Team:NYMU-Taipei/Project/Receptor/Integrin

From 2009.igem.org

(Difference between revisions)
Blackrabbit (Talk | contribs)
(New page: NYMU Wt-rece.png {{:Team:NYMU-Taipei/Header}} ==Motivation== Virus have a high mutation rate, so our immune system can not always detect mutated viruses. But vi...)
Newer edit →

Revision as of 20:24, 21 October 2009

NYMU Wt-rece.png


Contents

Motivation

Virus have a high mutation rate, so our immune system can not always detect mutated viruses. But virus capsid proteins have some specific binding proteins that viruses use to enter into human cells. There are some highly conserved regions on the virus proteins, since mutations of these regions will never be worth it for the viruses since the viruses will not be able to enter human cells and survive.

We wanted to express receptors that interact with several viruses (such as Adenovirus and coxsackievirus) originating from human cells in our ViroCatcher. In addition, we have to check the folding of target receptors, because our receptors come from human cells have to express and fold in bacteria. Eventually, to make contact with receptors of Adenovirus-like viruses and we have to anchor the receptors on the membrane of our ViroCatcher.

Goal

Use the receptors on human cells that bind to adenovirus-like viruses, and put them on our ViroCatcher to catch adenovirus-like viruses.

Receptors used to catch adenovirus and coxsackievirus

Previous studies indicates that several viruses like adenovirus and coxsackivirus interact with cellular receptors alpha-V integrin to entry into human cells. These virus capsid proteins has a conserve "RGD" region that interacts with the human α-V integrin receptor. Previous studies also shows that when virus lose the "RGD" motif, they reduce their ability of infection[1]. Not only can adenovirus and cosackievirus interact with receptor the α-V integrin, many other viruses can interact with it (See table 1)[2].

We chose to use receptor α-V integrin to catch viruses that has the "RGD" motif, so our ViroCatcher can catch several virus just by using the alpha-V integrin receptor.

Table of integrin in viruses entry.JPG


Here we chose another receptor CAR (coxsackievirus and adenovirus receptor) that is used specially for catching adenovirus and coxsakievirus. Adenovirus and coxsakievirus not only bind to the α-V integrin receptor, it also binds to the CAR receptor when they infect our cells. They use their fiber proteins on their capsid to interact with the CAR receptor[3].

Previous studies also indicates that the binding affinity of the CAR receptor is better than α-V integrin, so we add the CAR receptor to ensure that our ViroCatcher can catch adenovirus and coxsackievirus[3].


We express the two receptors α-V integrin and the CAR receptor on our ViroCatcher membrane and use autotransporter system to anchor them on the membrane of our ViroCatcher.

