Team:Valencia/Parts

Preparing inserts

Total DNA was extracted from our yeast strains.
AEQ was amplified by PCR using oligonucleotides matching the sequence and bearing the appropriate Biobrick prefix and suffix.

And our oligos (EcoRI and XbaI sites in bold) were:
Forward: 5'gaattcgcggccgcttctagatgaccagcgaccaatactc 3’
Reverse: 5’tactagtagcggccgctgcagttaggggacagctccaccg 3’

PCR was conducted as follows:

A first denaturation cycle
94º 3min

Followed by 30 amplification cycles:

94º 30s
55º 1min
72º 1min


And a final extension step:

72º 7min






Results:


1 = wt (1 microlitre)
2 = wt (2 microlitres)
3 = Cch1 (1 microlitre)
4 = Mid1 (1 microlitre)
5 = Negative Control
6 = Possitive Control
(We used the same MWM)


Amplicon has 600 pb's. We used wt 1 microlitre of PCR amplification product (career 1) to build the AEQ BioBrick.


Firstly, we purified the DNA from the agarosa (High Pure PCR Product Purification Kit, Roche). Later, amplicons were digested (H buffer) with EcoRI y XbaI.


Preparing vectors

Competent cells were transformed with pSB1A3 with the J04450 insert (present in the kit plate 1, hole 1K from the 2009 plasmid backbone distribution kit). We used the transformation protocol of XL1-Gold Ultracompetent Cells of..... We selected transformed cells in a LB + ampicillin medium plaques.


The following day, we selected red colonies, those that had the plasmid, and plasmids were extracted with the High pure miniprep plasmid isolation kit (ROCHE)
Plasmid were digested with EcoRI and XbaI, in the same way we digested PCR result.





Ligating Biobricks into plasmids

Both plasmids and inserts were run into 0.8% 0.5X TBE agarose gels and DNA bands excised with a clean scalpel. DNA was extracted from agarose blocks (ultra clean gel spin, DNA purification Kit, MO BIO laboratories).
T4 Ligase was used to ligate inserts and vectors for 1 h at room temperature (2X quick buffer was used).
Competent cells were transformed and resulting colonies (Amp LB) screened with Fw and Rv primers to confirm the presence of inserts.


pSB1AK3 containing UCP-1, 175-deleted and 76-deleted were sent to the Registry