Team:Calgary/23 July 2009

July M T W T F S S     [http://2009.igem.org/Team:Calgary/1_July_2009 1] [http://2009.igem.org/Team:Calgary/2_July_2009 2] [http://2009.igem.org/Team:Calgary/3_July_2009 3] [http://2009.igem.org/Team:Calgary/4_July_2009 4] [http://2009.igem.org/Team:Calgary/5_July_2009 5] [http://2009.igem.org/Team:Calgary/6_July_2009 6] [http://2009.igem.org/Team:Calgary/7_July_2009 7] [http://2009.igem.org/Team:Calgary/8_July_2009 8] [http://2009.igem.org/Team:Calgary/9_July_2009 9] [http://2009.igem.org/Team:Calgary/10_July_2009 10] [http://2009.igem.org/Team:Calgary/11_July_2009 11] [http://2009.igem.org/Team:Calgary/12_July_2009 12] [http://2009.igem.org/Team:Calgary/13_July_2009 13] [http://2009.igem.org/Team:Calgary/14_July_2009 14] [http://2009.igem.org/Team:Calgary/15_July_2009 15] [http://2009.igem.org/Team:Calgary/16_July_2009 16] [http://2009.igem.org/Team:Calgary/17_July_2009 17] [http://2009.igem.org/Team:Calgary/18_July_2009 18] [http://2009.igem.org/Team:Calgary/19_July_2009 19] [http://2009.igem.org/Team:Calgary/20_July_2009 20] [http://2009.igem.org/Team:Calgary/21_July_2009 21] [http://2009.igem.org/Team:Calgary/22_July_2009 22] [http://2009.igem.org/Team:Calgary/23_July_2009 23] [http://2009.igem.org/Team:Calgary/24_July_2009 24] [http://2009.igem.org/Team:Calgary/25_July_2009 25] [http://2009.igem.org/Team:Calgary/26_July_2009 26] [http://2009.igem.org/Team:Calgary/27_July_2009 27] [http://2009.igem.org/Team:Calgary/28_July_2009 28] [http://2009.igem.org/Team:Calgary/29_July_2009 29] [http://2009.igem.org/Team:Calgary/30_July_2009 30] [http://2009.igem.org/Team:Calgary/31_July_2009 31]

Carol
Chinmoyee
Emily
Fahd
Iman
Jamie
Jeremy
Katie
Kevin
Mandy
Patrick
Prima
Stefan
Vicki

May M T W T F S S         [http://2009.igem.org/Team:Calgary/1_May_2009 1] [http://2009.igem.org/Team:Calgary/2_May_2009 2] [http://2009.igem.org/Team:Calgary/3_May_2009 3] [http://2009.igem.org/Team:Calgary/4_May_2009 4] [http://2009.igem.org/Team:Calgary/5_May_2009 5] [http://2009.igem.org/Team:Calgary/6_May_2009 6] [http://2009.igem.org/Team:Calgary/7_May_2009 7] [http://2009.igem.org/Team:Calgary/8_May_2009 8] [http://2009.igem.org/Team:Calgary/9_May_2009 9] [http://2009.igem.org/Team:Calgary/10_May_2009 10] [http://2009.igem.org/Team:Calgary/11_May_2009 11] [http://2009.igem.org/Team:Calgary/12_May_2009 12] [http://2009.igem.org/Team:Calgary/13_May_2009 13] [http://2009.igem.org/Team:Calgary/14_May_2009 14] [http://2009.igem.org/Team:Calgary/15_May_2009 15] [http://2009.igem.org/Team:Calgary/16_May_2009 16] [http://2009.igem.org/Team:Calgary/17_May_2009 17] [http://2009.igem.org/Team:Calgary/18_May_2009 18] [http://2009.igem.org/Team:Calgary/19_May_2009 19] [http://2009.igem.org/Team:Calgary/20_May_2009 20] [http://2009.igem.org/Team:Calgary/21_May_2009 21] [http://2009.igem.org/Team:Calgary/22_May_2009 22] [http://2009.igem.org/Team:Calgary/23_May_2009 23] [http://2009.igem.org/Team:Calgary/24_May_2009 24] [http://2009.igem.org/Team:Calgary/25_May_2009 25] [http://2009.igem.org/Team:Calgary/26_May_2009 26] [http://2009.igem.org/Team:Calgary/27_May_2009 27] [http://2009.igem.org/Team:Calgary/28_May_2009 28] [http://2009.igem.org/Team:Calgary/29_May_2009 29] [http://2009.igem.org/Team:Calgary/30_May_2009 30] [http://2009.igem.org/Team:Calgary/31_May_2009 31]

