Team:Calgary/28 July 2009

From 2009.igem.org

(Difference between revisions)
Line 481: Line 481:
<br>
<br>
<div class="heading">
<div class="heading">
-
Descriptive Title of What You're Doing
+
Marketing Cold calls, Media & wiki acknowledgements
</div>
</div>
<br>
<br>

Revision as of 06:50, 21 August 2009

University of Calgary

UNIVERSITY OF CALGARY



THIS MONTH

July
MTWTFSS
    [http://2009.igem.org/Team:Calgary/1_July_2009 1] [http://2009.igem.org/Team:Calgary/2_July_2009 2] [http://2009.igem.org/Team:Calgary/3_July_2009 3] [http://2009.igem.org/Team:Calgary/4_July_2009 4] [http://2009.igem.org/Team:Calgary/5_July_2009 5]
[http://2009.igem.org/Team:Calgary/6_July_2009 6] [http://2009.igem.org/Team:Calgary/7_July_2009 7] [http://2009.igem.org/Team:Calgary/8_July_2009 8] [http://2009.igem.org/Team:Calgary/9_July_2009 9] [http://2009.igem.org/Team:Calgary/10_July_2009 10] [http://2009.igem.org/Team:Calgary/11_July_2009 11] [http://2009.igem.org/Team:Calgary/12_July_2009 12]
[http://2009.igem.org/Team:Calgary/13_July_2009 13] [http://2009.igem.org/Team:Calgary/14_July_2009 14] [http://2009.igem.org/Team:Calgary/15_July_2009 15] [http://2009.igem.org/Team:Calgary/16_July_2009 16] [http://2009.igem.org/Team:Calgary/17_July_2009 17] [http://2009.igem.org/Team:Calgary/18_July_2009 18] [http://2009.igem.org/Team:Calgary/19_July_2009 19]
[http://2009.igem.org/Team:Calgary/20_July_2009 20] [http://2009.igem.org/Team:Calgary/21_July_2009 21] [http://2009.igem.org/Team:Calgary/22_July_2009 22] [http://2009.igem.org/Team:Calgary/23_July_2009 23] [http://2009.igem.org/Team:Calgary/24_July_2009 24] [http://2009.igem.org/Team:Calgary/25_July_2009 25] [http://2009.igem.org/Team:Calgary/26_July_2009 26]
[http://2009.igem.org/Team:Calgary/27_July_2009 27] [http://2009.igem.org/Team:Calgary/28_July_2009 28] [http://2009.igem.org/Team:Calgary/29_July_2009 29] [http://2009.igem.org/Team:Calgary/30_July_2009 30] [http://2009.igem.org/Team:Calgary/31_July_2009 31]


NOTEBOOK PAGE INDEX



CALENDAR

May
MTWTFSS
        [http://2009.igem.org/Team:Calgary/1_May_2009 1] [http://2009.igem.org/Team:Calgary/2_May_2009 2] [http://2009.igem.org/Team:Calgary/3_May_2009 3]
[http://2009.igem.org/Team:Calgary/4_May_2009 4] [http://2009.igem.org/Team:Calgary/5_May_2009 5] [http://2009.igem.org/Team:Calgary/6_May_2009 6] [http://2009.igem.org/Team:Calgary/7_May_2009 7] [http://2009.igem.org/Team:Calgary/8_May_2009 8] [http://2009.igem.org/Team:Calgary/9_May_2009 9] [http://2009.igem.org/Team:Calgary/10_May_2009 10]
[http://2009.igem.org/Team:Calgary/11_May_2009 11] [http://2009.igem.org/Team:Calgary/12_May_2009 12] [http://2009.igem.org/Team:Calgary/13_May_2009 13] [http://2009.igem.org/Team:Calgary/14_May_2009 14] [http://2009.igem.org/Team:Calgary/15_May_2009 15] [http://2009.igem.org/Team:Calgary/16_May_2009 16] [http://2009.igem.org/Team:Calgary/17_May_2009 17]
[http://2009.igem.org/Team:Calgary/18_May_2009 18] [http://2009.igem.org/Team:Calgary/19_May_2009 19] [http://2009.igem.org/Team:Calgary/20_May_2009 20] [http://2009.igem.org/Team:Calgary/21_May_2009 21] [http://2009.igem.org/Team:Calgary/22_May_2009 22] [http://2009.igem.org/Team:Calgary/23_May_2009 23] [http://2009.igem.org/Team:Calgary/24_May_2009 24]
[http://2009.igem.org/Team:Calgary/25_May_2009 25] [http://2009.igem.org/Team:Calgary/26_May_2009 26] [http://2009.igem.org/Team:Calgary/27_May_2009 27] [http://2009.igem.org/Team:Calgary/28_May_2009 28] [http://2009.igem.org/Team:Calgary/29_May_2009 29] [http://2009.igem.org/Team:Calgary/30_May_2009 30] [http://2009.igem.org/Team:Calgary/31_May_2009 31]


