Team:KULeuven/Lab/Blue Light Receptor
From 2009.igem.org
(Difference between revisions)
(→required) |
(→Where from) |
||
Line 20: | Line 20: | ||
for biobrick | for biobrick | ||
only when actual promoter is known | only when actual promoter is known | ||
+ | *the GFP (BBa_E0240)came from the freezer (-80)at the lab | ||
==Steps== | ==Steps== |
Revision as of 12:46, 27 July 2009
Contents |
Planning
Goal
Purifying the promoter region of the blue light receptor from E. Coli. This region needs to be ‘cleaned’ and possible restriction sites mutated out. After a biobrick can be made.
required
- e coli stam ( MC4100)
- Primers (1) for PCR: already ordered (nummers: 2171 (FP) - 2172 (RP))
- Primers (2) for ‘cleaning’ region
- Primers (3) for biobrick (nog te maken)
- GFP with RBS and Terminator sequence
Where from
- Strain: from lab
- Primers: self made and ordered
for PCR Forward: CATCAT GAATTCGCGGCCGCTTCTAGAG TTT GAC AGG TTC GTC GTC Reverse: CTGCAGCGGCCGCTACTAGTA CCT CTG TTA AAA ATG TTA ATC AAT GTT AAG for ‘cleaning’ for biobrick only when actual promoter is known
- the GFP (BBa_E0240)came from the freezer (-80)at the lab
Steps
- 1.PCR reaction to purify suspected promoter region.
Probably has a promoter, RBS and SpeI restriction site.
- 2.PCR fragment coupled to GFP
Measuring reactivity of the promoter
- 3.“cleaning” region to only get promoter
Cutting in different pieces and measuring the GFP activity
a. Same reverse primer, shortening through forward primer. b. Once there is no activity anymore with forward primer, keep it constant and shorten reverse inkorten c. Once promoter found: updating those primers with a pre en suffix to make a biobrick out of the promoter
- 4.Mutating SpeI site out ( 178 - 183) via PCR mutagenesis
important
following conditions need to be kept in account:
- for growth of the bacteria: 37°C
- for expression of the genes regulated by ycgF/E system: 16°C
- at 16°C: expression will start after 50h and a very slow reversion to the ground state of ycgF
- working with a colony in the dark and one in light so that the effects of cold temperature on the gene expression pattern can be calculated out.
- blue light does NOT induce stress and cell death in E. Coli
- to monitor growth of the cells, measurement at OD 578 can be used