June M T W T F S S [http://2009.igem.org/Team:Calgary/1_June_2009 1] [http://2009.igem.org/Team:Calgary/2_June_2009 2] [http://2009.igem.org/Team:Calgary/3_June_2009 3] [http://2009.igem.org/Team:Calgary/4_June_2009 4] [http://2009.igem.org/Team:Calgary/5_June_2009 5] [http://2009.igem.org/Team:Calgary/6_June_2009 6] [http://2009.igem.org/Team:Calgary/7_June_2009 7] [http://2009.igem.org/Team:Calgary/8_June_2009 8] [http://2009.igem.org/Team:Calgary/9_June_2009 9] [http://2009.igem.org/Team:Calgary/10_June_2009 10] [http://2009.igem.org/Team:Calgary/11_June_2009 11] [http://2009.igem.org/Team:Calgary/12_June_2009 12] [http://2009.igem.org/Team:Calgary/13_June_2009 13] [http://2009.igem.org/Team:Calgary/14_June_2009 14] [http://2009.igem.org/Team:Calgary/15_June_2009 15] [http://2009.igem.org/Team:Calgary/16_June_2009 16] [http://2009.igem.org/Team:Calgary/17_June_2009 17] [http://2009.igem.org/Team:Calgary/18_June_2009 18] [http://2009.igem.org/Team:Calgary/19_June_2009 19] [http://2009.igem.org/Team:Calgary/20_June_2009 20] [http://2009.igem.org/Team:Calgary/21_June_2009 21] [http://2009.igem.org/Team:Calgary/22_June_2009 22] [http://2009.igem.org/Team:Calgary/23_June_2009 23] [http://2009.igem.org/Team:Calgary/24_June_2009 24] [http://2009.igem.org/Team:Calgary/25_June_2009 25] [http://2009.igem.org/Team:Calgary/26_June_2009 26] [http://2009.igem.org/Team:Calgary/27_June_2009 27] [http://2009.igem.org/Team:Calgary/28_June_2009 28] [http://2009.igem.org/Team:Calgary/29_June_2009 29] [http://2009.igem.org/Team:Calgary/30_June_2009 30]

July M T W T F S S     [http://2009.igem.org/Team:Calgary/1_July_2009 1] [http://2009.igem.org/Team:Calgary/2_July_2009 2] [http://2009.igem.org/Team:Calgary/3_July_2009 3] [http://2009.igem.org/Team:Calgary/4_July_2009 4] [http://2009.igem.org/Team:Calgary/5_July_2009 5] [http://2009.igem.org/Team:Calgary/6_July_2009 6] [http://2009.igem.org/Team:Calgary/7_July_2009 7] [http://2009.igem.org/Team:Calgary/8_July_2009 8] [http://2009.igem.org/Team:Calgary/9_July_2009 9] [http://2009.igem.org/Team:Calgary/10_July_2009 10] [http://2009.igem.org/Team:Calgary/11_July_2009 11] [http://2009.igem.org/Team:Calgary/12_July_2009 12] [http://2009.igem.org/Team:Calgary/13_July_2009 13] [http://2009.igem.org/Team:Calgary/14_July_2009 14] [http://2009.igem.org/Team:Calgary/15_July_2009 15] [http://2009.igem.org/Team:Calgary/16_July_2009 16] [http://2009.igem.org/Team:Calgary/17_July_2009 17] [http://2009.igem.org/Team:Calgary/18_July_2009 18] [http://2009.igem.org/Team:Calgary/19_July_2009 19] [http://2009.igem.org/Team:Calgary/20_July_2009 20] [http://2009.igem.org/Team:Calgary/21_July_2009 21] [http://2009.igem.org/Team:Calgary/22_July_2009 22] [http://2009.igem.org/Team:Calgary/23_July_2009 23] [http://2009.igem.org/Team:Calgary/24_July_2009 24] [http://2009.igem.org/Team:Calgary/25_July_2009 25] [http://2009.igem.org/Team:Calgary/26_July_2009 26] [http://2009.igem.org/Team:Calgary/27_July_2009 27] [http://2009.igem.org/Team:Calgary/28_July_2009 28] [http://2009.igem.org/Team:Calgary/29_July_2009 29] [http://2009.igem.org/Team:Calgary/30_July_2009 30] [http://2009.igem.org/Team:Calgary/31_July_2009 31]