June
MTWTFSS
[http://2009.igem.org/Team:Calgary/1_June_2009 1] [http://2009.igem.org/Team:Calgary/2_June_2009 2] [http://2009.igem.org/Team:Calgary/3_June_2009 3] [http://2009.igem.org/Team:Calgary/4_June_2009 4] [http://2009.igem.org/Team:Calgary/5_June_2009 5] [http://2009.igem.org/Team:Calgary/6_June_2009 6] [http://2009.igem.org/Team:Calgary/7_June_2009 7]
[http://2009.igem.org/Team:Calgary/8_June_2009 8] [http://2009.igem.org/Team:Calgary/9_June_2009 9] [http://2009.igem.org/Team:Calgary/10_June_2009 10] [http://2009.igem.org/Team:Calgary/11_June_2009 11] [http://2009.igem.org/Team:Calgary/12_June_2009 12] [http://2009.igem.org/Team:Calgary/13_June_2009 13] [http://2009.igem.org/Team:Calgary/14_June_2009 14]
[http://2009.igem.org/Team:Calgary/15_June_2009 15] [http://2009.igem.org/Team:Calgary/16_June_2009 16] [http://2009.igem.org/Team:Calgary/17_June_2009 17] [http://2009.igem.org/Team:Calgary/18_June_2009 18] [http://2009.igem.org/Team:Calgary/19_June_2009 19] [http://2009.igem.org/Team:Calgary/20_June_2009 20] [http://2009.igem.org/Team:Calgary/21_June_2009 21]
[http://2009.igem.org/Team:Calgary/22_June_2009 22] [http://2009.igem.org/Team:Calgary/23_June_2009 23] [http://2009.igem.org/Team:Calgary/24_June_2009 24] [http://2009.igem.org/Team:Calgary/25_June_2009 25] [http://2009.igem.org/Team:Calgary/26_June_2009 26] [http://2009.igem.org/Team:Calgary/27_June_2009 27] [http://2009.igem.org/Team:Calgary/28_June_2009 28]
[http://2009.igem.org/Team:Calgary/29_June_2009 29] [http://2009.igem.org/Team:Calgary/30_June_2009 30]


July
MTWTFSS
    [http://2009.igem.org/Team:Calgary/1_July_2009 1] [http://2009.igem.org/Team:Calgary/2_July_2009 2] [http://2009.igem.org/Team:Calgary/3_July_2009 3] [http://2009.igem.org/Team:Calgary/4_July_2009 4] [http://2009.igem.org/Team:Calgary/5_July_2009 5]
[http://2009.igem.org/Team:Calgary/6_July_2009 6] [http://2009.igem.org/Team:Calgary/7_July_2009 7] [http://2009.igem.org/Team:Calgary/8_July_2009 8] [http://2009.igem.org/Team:Calgary/9_July_2009 9] [http://2009.igem.org/Team:Calgary/10_July_2009 10] [http://2009.igem.org/Team:Calgary/11_July_2009 11] [http://2009.igem.org/Team:Calgary/12_July_2009 12]
[http://2009.igem.org/Team:Calgary/13_July_2009 13] [http://2009.igem.org/Team:Calgary/14_July_2009 14] [http://2009.igem.org/Team:Calgary/15_July_2009 15] [http://2009.igem.org/Team:Calgary/16_July_2009 16] [http://2009.igem.org/Team:Calgary/17_July_2009 17] [http://2009.igem.org/Team:Calgary/18_July_2009 18] [http://2009.igem.org/Team:Calgary/19_July_2009 19]
[http://2009.igem.org/Team:Calgary/20_July_2009 20] [http://2009.igem.org/Team:Calgary/21_July_2009 21] [http://2009.igem.org/Team:Calgary/22_July_2009 22] [http://2009.igem.org/Team:Calgary/23_July_2009 23] [http://2009.igem.org/Team:Calgary/24_July_2009 24] [http://2009.igem.org/Team:Calgary/25_July_2009 25] [http://2009.igem.org/Team:Calgary/26_July_2009 26]
[http://2009.igem.org/Team:Calgary/27_July_2009 27] [http://2009.igem.org/Team:Calgary/28_July_2009 28] [http://2009.igem.org/Team:Calgary/29_July_2009 29] [http://2009.igem.org/Team:Calgary/30_July_2009 30] [http://2009.igem.org/Team:Calgary/31_July_2009 31]


