"
Team:KULeuven/Wetlab/Vanillin Production
From 2009.igem.org
(Difference between revisions)
Bart Bosmans (Talk | contribs) (New page: {{Team:KULeuven/Common/BeginHeader}} {{Team:KULeuven/Common/SubMenu_Wetlab}} {{Team:KULeuven/Common/EndHeader}} =VANILLIN SYNTHESIS= ==Goal== Making vanillin from tyrosine in a five-step...) |
JochemDeen (Talk | contribs) (→Required) |
||
| Line 14: | Line 14: | ||
*SAM5: {{kulpart|BBa_K238007}}: RBS site + PstI restriction site removed | *SAM5: {{kulpart|BBa_K238007}}: RBS site + PstI restriction site removed | ||
*COMT: {{kulpart|BBa_I742107}}: coding sequence without RBS | *COMT: {{kulpart|BBa_I742107}}: coding sequence without RBS | ||
| + | ** LVA tag (AANDENYALAA) attached to COMT (nucleotide code: gctgcaaacgacgaaaactacgctttagtagct) | ||
*FCS: {{kulpart|BBa_I742115}}: RBS + fcs in pSB1A2 | *FCS: {{kulpart|BBa_I742115}}: RBS + fcs in pSB1A2 | ||
*ECH: {{kulpart|BBa_I742113}}: RBS + ech in pSB1A2 | *ECH: {{kulpart|BBa_I742113}}: RBS + ech in pSB1A2 | ||
Revision as of 07:57, 1 September 2009
Contents |
VANILLIN SYNTHESIS
Goal
Making vanillin from tyrosine in a five-step pathway.
Required
Biobricks:
- SAM8: : coding sequence without RBS
- SAM5: : RBS site + PstI restriction site removed
- COMT: : coding sequence without RBS
- LVA tag (AANDENYALAA) attached to COMT (nucleotide code: gctgcaaacgacgaaaactacgctttagtagct)
- FCS: : RBS + fcs in pSB1A2
- ECH: : RBS + ech in pSB1A2
Where from
- SAM8, SAM5, COMT, FCS, ECH will be sent to us from the French Lab from the university Edinburgh
Steps
- We will be working in three different stages
- Testing the transformation of tyrosin to ferrulic acid. The enzymes are put under a constitutive promoter and transcribed. Ferrulic acid concentrations are then measured with GC
- Testing the transformation of ferrulic acid to vanillin. The enzymes are put under a constitutive promoter and transcribed. Ferrulic acid concentrations are then measured with GC
- If both are tested and ok, they can be combined into one plasmid and again tested.
- Then, the locks need to be added.
- Testing the enzymes by detecting the endproducts through gaschromatography.
- One problem might be that the tyrosine of E. coli is depleted too fast
