doing
|
|
STEFAN
Building Engineered Cells in the Synthetic Kingdom
Construction of a GFP activity has been completed in Second Life. Clicking a jellyfish will dispense GFP, which the person can then put in their inventory. Then they can open the inventory of a bacteria in the area and place the GFP inside. As a result, the bacteria will glow green for a period of time after which the script will reset until the next person places the protein inside. This activity will also serve as a tutorial for inventory management for people new to Second Life. A note card will be added later on explaining the protein so others will understand how it can be expressed in the bacteria even though it has been extracted from a jellyfish.
|
|
VICKI
Descriptive Title of What You're Doing
|