Team:Valencia/Parts

From 2009.igem.org

(Difference between revisions)
(→Preparing inserts)
(→Preparing inserts)
Line 7: Line 7:
AEQ was amplified by PCR using oligonucleotides matching the sequence and bearing the appropriate Biobrick prefix and suffix.<br>
AEQ was amplified by PCR using oligonucleotides matching the sequence and bearing the appropriate Biobrick prefix and suffix.<br>
-
 
-
 
-
Firstly, aequorin sequence is:<br>
 
-
 
-
1 atgaccagcg accaatactc agtcaagctt acatcagact tcgacaaccc aagatggatt<br>
 
-
61 ggacgacaca agcatatgtt caatttcctt gatgtcaacc acaatggaaa aatctctctt<br>
 
-
121 gacgagatgg tctacaaggc atctgatatt gtcatcaata accttggagc aacacctgag<br>
 
-
181 caagccaaac gacacaaaga tgctgtagga gccttcttcg gaggagctgg aatgaaatat<br>
 
-
241 ggtgtggaaa ctgattggcc tgcatacatt gaaggatgga aaaaattggc tactgatgaa<br>
 
-
301 ttggagaaat acgccaaaaa cgaaccaacg ctcatccgta tatggggtga tgctttgttt<br>
 
-
361 gatatcgttg acaaagatca aaatggagct attacactgg atgaatggaa agcatacacc<br>
 
-
421 aaagctgctg gtatcatcca atcatcagaa gattgcgagg aaacatccag agtgtgcgat<br>
 
-
481 attgatgaaa gtggacaact cgatgttgat gagatgacaa gacaacattt aggattttgg<br>
 
-
541 tacaccatgg atcctgcttg cgaaaagctc tacggtggag ctgtccccta a<br>
 
Line 59: Line 45:
Amplicons were digested (H buffer) with EcoRI y XbaI.<br>
Amplicons were digested (H buffer) with EcoRI y XbaI.<br>
 +
 +
 +
 +
===Preparing vectors===
 +
 +
Competent cells were transformed with:  <br>
 +
 +
 +
Plasmids were extracted (High pure miniprep plasmid isolation kit ROCHE) <br>
 +
Plasmid were digested with EcoRI and XbaI<br>
 +
 +
 +
===Ligating Biobricks into plasmids===
 +
 +
Both plasmids and inserts were run into 0.8% 0.5X TBE agarose gels and DNA bands excised with a clean scalpel. DNA was extracted from agarose blocks (ultra clean gel spin, DNA purification Kit, MO BIO laboratories).<br>
 +
T4 Ligase was used to ligate inserts and vectors for 1 h at room temperature (2X quick buffer was used).<br>
 +
Competent cells were transformed and resulting colonies (Amp LB) screened with Fw and Rv primers to confirm the presence of inserts. <br>
 +
pSB1AK3 containing UCP-1, 175-deleted and 76-deleted were sent to the Registry <br>
 +
 +
 +
 +
 +
 +
</div>
 +
</div>

Revision as of 15:05, 5 October 2009















Preparing inserts

Total DNA was extracted from our yeast strains.
AEQ was amplified by PCR using oligonucleotides matching the sequence and bearing the appropriate Biobrick prefix and suffix.



And our oligos (EcoRI and XbaI sites in bold) were:
Forward: 5'gaattcgcggccgcttctagatgaccagcg 3’
Reverse: 5’tactagtagcggccgctgcagttaggggac 3’



PCR was conducted as follows:

    A first denaturation cycle
      94º 3'

    Followed by 30 amplification cycles:

      94º 30 55º 1' 72º 1'

    And a final extension step:

      72º 7'


Results:

File:.jpg

1 = wt (1 microlitre)
2 = wt (2 microlitres)
3 = Cch1 (1 microlitre)
4 = Mid1 (1 microlitre)
5 = Negative Control
6 = Possitive Control
(We used the same MWM)

We used wt 1 microlitre of PCR amplification product (career 1) to build the AEQ BioBrick.

Amplicons were digested (H buffer) with EcoRI y XbaI.


Preparing vectors

Competent cells were transformed with:


Plasmids were extracted (High pure miniprep plasmid isolation kit ROCHE)
Plasmid were digested with EcoRI and XbaI


Ligating Biobricks into plasmids

Both plasmids and inserts were run into 0.8% 0.5X TBE agarose gels and DNA bands excised with a clean scalpel. DNA was extracted from agarose blocks (ultra clean gel spin, DNA purification Kit, MO BIO laboratories).
T4 Ligase was used to ligate inserts and vectors for 1 h at room temperature (2X quick buffer was used).
Competent cells were transformed and resulting colonies (Amp LB) screened with Fw and Rv primers to confirm the presence of inserts.
pSB1AK3 containing UCP-1, 175-deleted and 76-deleted were sent to the Registry



</div> </div>

Retrieved from "http://2009.igem.org/Team:Valencia/Parts"