  • [http://www.ncbi.nlm.nih.gov/nuccore/223468596?from=277&to=3315&report=gbwithparts alpha-V integrin sequence]
       1 atggcttttc cgccgcggcg acggctgcgc ctcggtcccc gcggcctccc gcttcttctc
      61 tcgggactcc tgctacctct gtgccgcgcc ttcaacctag acgtggacag tcctgccgag
     121 tactctggcc ccgagggaag ttacttcggc ttcgccgtgg atttcttcgt gcccagcgcg
     181 tcttcccgga tgtttcttct cgtgggagct cccaaagcaa acaccaccca gcctgggatt
     241 gtggaaggag ggcaggtcct caaatgtgac tggtcttcta cccgccggtg ccagccaatt
     301 gaatttgatg caacaggcaa tagagattat gccaaggatg atccattgga atttaagtcc
     361 catcagtggt ttggagcatc tgtgaggtcg aaacaggata aaattttggc ctgtgcccca
     421 ttgtaccatt ggagaactga gatgaaacag gagcgagagc ctgttggaac atgctttctt
     481 caagatggaa caaagactgt tgagtatgct ccatgtagat cacgtcagct tatttcggat
     541 caagtggcag aaatcgtatc taaatacgac cccaatgttt acagcatcaa gtataataac
     601 caattagcaa ctcggactgc acaagctatt tttgatgaca gctatttggg ttattctgtg
     661 gctgtcggag atttcaatgg tgatggcata gatgactttg tttcaggagt tccaagagca
     721 gcaaggactt tgggaatggt ttatatttat gatgggaaga acatgtcctc cttatacaat
     781 tttactggcg agcagatggc tgcatatttc ggattttctg tagctgccac tgacattaat
     841 ggagatgatt atgcagatgt gtttattgga gcacctctct tcatggatcg tggctctgat
     901 ggcaaactcc aagaggtggg gcaggtctca gtgtctctac agagagcttc aggagacttc
     961 cagacgacaa agctgaatgg atttgaggtc tttgcacggt ttggcagtgc catagctcct
    1021 ttgggagatc tggaccagga tggtttcaat gatattgcaa ttgctgctcc atatgggggt
    1081 gaagataaaa aaggaattgt ttatatcttc aatggaagat caacaggctt gaacgcagtc
    1141 ccatctcaaa tccttgaagg gcagtgggct gctcgaagca tgccaccaag ctttggctat
    1201 tcaatgaaag gagccacaga tatagacaaa aatggatatc cagacttaat tgtaggagct
    1261 tttggtgtag atcgagctat cttatacagg gccagaccag ttatcactgt aaatgctggt
    1321 cttgaagtgt accctagcat tttaaatcaa gacaataaaa cctgctcact gcctggaaca
    1381 gctctcaaag tttcctgttt taatgttagg ttctgcttaa aggcagatgg caaaggagta
    1441 cttcccagga aacttaattt ccaggtggaa cttcttttgg ataaactcaa gcaaaaggga
    1501 gcaattcgac gagcactgtt tctctacagc aggtccccaa gtcactccaa gaacatgact
    1561 atttcaaggg ggggactgat gcagtgtgag gaattgatag cgtatctgcg ggatgaatct
    1621 gaatttagag acaaactcac tccaattact atttttatgg aatatcggtt ggattataga
    1681 acagctgctg atacaacagg cttgcaaccc attcttaacc agttcacgcc tgctaacatt
    1741 agtcgacagg ctcacattct acttgactgt ggtgaagaca atgtctgtaa acccaagctg
    1801 gaagtttctg tagatagtga tcaaaagaag atctatattg gggatgacaa ccctctgaca
    1861 ttgattgtta aggctcagaa tcaaggagaa ggtgcctacg aagctgagct catcgtttcc
    1921 attccactgc aggctgattt catcggggtt gtccgaaaca atgaagcctt agcaagactt
    1981 tcctgtgcat ttaagacaga aaaccaaact cgccaggtgg tatgtgacct tggaaaccca
    2041 atgaaggctg gaactcaact cttagctggt cttcgtttca gtgtgcacca gcagtcagag
    2101 atggatactt ctgtgaaatt tgacttacaa atccaaagct caaatctatt tgacaaagta
    2161 agcccagttg tatctcacaa agttgatctt gctgttttag ctgcagttga gataagagga
    2221 gtctcgagtc ctgatcatat ctttcttccg attccaaact gggagcacaa ggagaaccct
    2281 gagactgaag aagatgttgg gccagttgtt cagcacatct atgagctgag aaacaatggt
    2341 ccaagttcat tcagcaaggc aatgctccat cttcagtggc cttacaaata taataataac
    2401 actctgttgt atatccttca ttatgatatt gatggaccaa tgaactgcac ttcagatatg
    2461 gagatcaacc ctttgagaat taagatctca tctttgcaaa caactgaaaa gaatgacacg
    2521 gttgccgggc aaggtgagcg ggaccatctc atcactaagc gggatcttgc cctcagtgaa
    2581 ggagatattc acactttggg ttgtggagtt gctcagtgct tgaagattgt ctgccaagtt
    2641 gggagattag acagaggaaa gagtgcaatc ttgtacgtaa agtcattact gtggactgag
    2701 acttttatga ataaagaaaa tcagaatcat tcctattctc tgaagtcgtc tgcttcattt
    2761 aatgtcatag agtttcctta taagaatctt ccaattgagg atatcaccaa ctccacattg
    2821 gttaccacta atgtcacctg gggcattcag ccagcgccca tgcctgtgcc tgtgtgggtg
    2881 atcattttag cagttctagc aggattgttg ctactggctg ttttggtatt tgtaatgtac
    2941 aggatgggct tttttaaacg ggtccggcca cctcaagaag aacaagaaag ggagcagctt
    3001 caacctcatg aaaatggtga aggaaactca gaaacttaa