August M T W T F S S           [http://2009.igem.org/Team:Calgary/1_August_2009 1] [http://2009.igem.org/Team:Calgary/2_August_2009 2] [http://2009.igem.org/Team:Calgary/3_August_2009 3] [http://2009.igem.org/Team:Calgary/4_August_2009 4] [http://2009.igem.org/Team:Calgary/5_August_2009 5] [http://2009.igem.org/Team:Calgary/6_August_2009 6] [http://2009.igem.org/Team:Calgary/7_August_2009 7] [http://2009.igem.org/Team:Calgary/8_August_2009 8] [http://2009.igem.org/Team:Calgary/9_August_2009 9] [http://2009.igem.org/Team:Calgary/10_August_2009 10] [http://2009.igem.org/Team:Calgary/11_August_2009 11] [http://2009.igem.org/Team:Calgary/12_August_2009 12] [http://2009.igem.org/Team:Calgary/13_August_2009 13] [http://2009.igem.org/Team:Calgary/14_August_2009 14] [http://2009.igem.org/Team:Calgary/15_August_2009 15] [http://2009.igem.org/Team:Calgary/16_August_2009 16] [http://2009.igem.org/Team:Calgary/17_August_2009 17] [http://2009.igem.org/Team:Calgary/18_August_2009 18] [http://2009.igem.org/Team:Calgary/19_August_2009 19] [http://2009.igem.org/Team:Calgary/20_August_2009 20] [http://2009.igem.org/Team:Calgary/21_August_2009 21] [http://2009.igem.org/Team:Calgary/22_August_2009 22] [http://2009.igem.org/Team:Calgary/23_August_2009 23] [http://2009.igem.org/Team:Calgary/24_August_2009 24] [http://2009.igem.org/Team:Calgary/25_August_2009 25] [http://2009.igem.org/Team:Calgary/26_August_2009 26] [http://2009.igem.org/Team:Calgary/27_August_2009 27] [http://2009.igem.org/Team:Calgary/28_August_2009 28] [http://2009.igem.org/Team:Calgary/29_August_2009 29] [http://2009.igem.org/Team:Calgary/30_August_2009 30] [http://2009.igem.org/Team:Calgary/31_August_2009 31]

September M T W T F S S   [http://2009.igem.org/Team:Calgary/1_September_2009 1] [http://2009.igem.org/Team:Calgary/2_September_2009 2] [http://2009.igem.org/Team:Calgary/3_September_2009 3] [http://2009.igem.org/Team:Calgary/4_September_2009 4] [http://2009.igem.org/Team:Calgary/5_September_2009 5] [http://2009.igem.org/Team:Calgary/6_September_2009 6] [http://2009.igem.org/Team:Calgary/7_September_2009 7] [http://2009.igem.org/Team:Calgary/8_September_2009 8] [http://2009.igem.org/Team:Calgary/9_September_2009 9] [http://2009.igem.org/Team:Calgary/10_September_2009 10] [http://2009.igem.org/Team:Calgary/11_September_2009 11] [http://2009.igem.org/Team:Calgary/12_September_2009 12] [http://2009.igem.org/Team:Calgary/13_September_2009 13] [http://2009.igem.org/Team:Calgary/14_September_2009 14] [http://2009.igem.org/Team:Calgary/15_September_2009 15] [http://2009.igem.org/Team:Calgary/16_September_2009 16] [http://2009.igem.org/Team:Calgary/17_September_2009 17] [http://2009.igem.org/Team:Calgary/18_September_2009 18] [http://2009.igem.org/Team:Calgary/19_September_2009 19] [http://2009.igem.org/Team:Calgary/20_September_2009 20] [http://2009.igem.org/Team:Calgary/21_September_2009 21] [http://2009.igem.org/Team:Calgary/22_September_2009 22] [http://2009.igem.org/Team:Calgary/23_September_2009 23] [http://2009.igem.org/Team:Calgary/24_September_2009 24] [http://2009.igem.org/Team:Calgary/25_September_2009 25] [http://2009.igem.org/Team:Calgary/26_September_2009 26] [http://2009.igem.org/Team:Calgary/27_September_2009 27] [http://2009.igem.org/Team:Calgary/28_September_2009 28] [http://2009.igem.org/Team:Calgary/29_September_2009 29] [http://2009.igem.org/Team:Calgary/30_September_2009 30]

