Team:KULeuven/Notebook/Blue Light Receptor

From 2009.igem.org

Revision as of 06:52, 9 August 2009 by Deepstar (Talk | contribs)


Contents

Week 1: 6 July 2009 - 12 July 2009

Week 2: 13 July 2009 - 19 July 2009

[edit] Monday

  • YcgF Gene, naturally available in [http://ecoliwiki.net/colipedia/index.php/ycgF:Gene 3 E. Coli strains]. Can use the promotor of Ycgf gene for expression
  • Probable strain K12
  • Promotor voor YcgF gene:
    • AACAATCCAGGGTAATGGGTGAGGCGAGAGTAAGACGGTAACAGACATATCTTCTTG TGTCTTTCTTTTAATACCAAAACATAACCGTTTCTTTACATTGATAAAAAATGGAAAAAG TTGAACACTAGTTGGCGAAAAATCTTGTATAGATTGTCAGTTAAATGATGCAATATGTT TTATCATAACACATTGTTTTATATGCATTAGCACTAATTGCAAAAAATTAATTTATCATT CTGTACACATATTTCGTACAAGTTTGCTATTGTTACTTCACTTAACATTGATTAACATTTTTAACAGAGGCGTAGCATG
      (source: [http://www.ncbi.nlm.nih.gov])

[edit] Tuesday

  • Primer selection for the promotor [Done]
    • Send mail to Institut for Biologie-Mikrobiologie ([http://www.ncbi.nlm.nih.gov/pubmed/19240136 The BLUF-EAL protein YcgF acts as a direct anti-repressor in a blue-light response of Escherichia coli]) [Done]

[edit] Wednesday

  • Mail Institut fur Mikrobiologie der Westfalischen, Wilhelms-Universitat Munster for the plasmid [Done]

Week 3: 20 July 2009 - 26 July 2009

[edit] Thursday

  • Primers for the blue light receptor have arrived

[edit] Friday

  • PCR on promoter region in MC4100 E.coli colony using primers and tested on agarose gel

Week 4: 27 July 2009 - 2 August 2009

[edit] Monday

Nanodrop performed on purified promoter region

  • concentration: 91,9 ng/μl
  • 260/280 = 1,90
rbs + GFP + terminator was plated.

[edit] Tuesday

was cultured in liquid medium and put in the 37°C incubator overnight

[edit] Wednesday

An extra PCR on the MC4100 E.coli colony was performed using the primers 2171 and 2172. This was done to get extra promoter region templates (360bp)

GFP ()

  • Miniprepped and nanodropped
    • Concentration: 85,6ng/μl
    • 260/280: 1,87
  • A restriction digest was performed to cut the plasmid with EcoRI and XbaI
    • A mixture of 20μl was made(3x):6μl DNA, 2μl bufferH, 1μl EcoRI and 1μl XbaI, 10μl AD
    • The mixture was incubated for at least an hour at 37°C


BLR promoter region The PCR product that was purified friday (24/07) is digested with EcoRI and partially digested with SpeI

  • Digestion with EcoRI
    • Following mixture was made (x6): 5μl DNA, 2μl buffer H, 1μl EcoRI, 12μl MilliQ
    • Incubated for 1h at 37°C
  • Partial digestion with SpeI
    • Dilution of the enzymes:
      • AD/b: 225μl MQ + 25μl buffer H
      • 1/100: 1μl SpeI + 99μl AD/b
      • 1/200: 50μl 1/100 + 50μl AD/b
      • 1/500: 20μl 1/100 + 80μl AD/b
    • Made following mixture:
I II III IV V VI
EcoRI digestion mix 20μl 20μl 20μl 20μl 20μl 20μl
diluted SpeI 1μl 1/200 2μl 1/200 3μl 1/200 1μl 1/500 2μl 1/500 3μl 1/500
AD 4μl 3μl 2μl 4μl 3μl 2μl
  • The mixture was incubated for 15 min at 37°C

After the restriction digests, the products had to be checked for their length. So, an agarose gel was run for both the cut GFP-plasmids and the cut promoter region. A photograph was taken and following conclusions were made:

  • Plasmids with GFP appeared to have cut decently
  • Promoter region: the partial digestion did not seem to have done the trick. We only found a lane around 360 bp while we expected to find another lane just under 200 bp due to cutting at the "forbidden" SpeI site in the middle. As we did not find this lane in our gel we concluded that SpeI probably did not cut. This might be because it was diluted too much or because we did not incubate long enough.

We concluded to purify both the plasmids and the promoter region through gel extraction. After nanodropping, we had these results:

  • Plasmids:
    • Concentration: 22ng/µl
    • 260/280: 1,83
  • Promoter region (two samples):
    • Concentration: 31,7ng/µl and 32,7ng/µl
    • 260/280: 1,84 and 2,06

The conclusion of the day was to redo a partial digestion on the promoter regions, this time under different conditions (longer incubation time and less diluted). At the same time a Knelow technique would be used on the newly PCR-ed promoter region in order to cut out the SpeI site.

Later that evening we received an email from Regine Hengge (co-author on the article [http://www.ncbi.nlm.nih.gov/pubmed/19240136 The BLUF-EAL protein YcgF acts as a direct anti-repressor in a blue-light response of Escherichia coli]). This contained valuable information about the location of the actual promoter in our purified region.

[edit] Thursday

The PCR reaction that was done Wednesday was put on an agarose gel and run for an hour. Afterwards, the lane was purified by gel extraction and miniprepped. Three different samples with the same product were measured through the nanodrop:

  • Concentration:
    • 192,7 ng/µl
    • 161,9 ng/µl
    • 155,1 ng/µl
  • 260/280
    • 1,82
    • 1,82
    • 1,80

[edit] Friday


Week 5: 3 August 2009 - 9 August 2009

[edit] Monday

[edit] Tuesday

[edit] Wednesday

[edit] Thursday

Primers for the blue light receptor have arrived

[edit] Friday


Week 6: 10 August 2009 - 16 August 2009

[edit] Monday

PCR reaction with the new primers 2260 and 2261 to get the exact blue light promotor sequence. The reaction was succesful and with no byproducts, so a simple PCR clean up was executed.

  • concentration of clean pcr product.:
    • 102,6 ng/µl
    • 1,88

[edit] Tuesday

  1. Restriction digest
    • cut with EcoRI and SpeI, incubation for 1,5 hour
  2. Gel electrophoresis of
    • The cut piece should be 109 bp
  3. Restriction digest
  4. Electroporation of parts - and in electrocompetent cells

[edit] Wednesday

  1. Gel electrophoresis of BlP cut with EcoRI and SpeI
  2. Gel extraction of the Blp

Nanodrop results

Part concentration (ng/μl) 260/280 λ 260/230 λ
Blp 27 2,08
  1. PCR (with Pfx) of blue light promoter with primers iGEM 2260 and iGEM 2261
    • Annealing of 58C
  2. Inoculate liquid medium
    • Inoculation of - and
  3. Ligation
Vector insert
+ (BLP)
50ng -> 2,5 μl 5 ng -> 0,3 μl

[edit] Thursday

  1. PCR product of 12-august of pairt
  2. Miniprep of

Nanodrop results:

Part concentration (ng/μl) 260/280 λ 260/230 λ
123,3 1,82
141,2 1,99
  1. Restriction digest cut with EcoRI and XbaI
  2. Electroporation of + and the ligation of ...
  3. Gelelectrophoresis of
    • Only 1 band, so probably everything was cut
  4. Gelextraction of
    • Nanodrop = 29,3 ng/μl
  5. Ligation of vector and insert

[edit] Friday

  1. Transfer of the plates with cells from the ligation: 20 colonies have been transferred to a new plate to achieve more single colonies
  2. Plating of from -80°C
  3. Electroporation of the blue light promotor ligation (with ) in new competent cells