outer primer foward contain ompA sticky tag

GCACTCGTCCGGACAAC(56deg, 65%, 17bp) ATGGCTTTTCCGCCG 53deg, 60%, 8+15bp

outer primer reverse

ctgcagcggccgctactagta TTAAGTTTCTGAGTTTCCTTCACC 55deg, 38%, 21+24bp

inner primer1:55deg, 53%, 19bp

CCATTCCACTaCAGGCTGA
TCAGCCTGtAGTGGAATGG

inner primer2:55deg, 41%, 22bp

CTGTTTTAGCaGCAGTTGAGAT
ATCTCAACTGCtGCTAAAACAG


  • [http://www.ncbi.nlm.nih.gov/CCDS/CcdsBrowse.cgi?REQUEST=CCDS&ORGANISM=0&BUILDS=CURRENTBUILDS&DATA=CCDS33519.1 receptor CXADR(CAR) sequence]
       1 atggcgctcc tgctgtgctt cgtgctcctg tgcggagtag tggatttcgc cagaagtttg
      61 agtatcacta ctcctgaaga gatgattgaa aaagccaaag gggaaactgc ctatctgccg
     121 tgcaaattta cgcttagtcc cgaagaccag ggaccgctgg acatcgagtg gctgatatca
     181 ccagctgata atcagaaggt ggatcaagtg attattttat attctggaga caaaatttat
     241 gatgactact atccagatct gaaaggccga gtacatttta cgagtaatga tctcaaatct
     301 ggtgatgcat caataaatgt aacgaattta caactgtcag atattggcac atatcagtgc
     361 aaagtgaaaa aagctcctgg tgttgcaaat aagaagattc atctggtagt tcttgttaag
     421 ccttcaggtg cgagatgtta cgttgatgga tctgaagaaa ttggaagtga ctttaagata
     481 aaatgtgaac caaaagaagg ttcacttcca ttacagtatg agtggcaaaa attgtctgac
     541 tcacagaaaa tgcccacttc atggttagca gaaatgactt catctgttat atctgtaaaa
     601 aatgcctctt ctgagtactc tgggacatac agctgtacag tcagaaacag agtgggctct
     661 gatcagtgcc tgttgcgtct aaacgttgtc cctccttcaa ataaagctgg actaattgca
     721 ggagccatta taggaacttt gcttgctcta gcgctcattg gtcttatcat cttttgctgt
     781 cgtaaaaagc gcagagaaga aaaatatgaa aaggaagttc atcacgatat cagggaagat
     841 gtgccacctc caaagagccg tacgtccact gccagaagct acatcggcag taatcattca
     901 tccctggggt ccatgtctcc ttccaacatg gaaggatatt ccaagactca gtataaccaa
     961 gtaccaagtg aagactttga acgcactcct cagagtccga ctctcccacc tgctaaggta
    1021 gctgccccta atctaagtcg aatgggtgcg attcctgtga tgattccagc acagagcaag
    1081 gatgggtcta tagtatag

outer primer forward contain ompA sticky tag

GCACTCGTCCGGACAAC(56deg, 65%, 17bp)ATGGCGCTCCTGCTGTGC 62deg, 67%, 18bp

outer primer reverse

ctgcagcggccgctactagta CTATACTATAGACCCATCCTTGCTC 55deg, 44%, 25bp

Circuit design

HIV receptors
pRE
K116603

NYMU icon P.png
RBS
B0034

NYMU icon R.png

transmembrane region

NYMU icon C.png

CAR or alpha-v integrin

NYMU icon C.png

B0010

NYMU icon T.png

B0012

NYMU icon T.png

References

1. Shiokawa S, Yoshimura Y, Sawa H, Nagamatsu S, Hanashi H, Sakai K, Ando M, Nakamura Y: Functional role of arg-gly-asp (RGD)-binding sites on beta1 integrin in embryo implantation using mouse blastocysts and human decidua. Biol Reprod 1999, 60(6):1468-1474.
2. Shan-dian G, Jun-zheng D, Jian-hua Z, Hui-yun C, Qing-ge X: Integrin activation and viral infection. Virologica Sinica 2008, 23(1): 1-7.
3. Nemerow GR, Stewart PL: Role of alpha(v) integrins in adenovirus cell entry and gene delivery. Microbiol Mol Biol Rev 1999, 63(3):725-734.