October M T W T F S S       [http://2009.igem.org/Team:Calgary/1_October_2009 1] [http://2009.igem.org/Team:Calgary/2_October_2009 2] [http://2009.igem.org/Team:Calgary/3_October_2009 3] [http://2009.igem.org/Team:Calgary/4_October_2009 4] [http://2009.igem.org/Team:Calgary/5_October_2009 5] [http://2009.igem.org/Team:Calgary/6_October_2009 6] [http://2009.igem.org/Team:Calgary/7_October_2009 7] [http://2009.igem.org/Team:Calgary/8_October_2009 8] [http://2009.igem.org/Team:Calgary/9_October_2009 9] [http://2009.igem.org/Team:Calgary/10_October_2009 10] [http://2009.igem.org/Team:Calgary/11_October_2009 11] [http://2009.igem.org/Team:Calgary/12_October_2009 12] [http://2009.igem.org/Team:Calgary/13_October_2009 13] [http://2009.igem.org/Team:Calgary/14_October_2009 14] [http://2009.igem.org/Team:Calgary/15_October_2009 15] [http://2009.igem.org/Team:Calgary/16_October_2009 16] [http://2009.igem.org/Team:Calgary/17_October_2009 17] [http://2009.igem.org/Team:Calgary/18_October_2009 18] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/19_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 19] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/20_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 20] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/21_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 21] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/22_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 22] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/23_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 23] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/24_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 24] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/25_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 25] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/26_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 26] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/27_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 27] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/28_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 28] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/29_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 29] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/30_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 30] [http://2009.igem.org/wiki/index.php?title=Team:Calgary/31_October_2009&preload=Team:Calgary/NotebookPreload&action=edit 31]

• No single colonies were found on LB+Kan plates. The transformation was done by using XL Gold Ultracompetent cells and plasmid, pCS26+promoters (NEB Quick Ligase).
• Transformation of pBluescript into both XL Gold and Top 10 cells were successful. Cells grew on LB plates.

WIKI CODING HERE

• Read two papers on Ethics: First a review paper by Keasling called Synthetic Biology for Synthetic Chemistry, which I didn't find super useful as it mostly just focused on defining Synthetic Biology and metabolic engineering. I also started to read Scenarios for the Future of Snthetic Biology by Stephen Aldrich, James Newcomb, and Robert Carlson. I didn't get too far in this, but it seemed slighly more useful, discussing who will play a role in shaping the field of Sythetic Biology.

• At 10:00 a.m. Mandy, Fahd, Stefan and I met with Dr. Wolbring to discuss ethics. It was an interesting meeting and he has given us a better idea of where to go from here. We discussed the write-up that we did for AIF and he agreed to send us a copy of it with his comments sometime today. He also showed us some interesting tools olnline that might help us. One of these was a program called uStream where you can record and broadcast videos and invite people to watch and comment. He suggested that this could be a powerful tool to discuss ethics with other teams and guest speakers. We really liked this idea as an alternative to our conference idea.

• Today I sent one of my colonies down for sequencing. I sent down J13002-LuxOD47E-B0015 colony 6 with the BBK Reverse Sequencing primer. I'm hoping that this result will come back tomorrow and the presence of the B0015 terminator will be verified in my contruct. If this is the case, then my circuit will be complete!

Today, I concentrated my energies at marketing our iGEM project and looking at the ethical aspect of our project. Here is what I did today:

1) I talked to ALPAC. I got her excited about our project this year and to ld her abt that we are developing virtual educational tools. She asked for our sponsorship package so i e-mailed her one. I will call her after August 3rd(ON HOLIDAYS).

