|
|
CAROL
Modeling Readings Continued
- Continued with reading up on things to characterize for the AI-2 system
- Started familiarization with Single Site-Directed Mutagenesis protocol
- Primers for mutagenesis is ordered. The following are the sequences for the mutagenesis:
LuxCDABE-M-F:CCATTAATGAATTGCCGGATAATCTGGATTTTGAAGGCC
LuxCDABE-M-R:GGCCTTCAAAATCCAGATTATCCGGCAATTCATTAATGG
- Both primers are PAGE purified.
- Received licences for Matlab and Simbiology. Downloaded program and was able to practice through examples found in the Matlab package. Focused on G protein cascase model (example in Matlab) in Yeast and prepared a presentation to show other iGEM members how Simbiology works.
|
|
|
CHINMOYEE
CLASS
|
|
|
EMILY
Sequencing of LuxOD47E in psB1AC3
- Objective: To veriffy the presence of the LuxOD47E gene in the psB1AC3 BBK vector
Size of plasmid Backbone: 3055 bp
Size of the gene of interest: 1362 bp
Total size: 4417 bp
Sequencing needs 100ng of DNA/ 1 kb
4.4kb x 100ng/kb = 440ng
Concentration of C2= 92.9ng/μL
440ng/ 92.9 ng/uL = 4.8 μL DNA
Diluted 4.8 μL DNA (LuxOD47E BBK C2) with 5.2 μL ddH20 and sent down to Univeristy of Calgary Sequencing Labs with VF2 and VF1 primers.
- Results: Sequencing came back and results indicated that the gene if interest, LuxOD47E was not in the psB1AC3 vector. We will have to go back to the gene in the pCR2.1-TOPO vector and try to get it into the psB1AC3 vector.
File:2009.05.28.D47E BBkVer RD+PCR.tif
|
|
|
FAHD
Descriptive Title of What You're Doing
|
|
|
IMAN
Descriptive Title of What You're Doing
|
|
|
JAMIE
Descriptive Title of What You're Doing
|
|
|
JEREMY
Send LuxO D47A in psB1AC3 Colony 2 to get sequenced
Although RD and PCR are effective means of verifying the presence of a sequence of DNA, the gold standard for verification is DNA sequencing. LuxO D47A in psB1AC3 Colony 2 was sent to the University of Calgary DNA Sequencing Facility (University Core DNA Services, Calgary, Alberta, Canada). Primers used were VF2 (anneals near the BBK prefix on the BBK vector - used as a forward primer) and VF1 (anneals near the BBK suffix on the BBK vector - used as a reverse primer). The template was prepared such that there was 100ng/1kb of DNA (gene of interest + vector).
After analyzing the sequencing results, it was evident that luxO D47A was absent from the psB1AC3 vector.
|
|
|
KATIE
Descriptive Title of What You're Doing
|
|
|
KEVIN
Matlab and symbiology
Familiarizing with the matlab program provided by MathWorks, and its biological tool called Symbiology.
No experiments were done on this day.
|
|
|
MANDY
Descriptive Title of What You're Doing
|
|
|
PATRICK
Descriptive Title of What You're Doing
|
|
|
PRIMA
Descriptive Title of What You're Doing
|
|
|
STEFAN
Descriptive Title of What You're Doing
|
|
|
VICKI
Gel electrophoresis of PCR and restriction digest products from yesterday
Purpose: To analyse the PCR and restriction digest products from yesterday by running them on the gel. This will show:
- Whether or not the products are free of DNA contamination
- Whether or not they actually contain LuxPQ BBk (or LuxPQ TOPO) – note that sequencing is the only way to confirm this, but this will help us eliminate products that clearly do not contain the gene of interest
Materials and methods:
- Preparation.
- Salvaging the restriction digests, which were hastily left overnight at room temperature and with no orange dye to stop the reaction. This was addressed today, when 4uL of orange dye were introduced to the 20 uL of restriction digest tube contents to deactivate the NotI restriction enzymes. 16 uL of ddHOH were added to bring the total tube volume up to 40 uL
- Introducing a negative control. Stock LuxPQ BBk (of the uncut variety) will produce a distinct band on the gel around 7500 bp (accounting for the psB1AC3 plasmid and the LuxPQ gene), with fluctuations in levels based on the degree of coiling. Accordingly, if the NotI restriction digests did not actually digest, the digest lanes will resemble this control. This tube included 2uL of DNA, 1 uL of dye and 7 uL ddHOH
- PCR products to evaluate specificity. If there are significant genetic mutations in the BBk sample, the primers will either not anneal at all (resulting in no PCR product) or anneal but give a product that is of a different size (if the mutations are beyond the primer domain).
- Gel set-up
- A 0.7% agarose gel was made. 10 uL of the aforementioned cocktails were loaded into each well, with the well key included in the results picture. Voltage was set at 90V and left to run for 50 minutes. A GenRuler 1 kb Plus DNA Ladder was run in parallel to provide size calibrations for our results.
Results:
(insert May 28 gel picture here)
|
"
