"
Team:KULeuven/Wetlab/Vanillin Production
From 2009.igem.org
(Difference between revisions)
Bart Bosmans (Talk | contribs) |
Bart Bosmans (Talk | contribs) |
||
| Line 4: | Line 4: | ||
__NOTOC__ | __NOTOC__ | ||
=VANILLIN SYNTHESIS= | =VANILLIN SYNTHESIS= | ||
| - | + | ||
==Goal== | ==Goal== | ||
| + | [[Image:Miss_Blue_vanillin_production.png|225px|left]] | ||
Making vanillin from tyrosine in a five-step pathway. | Making vanillin from tyrosine in a five-step pathway. | ||
| - | [[Image:Vanillin_Biosynthesis_Pathway.jpg| | + | [[Image:Vanillin_Biosynthesis_Pathway.jpg|right|thumb|365px|Making vanillin from tyrosine]] |
==Required== | ==Required== | ||
Revision as of 15:17, 2 September 2009
VANILLIN SYNTHESIS
Goal
Making vanillin from tyrosine in a five-step pathway.
Required
Biobricks:
- SAM8: : coding sequence without RBS
- SAM5: : RBS site + PstI restriction site removed
- COMT: : coding sequence without RBS
- LVA tag (AANDENYALAA) attached to COMT (nucleotide code: gctgcaaacgacgaaaactacgctttagtagct)
- FCS: : RBS + fcs in pSB1A2
- ECH: : RBS + ech in pSB1A2
Where from
- SAM8, SAM5, COMT, FCS, ECH will be sent to us from the French Lab from the university Edinburgh
Steps
- We will be working in three different stages
- Testing the transformation of tyrosin to ferrulic acid. The enzymes are put under a constitutive promoter and transcribed. Ferrulic acid concentrations are then measured with GC
- Testing the transformation of ferrulic acid to vanillin. The enzymes are put under a constitutive promoter and transcribed. Ferrulic acid concentrations are then measured with GC
- If both are tested and ok, they can be combined into one plasmid and again tested.
- Then, the locks need to be added.
- Testing the enzymes by detecting the endproducts through gaschromatography.
- One problem might be that the tyrosine of E. coli is depleted too fast