2) I had a meeting with Dr. Wolbring till 12.00 pm. I will tell in detail tomorrow what we had discussed in that meeting but here a couple of brief pointers:

>Considering the Economics of Our Project

>Synthetic Biology VS End Product VS iGEM Competition

>Feasibillty of our project

>Degradation of Bio-films VS Degradation of Nano-silver

>Log-term future of energy industry, biofuels

>Patenting: Open Source VS Closed Source

>Ethcis before Benchwork?

>15 Global Challenges that the world faces.

3) I e-mailed Teck Coal Ltd (VP of Engineering and Development). I also did research on the company so I could make specific connections with our project and their organization. I will call heim next week.

4) I found a couple of contacts at Teck Coal Ltd. These include their communty relations officer and the Coporate Governence Officer. I will call them on monday if we our meting ends after 12.00pm

5) I did research on Enbridge Pipelines Inc. I e-mailed a sponsorship proposal to at Enbridge Pipelines Inc. I will get back to him next week

6) I did research on Finning Canada. I e-mailed them a sponsorship proposal at finning Canada. I will get back to him next week.

7) I did research on Focus Corporation. I e-mailed a sponsorship proposal to Focus Corporation and I will get back to them next week.

8) Attended Thane's group meeting.

9) I did research on how to make our ethics online show on ustream TV. I also made an account on ustream TV. I will discuss about the details of this show tomorrow in class.

10) I called VWR if he had recieved my list of required(Donation) lab reagents and chemicals. He will be out of office till 24th so i will call him next week.

WIKI CODING HERE

WIKI CODING HERE

WIKI CODING HERE

A variable has been added to bacterial transformation so that once the quiz is complete, the object is aware of what DNA was taken up by the competent cells and it opens up the possibilities of using other types of DNA for the activity very easily.

I traced through the entire notecard reader script and I now believe I have a firm grasp about what is happening as the program runs. The dataserver event basically is triggered when there is data being handled at different times, so it will check that the data being handled is a line of the notecard and if it is it will add the string of data to a temporary variable. Then it keeps track of the number of lines read in order to request the next line of the notecard, which requires the number. So now I am confident with the use of this script, which lessens my guilt for implementing it.

I was able to edit and add to notecards that Mandy will read when she has time, which include:

• What is DNA?
• What is RNA?
• Translation
• Restriction Digest
• Ligation

I have also started a display for DNA replication for the base of the spiral when I take some time away from working on the virtual lab, which involves animating a lot of objects to represent the enzymes involved as well as all the pieces that will have to be rezzed to make a complementary strand of DNA. The difficulties I will encounter will probably be with having all objects moving at the right times and where they will have to travel.

I have discovered that my restriction digest activity does more that it has to, which is not a bad thing. So people can just play around if they want to ligate promoter and rbs together for practice or it could be walked through in the instructions. The notecard reader has been implemented in the third and final construction site and tomorrow after group meeting I would like to obtain the names of all the materials required so I can finish renaming the general materials for the activity.

Have reviewed all the characteristics that were discussed last time and today wrote a detailed overview of why/how we would implement it, with the rest of the modeling team.

Yesterday, I have sent Pqrr4+B0034 (RBS) for sequencing with BBK CP F primers in order to verify the presence of Pqrr4+B0034. This construct will be used to construct our reporter circuit when the part with GFP+LVA tag arrives.

Legend
Vector contamination
BBK Restriction sites
Sequence of interest
Scar

Sequence of Pqrr4+B0034 (RBS) C1

GGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTG

GAATTCGCGGCCGCTTCTAGAGTATCAGCAAAAACACTACGGTGGATAATCAGTAAAACCATGAAACTAGAGCCCCGCACACTTGC GGGGCTTTTTAATTTTGAATTTCTTTCTTATTAAAACGCCATTTTTCTGATAAATGTATTAGTAGCAATGCGCATGGTGGCATATT TGCATCATTTTGCATTTTGCAAATGCGATTTGCAAAATGCGTGCTCAATAAAGCACCAATATGCATCAGGATCGAAGAAAAAAGGC GTTTTTAAAAGTTGGCACGCATCGTGCTTTATACAGATACTAGAGAAAGAGGAGAAATACTAGTAGCGGCCGCTGCAG

TCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGC TCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCA GGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCA CAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGG CGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGA AGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACC CCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAGACACGACTTATCGCCACTG

Sequence of Pqrr4+B0034 (RBS) C9

GGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTG

GAATTCGCGGCCGCTTCTAGAGTATCAGCAAAAACACTACGGTGGATAATCAGTAAAACCATGAAACTAGAGCCCCGCACACTTGC GGGGCTTTTTAATTTTGAATTTCTTTCTTATTAAAACGCCATTTTTCTGATAAATGTATTAGTAGCAATGCGCATGGTGGCATATT TGCATCATTTTGCATTTTGCAAATGCGATTTGCAAAATGCGTGCTCAATAAAGCACCAATATGCATCAGGATCGAAGAAAAAAGGC GTTTTTAAAAGTTGGCACGCATCGTGCTTTATACAGATACTAGAGAAAGAGGAGAAATACTAGTAGCGGCCGCTGCAG

TCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGC TCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCA GGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCA CAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGG CGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGA AGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACC CCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAGAC

For both Colony 1 and 9 Pqrr4+B0034 coding sequences, I have verified that Pqrr4 match 100% with the sequence provided by Thane (given when I sequenced last time), and that B0034 also match with the sequence given by the partsregistry.org. We can clearly see that scar has been successfully formed between Pqrr4 and B0034. I now have to wait for the part with GFP+LVA tag to arrive to finish constructing our reporter circuit.

Now that I have verified the presence of Pqrr4, I can now sequence Pqrr4+I13500 (RBS+GFP) in order verify and make those cells competent again so that we can test Emily and Vicky’s mutants.

WIKI CODING HERE

Retrospective Notebook: This entry was not written on this day, but derived later from working notes I made that day.

I filed a support request with Linden Labs (the company behind Second Life), but with some sixty thousand users online every day I didn't imagine that the TetR object that got lost yesterday would be a high priority. This was a decently large setback.

Not wanting to wait around for my work to rematerialize, I wound up rewriting the changes I had made since the last time I had saved. I also got to work on a new version of the stayput script... with a new provision to stop objects from floating away more than a short distance! Lesson learned.

Today: Novus Biologicals and TransAlta emailed me back and said they’re unable to sponsor iGEM. Novus said that they’re a small company and they have donated the amount that they set aside earlier. I called TransAlta and they said they like our project but due to the economic crisis, they had to cut down their budget; they’re only funding on-going projects within their own companies.

I sent a thank you letters and asked for contact from 10 companies who were unable to help us. I also sent Noreen Schultz (Ab Community Relations Coordinator) from Company 1a breakdown of our budget and a project description (just as she had asked) after she didn’t quite understand the science behind our project. I showed Thane the description and budget breakdown before sending it. I emphasized that we’re not looking for something big, any donation will be greatly appreciated by the team. I’ll follow up with her on Monday, July 27th. I also followed up with the following:

Company 1 Emailed Noreen S. She understands our project and currently looking over pkg. Follow up on July 27 Company 2 President is looking over pkg, needs more time. Follow up July 27

BioAlberta The President was out of the country for about a month; he will get back tomorrow. His assistant said they’ll send the cheque of $1000.00 after he gets back.

Company 3 Called HR but couldn’t get a hold of her, left a msg. Follow up July 24

Company 4 called HR and left a msg, Follow up tomorrow to arrange a one on one meeting

GSK I called her back and she said that since our project for the competition deals with biofilms and they’re a pharmaceutical company; our doesn’t apply to them right now. I said that it can be used for medicine too but she said since I’m trying to raise money for the competition and the project in that case is biofilm, it doesn’t fit with their goals. But she told me send the pkg anyways so I’ll mail to her tomorrow.

Company 5 Called the Community sponsorship lady and she wasn’t in the office. I left a msg. follow up tomorrow.

Company 6 Called Nancy Laviorette (not sure about her position)….left a voicemail…follow up tomorrow. They’re looking over our pkg.

