"
Team:Kyoto/CiC/Experiment
From 2009.igem.org
Experiment
Construction
HIV-TAT::(LALAAAA)3 expressing vector
†RBS+HIV-TAT+HIStag+(LALAAAA)3 was made by elongation of primer dimer.
(Forward primer;
cggaattcgcggccgcttctagagaaagaggagaaatactagATGTATGGACGTAAAAAACGTCGTGGACGTCGTCGTGGCGGCGGTCATCATCATCATCACCATGGCGG
Reverse primer;
ctgcagcggccgctactagtaTTACGCGGCCGCCGCCAGGGCCAGCGCGGCCGCCGCCAGGGCCAGCGCGGCCGCCGCCAGGGCCAGGCCACCGCCATGGTGATGATGATG)
Signal for TIM23 complex::GFP expressing vector
†RBS+Signal for TIM23 complex::GFP+terminator was made by two-stage PCR.
First-stage PCR
Forward primer;
TTTAAACCGGCGACCCGTACCCTGTGCTCTTCTCGTTATCTGCTGcgtaaaggagaagaacttttcactggagttg
Reverse primer;
agtgagctgataccgctcgc
Second-stage PCR Forward primer; cggaattcgcggccgcttctagagaaagaggagaaatactagATGCTGAGCCTGCGTCAGTCTATTCGTTTTTTTAAACCGGCGACCCGTAC Reverse primer; agtgagctgataccgctcgc
Evaluation for the performance of Timer Vector
We evaluate Timer Vector by observing the expression of GFP. Timer Vector is inserted into yeast which is transformed by lacI expression vector. Timer Vector has LacI repetitive sequence in the both ends. It protects from the degradation by exonuclease, so GFP is expressed. The repetitive sequence becomes shorter every time a cell divides. At last, the repetitive sequence is completely lost. Timer Vector is degraded by exonuclease, and stop the expression of GFP.
The expression of GFP is observed by fluorescence microscope. We observe the yeast in liquid culture medium on a glass schale. Liquid culture allows us to choose single yeast to focus on. ConcanavalinA is added into the culture medium. This prevents the yeast from diffusing, and yeast forms colonies in culture medium. We use CSM liquid culture medium without Uracil. The yeast we use can’t synthesize Uracil. Timer Vector has Uracil synthetic gene, so only transformed yeast grow.
In the anticipated result, the colony stops the expression of GFP at the almost same time. The repetitive sequence becomes shorter by about 200bp per cell division, and it is completely lost after about 7-8 times of cell divisions. This leads the suggestion that observed colonies are composed of over 2の７乗 yeast.
</div>
