From 2009.igem.org
(Difference between revisions)
|
|
Line 394: |
Line 394: |
| <br> | | <br> |
| <div class="heading"> | | <div class="heading"> |
- | Mathlab and symbiology
| + | Matlab and symbiology |
| </div> | | </div> |
| <br> | | <br> |
| <div class="desc"> | | <div class="desc"> |
| </html> | | </html> |
- | Familiarizing with the mathlab program provided by MathWorks, and its biological tool called Symbiology. | + | Familiarizing with the matlab program provided by MathWorks, and its biological tool called Symbiology. |
| | | |
| No experiments were done on this day. | | No experiments were done on this day. |
Revision as of 19:21, 29 July 2009
University of Calgary
|
CAROL
Modeling Readings Continued
- Continued with reading up on things to characterize for the AI-2 system
- Started familiarization with Single Site-Directed Mutagenesis protocol
- Primers for mutagenesis is ordered. The following are the sequences for the mutagenesis:
LuxCDABE-M-F:CCATTAATGAATTGCCGGATAATCTGGATTTTGAAGGCC
LuxCDABE-M-R:GGCCTTCAAAATCCAGATTATCCGGCAATTCATTAATGG
- Both primers are PAGE purified.
- Received licences for Matlab and Simbiology. Downloaded program and was able to practice through examples found in the Matlab package. Focused on G protein cascase model (example in Matlab) in Yeast and prepared a presentation to show other iGEM members how Simbiology works.
|
|
CHINMOYEE
Descriptive Title of What You're Doing
|
|
EMILY
Sequencing of LuxOD47E in psB1AC3
- Objective: To veriffy the presence of the LuxOD47E gene in the psB1AC3 BBK vector
Size of plasmid Backbone: 3055 bp
Size of the gene of interest: 1362 bp
Total size: 4417 bp
Sequencing needs 100ng of DNA/ 1 kb
4.4kb x 100ng/kb = 440ng
Concentration of C2= 92.9ng/μL
440ng/ 92.9 ng/uL = 4.8 μL DNA
Diluted 4.8 μL DNA (LuxOD47E BBK C2) with 5.2 μL ddH20 and sent down to Univeristy of Calgary Sequencing Labs with VF2 and VF1 primers.
- Results: Sequencing came back and results indicated that the gene if interest, LuxOD47E was not in the psB1AC3 vector. We will have to go back to the gene in the pCR2.1-TOPO vector and try to get it into the psB1AC3 vector.
|
|
FAHD
Descriptive Title of What You're Doing
|
|
IMAN
Descriptive Title of What You're Doing
|
|
JAMIE
Descriptive Title of What You're Doing
|
|
JEREMY
Descriptive Title of What You're Doing
|
|
KATIE
Descriptive Title of What You're Doing
|
|
KEVIN
Matlab and symbiology
Familiarizing with the matlab program provided by MathWorks, and its biological tool called Symbiology.
No experiments were done on this day.
|
|
MANDY
Descriptive Title of What You're Doing
|
|
PATRICK
Descriptive Title of What You're Doing
|
|
PRIMA
Descriptive Title of What You're Doing
|
|
STEFAN
Descriptive Title of What You're Doing
|
|
VICKI
Descriptive Title of What You're Doing
|