August
MTWTFSS
          [http://2009.igem.org/Team:Calgary/1_August_2009 1] [http://2009.igem.org/Team:Calgary/2_August_2009 2]
[http://2009.igem.org/Team:Calgary/3_August_2009 3] [http://2009.igem.org/Team:Calgary/4_August_2009 4] [http://2009.igem.org/Team:Calgary/5_August_2009 5] [http://2009.igem.org/Team:Calgary/6_August_2009 6] [http://2009.igem.org/Team:Calgary/7_August_2009 7] [http://2009.igem.org/Team:Calgary/8_August_2009 8] [http://2009.igem.org/Team:Calgary/9_August_2009 9]
[http://2009.igem.org/Team:Calgary/10_August_2009 10] [http://2009.igem.org/Team:Calgary/11_August_2009 11] [http://2009.igem.org/Team:Calgary/12_August_2009 12] [http://2009.igem.org/Team:Calgary/13_August_2009 13] [http://2009.igem.org/Team:Calgary/14_August_2009 14] [http://2009.igem.org/Team:Calgary/15_August_2009 15] [http://2009.igem.org/Team:Calgary/16_August_2009 16]
[http://2009.igem.org/Team:Calgary/17_August_2009 17] [http://2009.igem.org/Team:Calgary/18_August_2009 18] [http://2009.igem.org/Team:Calgary/19_August_2009 19] [http://2009.igem.org/Team:Calgary/20_August_2009 20] [http://2009.igem.org/Team:Calgary/21_August_2009 21] [http://2009.igem.org/Team:Calgary/22_August_2009 22] [http://2009.igem.org/Team:Calgary/23_August_2009 23]
[http://2009.igem.org/Team:Calgary/24_August_2009 24] [http://2009.igem.org/Team:Calgary/25_August_2009 25] [http://2009.igem.org/Team:Calgary/26_August_2009 26] [http://2009.igem.org/Team:Calgary/27_August_2009 27] [http://2009.igem.org/Team:Calgary/28_August_2009 28] [http://2009.igem.org/Team:Calgary/29_August_2009 29] [http://2009.igem.org/Team:Calgary/30_August_2009 30]
[http://2009.igem.org/Team:Calgary/31_August_2009 31]


September
MTWTFSS
  [http://2009.igem.org/Team:Calgary/1_September_2009 1] [http://2009.igem.org/Team:Calgary/2_September_2009 2] [http://2009.igem.org/Team:Calgary/3_September_2009 3] [http://2009.igem.org/Team:Calgary/4_September_2009 4] [http://2009.igem.org/Team:Calgary/5_September_2009 5] [http://2009.igem.org/Team:Calgary/6_September_2009 6]
[http://2009.igem.org/Team:Calgary/7_September_2009 7] [http://2009.igem.org/Team:Calgary/8_September_2009 8] [http://2009.igem.org/Team:Calgary/9_September_2009 9] [http://2009.igem.org/Team:Calgary/10_September_2009 10] [http://2009.igem.org/Team:Calgary/11_September_2009 11] [http://2009.igem.org/Team:Calgary/12_September_2009 12] [http://2009.igem.org/Team:Calgary/13_September_2009 13]
[http://2009.igem.org/Team:Calgary/14_September_2009 14] [http://2009.igem.org/Team:Calgary/15_September_2009 15] [http://2009.igem.org/Team:Calgary/16_September_2009 16] [http://2009.igem.org/Team:Calgary/17_September_2009 17] [http://2009.igem.org/Team:Calgary/18_September_2009 18] [http://2009.igem.org/Team:Calgary/19_September_2009 19] [http://2009.igem.org/Team:Calgary/20_September_2009 20]
[http://2009.igem.org/Team:Calgary/21_September_2009 21] [http://2009.igem.org/Team:Calgary/22_September_2009 22] [http://2009.igem.org/Team:Calgary/23_September_2009 23] [http://2009.igem.org/Team:Calgary/24_September_2009 24] [http://2009.igem.org/Team:Calgary/25_September_2009 25] [http://2009.igem.org/Team:Calgary/26_September_2009 26] [http://2009.igem.org/Team:Calgary/27_September_2009 27]
[http://2009.igem.org/Team:Calgary/28_September_2009 28] [http://2009.igem.org/Team:Calgary/29_September_2009 29] [http://2009.igem.org/Team:Calgary/30_September_2009 30]


