Restriction Digest
To verify the isolated
Pqrr4, restriction digest was done with NotI (invitrogen, Lot 2803027) enzymes, React Buffer 3, and GeneRuler SM1333 ladder.
Polymerase Chain Reaction (PCR)
The
Pqrr4 was then amplified using Polymerase Chain Reaction (PCR) from biobrick AC (pSB1AC3) using primers Pqrr4 F/R and platinum Thermus aquaticus (pTaq; invitrogen) according to the specifications of the manufacturer. The following cycling conditions were used:
94°C for 3 min; 36x (94°C for 30s; 53°C for 45s; 72°C for 1 min;) 72°C for 10 min; held at 4°C.
Sequencing
Lastly, the Colony 1, being Pqrr4 BBK Green, was sent for sequencing with Pqrr4 F/R primers to the University of Calgary DNA Sequencing Facility (University Core DNA Services, Calgary, Alberta, Canada).
ATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTG