"
Fok Monomer
planning and cloning a monomeric restriction enzyme
A Survey by the “international Genetically Engineered
Machine”
(iGEM)
Team Freiburg 2009
Introduction
Introduction In order to create a universal restriction enzyme we followed several ideas and models. The first and most promising idea we had was to create a Fok Monomer as it represents the optimal and easiest model for a universal restriction enzyme If we are able to employ a monomeric enzyme, this protein would have a couple of advantages. Most importantly we would no longer need two separate oligonucleotides to achieve specific binding and cutting of the target DNA. Also only one protein has to be purified – thus saving time and money. A scientific advantage is the option to optimize the monomer by phage display. Using this technology, we would have the chance to create a thermostable, specific, universal restriction enzyme whose DNA binding activity is only created by a single oligonucleotide. Our goal was firstly to create a Fok-monomer which is able to cut DNA without a primary dimerization step and secondly to show that our heterodimeric interface design works properly. To reach this, we had to clone all the required parts one after another, resulting in a huge fusion protein. Results 3D modelling and design goals Fig1.: Scheme I. lipocalin II. Foka/i (heterodimers) III. Linker IV. His-Tag The necessary parts in the model of an monomeric restriction encyme are: Tag-binding protein - Fok heterodimer1 - linker - Fok herterodimer2 (Fig1). Tab.:1 list of parts usable for Fok Monomer In order to purify this fusion protein we had to employ a N-terminal tag. The binding protein (a lipocalin) mediates between the FokI protein and the tagged oligo. Both parts of the Fok heterodimers are associated with a long linker allowing them to establish the cutting site conformation. This artificial restriction nuclease domain is the functional part of the monomer and catalyzes the DNA cleavage. Before we started in the wet lab we planned all the individual steps and to figure out the best way to create the Fok monomer, so the first thing we did was to design a Fok monomer in silico. Fig2.: 3D model of Fok Monomer The model (Fig2.) shows that we have to use a linker which is something about 70 Angström in length to provide the required distance between the two Fok parts. Therefore we decided to order two complement oligonucleotides encoding one 36 amino acid glycine-serine linker. 5'-CTAGATGGCCGGCGGTTCTGGTGGTGGTTCTGGCGGTGGTTCTGGAGGTAGTTCTGGCGGTGGATCTGGAGGCGGTTCTGGGTCAGGATCTGGTGGAGGTTCTGGCTCTGGGAATCAGA-3' 3'-TACCGGCCGCCAAGACCACCACCAAGACCGCCACCAAGACCTCCATCAAGACCGCCACCTAGACCTCCGCCAAGACCCAGTCCTAGACCACCTACCAAGACCGAGACCCTTAGTCTGGCC-5 However at this stage the first problem appeared. This are the oligonucleotides, each 120aa long that we ordered from Mr.Gene. Unfortunately we made a mistake when ordering the complement oligonucleotide. As you can see we have two mismatches (compare coloured bases in the sequence). But somehow we managed to dimerize the two oligos. After dimerization in the thermo cycler and cloning into a pMA (BBa_K243031) vector (XbaI/AgeI) some mutations appeared in the 36GSLinker gene caused by the mismatches. But since there was no frame shift we decided to carry on. Firstly we picked the parts we were going to use. We decided to use one we already completed in our earlier experiments. His – FluA – Split - Foki (BBa_K243010) has all the functions we needed. These are (I) a tag to purify, (II) a Fok domain and (III) the anticalin which binds the modified oligonucleotide Fig.1. Cloning the linker (no part) behind those was the next step. We followed the assembly standard 25 and cut the vector with AgeI and PstI and the inserted with NgoMIV and PstI. However, we ran into some more problems. After cloning Foka (BBa_K243000) behind this construct, again assembly standard 25, we performed some test digestions to cut out the insert again. These showed that the plasmid became even smaller as it would be without an insertion (pEX: ~ 4,5kb and after test digestion ~ 2,2kb). The Insert should be about 1,9kb but as you can see in Fig.3 it´s about 900k. Also the sequencing went wrong. Most likely the active Fok did cut the plasmid and promoted deletion of the Fok gene, what gave mutated cells a significant growth advantage. After that we decided to order the 36GS-linker (GSAT Linker: BBa_K243029) as gene synthesis. 5´-GAGCTCGAATTCGCGGCCGCTTCTAGATGGCCGGCGGTGGTTCTGCCGGT GGCTCCGGTTCTGGCTCCAGCGGTGGCAGCTCTGGTGCGTCCGGCACGGG TACTGCGGGTGGCACTGGCAGCGGTTCCGGTACTGGCTCTGGCACCGGTA ATACTAGTAGCGGCCGCTGCAGGGTACC-3´ This time the order was well planned but it took over 4 weeks to get them. Unfortunately the genes arrived too late. Once again we have to make all the cloning steps. As of mid October 2009 the project is still in progress.