October
MTWTFSS
      [http://2009.igem.org/Team:Calgary/1_October_2009 1] [http://2009.igem.org/Team:Calgary/2_October_2009 2] [http://2009.igem.org/Team:Calgary/3_October_2009 3] [http://2009.igem.org/Team:Calgary/4_October_2009 4]
[http://2009.igem.org/Team:Calgary/5_October_2009 5] [http://2009.igem.org/Team:Calgary/6_October_2009 6] [http://2009.igem.org/Team:Calgary/7_October_2009 7] [http://2009.igem.org/Team:Calgary/8_October_2009 8] [http://2009.igem.org/Team:Calgary/9_October_2009 9] [http://2009.igem.org/Team:Calgary/10_October_2009 10] [http://2009.igem.org/Team:Calgary/11_October_2009 11]
[http://2009.igem.org/Team:Calgary/12_October_2009 12] [http://2009.igem.org/Team:Calgary/13_October_2009 13] [http://2009.igem.org/Team:Calgary/14_October_2009 14] [http://2009.igem.org/Team:Calgary/15_October_2009 15] [http://2009.igem.org/Team:Calgary/16_October_2009 16] [http://2009.igem.org/Team:Calgary/17_October_2009 17] [http://2009.igem.org/Team:Calgary/18_October_2009 18]
[http://2009.igem.org/wiki/index.php?title=Team:Calgary/19_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 19] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/20_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 20] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/21_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 21] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/22_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 22] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/23_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 23] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/24_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 24] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/25_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 25]
[http://2009.igem.org/wiki/index.php?title=Team:Calgary/26_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 26] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/27_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 27] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/28_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 28] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/29_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 29] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/30_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 30] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/31_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 31]



JULY 28, 2009


CAROL
Analyzing ''E.coli'' Colonies

  • Minimal growth of E.Coli on LB plates with Kan resistance. There were only 5 colonies found. None of the colonies were glowing. We are not sure what 'glowing' would look like.
  • Ordered primers that would allow us to clone part BBa_B0040 in front of the luciferase operon. The following is the primers that were ordered.

XhoI-R40-F: GCGCTCGAGTCCCTATCAGTGATAGAG BamHI-R40-R: GCGGGATCCGTGCTCAGTATCTCTATC

  • These primers would allow us to attach XhoI and BamHI sites onto part BBa_B0040 by PCR and then we are able to clone this part into pCS26 vector with luciferase as the reporter. This should allow us to see the glowing from the luciferase operon in the plasmid.


CHINMOYEE

Descriptive Title of What You're Doing

WIKI CODING HERE


EMILY

Descriptive Title of What You're Doing

WIKI CODING HERE


FAHD

Calling Oil & Gas and Research & Development Pharmaceutical Companies

Following is a list of Research & Development Pharmaceutical Companies I contacted and researched on today:
1) Life Technologies Inc.
2) Charles River Labs
3) Boheringer Ingelheim Canada Ltd.
4) EMD Chemicals
5) Paladin Labs
6) VWR Canada

Following is a list of Oil & Gas Companies I contacted and researched on today:
1) Teck Coal Ltd.
2) Focus Corporation
3) Imperial oil resources
4) Enbridge Pipelines
5) Bietz Resources
6) Bow Valley Energy Ltd.
7) Ithaca Energy Inc.

For today, Boheringer Ingelhiem Canada was the only Research & Development Pharmaceutical Company that said that it might be able to help us. I will do a follow-up on our 2009 iGEM sponsorship proposal next week.