I also updated the gmail excel document with all the list of companies that Fahd and I have contacted. Jeremy said he’ll send me the list of companies and their contact info soon so I’ll put his up too. Jamie’s supposed to do his soon. I spent some time with Mandy and Patrick re-working/rewriting the second life section of the newsletter, re-wrote the Lethbridge trip section, edited some pics, etc. Phone calls took a long time since I called some of these companies every 2 hrs (but don’t worry I didn’t leave a msg every time). Since Jon’s dad is donating to the team, I gave him our account number for BMO and our address for the BhSc office depending on which method he uses to give us the money. I also wrote up a thank you letter which I need to pass by the rest of the marketing team tomorrow before we give it to Jon/his dad.

Today was spent having some ethics discussion with Dr. Wolbring. We talked about synthetic biology being different for Kiesling, Ventor and Endy. For example, Ventor wants to build an organism from the bottom up, while Kiesling is more interested in metabolic engineering. Dr. Wolbring suggested we should keep in mind the economic viability of our project. What is the reason we are doing this project? Is there something that is more effective and cheaper than our system for destroying and preventing biofilm formation? He said the teams don't really take these things into account and some other things about iGEM that I didn't really agree with because I feel iGEM is not meant for useful applications and a product that will sell. We're undergraduates, I don't think groundbreaking discoveries should be expected. Anyway, he did offer some help in suggesting some ways we can go beyond the paper (see Fahd's email).

For Second Life, I fixed up the eukaryotic cell today. I then met with Max Chatnoir, creator of genome island in order to show her my endoplasmic reticulum (the Second Life one not one in my body). I did this because I feel it is important to keep my contacts updated and also she was having trouble creating one herself. She was super impressed and I also sent pictures of the lab and synthetic kingdom. She is excited for the unveiling of our island. Then, she mentioned that we should join SciLands, a collection of science based islands that are grouped together in Second Life and Mandy took a look at the application and we thought this would be an excellent idea.

Tomorrow will consist of the ethics (or lab?) meeting and also the super secret announcement for Sonja. After that, I will most likely be continuing my work in the Synthetic Kingdom by brainstorming some more ideas for engineered cells.

We touched on that briefly today but had to put that on hold to discuss lab work. We’re planning to put together something that includes a description of what we’re planning to look at (Hill equation, static/dynamic behaviour, response time, population mean and range), why it’s useful and how we plan to collect the data to develop the model or quantify that aspect of characterisation.

We all know that I’m making a lot of vague claims in the introduction (ie, why coordinated behaviour could be useful in degrading biofilms). These need to be substantiated by something specific and credible. I will address that as much as I can within the next few hours. Other areas of concern include a lacklustre description and comparison of the AHL and AI-2 signalling pathways that needs to be improved (ie, why do we want AI-2 beyond my favourite example of enabling a quorum-based logic gate? I need to mention specific cases where the AHL system does not function while AI-2 does, which can be found in the literature); poor formatting of names that need to be italicised or not (genes vs proteins); a more rigorous description of how and why bacteria use quorum sensing in nature; a better introduction to LuxOD47A, where it came from, how it was developed and in what specific experiment it was used in. This list is by no means exhaustive and I’m sure that more will come up once I address the issues that I’ve mentioned.

We discussed this in our paper meeting today. I was still somewhat in thesis mode and I wasn’t sure how much detail to include because I thought that we were just writing this for the wiki. As mentioned in the meeting today, I’ll make it less cumbersome, assume some prior knowledge of technologies such as PCR, and use the descriptions that I wrote for the typed edition of my notebook.

I’m still a little uncertain about the results too – I haven’t focussed on it that much yet because I’ve been caught up in the previous sections. From what I understand, since I don’t have any functional validations (if my cells glowed, I would worry), the sequencing results really are the verification that something happened. I’ll also include my very last gel, which includes the DNA ladder, a negative control, LuxOD47A BBk, LuxOD47A BBk + B0015, and J13002 + Lux… + B0015. This displays everything that we’re contributing to the registry; has a good negative control; and distinct size differences that help validate the results. I’ll have a better sense of whether to include more detail as the section takes form – we had talked about including a gel for every stage of the process, but if I can embody all 3 Registry contributions in one, it would be the least cumbersome to just use that.