IMAN

Descriptive Title of What You're Doing

WIKI CODING HERE


JAMIE

Descriptive Title of What You're Doing

WIKI CODING HERE


JEREMY

Descriptive Title of What You're Doing

WIKI CODING HERE


KATIE

Script Revision

The PCR machine modification took a lot longer than initially anticipated since the machine was having difficulties successfully locating all the materials it required. To fix this, I rewrote the script using a different method to check for inventory inside the object and I now check for the existence of the items that are needed within individual lists at three points rather that two to prevent any mistakes that were being made previously. One positive outcome of taking the time to make these changes is that now a list may contain things that it does not necessarily require to complete the activity meaning more options may be added when they are required. It also makes the script less bulky so I believe that when I have the time I will change the whole script to run just like the PCR activity with a general DNA template.

I am now tempted to go back to restriction digest and change the script, since my initial method appears to only work well within a less complicated script, so I believe I will return to that at a later date as well. I am selecting the substrings I will need from a single note card for comparing the parts that are going to be ligated together. So far I have determined the substrings of sequences for all promoters, rbs and terminators cut to be inserted behind or in front of another part and now have moved on to the gene that will be used for the lab missions.

I was able to get my DNA polymerase to successfully detect an RNA primer and rez nucleotides after the collision for a little while. I have now made a primase to rez the RNA primers and now I have to determine where on the strand they should be rezzed along the lagging strand. I am also considering animating the open strands of DNA so that initially, the single strands are together and then come apart, which will send a message to gyrase and helicase to initiate their own activities, which I believe will just involve them moving to their respective places as their individual functions are explained.

Tomorrow I plan to continue with the replication animation as well as the entire molecular cloning mission. I believe I will try to get the timing organized for the different parts of the replication display so that everything will happen in the correct order and I will finish of obtaining the substrings I need from note cards for construction.


KEVIN

1. Overnight cultures

Purpose: To do a miniprep on cells containing these plasmids, we have to grow an o/n culture. K082003 is being isolated to complete the reporter circuit of Pqrr4+RBS+GFP+LVA. So far, Pqrr4 + RBS have been constructed, and now I have to miniprep GFP+LVA, and construct the final reporter circuit. Q04510 is being isolated so that Jeremy and Jamie can construct our final response circuit.

2. Restreak of K082003 (GFP + LVA tag) and Q04510 (Inverter)

Purpose: Because some of yesterday’s restreaks did not contain single colonies, I restreaked them again so that I can get single colonies to work with if the single colonies in 1 do not contain the plasmid of interest.

MANDY

Descriptive Title of What You're Doing

WIKI CODING HERE


PATRICK

Descriptive Title of What You're Doing

WIKI CODING HERE


PRIMA

Marketing Cold calls, Media & wiki acknowledgements

I updated the gmail contact list. Sent a Thank you letter to Corning Life Sciences.

Called Worley Parsons – the contact they gave me was apparently the wrong person. It was the HR person and she said she’ll find out who deals with sponsorship and get back to me. But I might just inquire and find out myself just in. Company 2 (Jennifer Alexander)- called today but couldn’t get a hold of her so I left a msg  follow up tomorrow

Cayman Chemicals ..called…needs a final confirmation from their President follow up July 31

Sigma Aldrich I sent her and email and left her a voicemail  follow up tomorrow or day after

COLT Engineering – sent sponsorship pkg and I’ll call them on Thursday

Origene – I called today but they can’t sponsor any projects this year due to economic downfall

Finally sent Ms. Moser an email and the letter to be forwarded to Mr Jay Ingram.

I also wrote up the acknowledgement section of the wiki and sent it to Mandy. Tomorrow I’ll acknowledge each individual mentor/donator person.

I also called Wordans T-shirt company and told them about our project and what we want and asked for quotes and discounts. I got the email address of the manager and sent him and email about what we want on the shirt and if we ordered 30-40 shirts, how much would each cost?? He’ll get back to me soon and I can let you guys know. I research some companies that I’ll be contacting within a few days and personalized the email to emphasize how iGEM's goal concides with the company's goal/project. Tomorrow I’ll update my notebook on the wiki.



STEFAN

Building Engineered Cells in the Synthetic Kingdom

Construction of a GFP activity has been completed in Second Life. Clicking a jellyfish will dispense GFP, which the person can then put in their inventory. Then they can open the inventory of a bacteria in the area and place the GFP inside. As a result, the bacteria will glow green for a period of time after which the script will reset until the next person places the protein inside. This activity will also serve as a tutorial for inventory management for people new to Second Life. A note card will be added later on explaining the protein so others will understand how it can be expressed in the bacteria even though it has been extracted from a jellyfish.


VICKI

Descriptive Title of What You're Doing

WIKI CODING HERE