|
|
CAROL
Modeling Readings
- Focused on how part BBa_F2620 was characterized and wrote up simple protocols to test our circuit when the circuit is completed.
- Some of the characteristics include: gene stability, response time, dynamic response and specificity.
- Started reading up on Simbiology and what kind of functionality the platform provides.
- No experiments performed.
|
|
|
CHINMOYEE
Descriptive Title of What You're Doing
|
|
|
EMILY
Restriction Digest and PCR with gene-specific primers of LuxOD47E in the psB1AC3 vector
- Objective: to verify that the gene of interest LuxOD47E has been biobricked (contains the biobrick restriction sites).
Restriction Digest
- Protocol: Digest 10 μL LuxOD47E BBK (C1- [60.3 ng/μL] and C2- [92.9 ng/μL]) with 1μL Not1 restriction enzyme (Invitrogen, CA), 2 μL REact 3 Buffer and 7 μL ddH20. Left for two hours in 37ºC water bath. Then heat activated in a 65ºC water bath for 10 minutes.
PCR of LuxOD47E in psB1AC3 with gene-specific primers
- Objective: To verify the presence of LuxOD47E in the psB1AC3 vector. If our gene of interest is biobricked and in the psB1AC3 vector, than we can proceed with construction.
- Protocol: Made 9x mastermix with 45 μL 10x PCR Buffer, minus Mg2+, 9 μL 10 mM dNTPs, 13.5 μL 50 mM MgCl2, 1.8 μL p Taq DNA Polymerase, 9 μL LuxO-R primer, 9 μL LuxO-F primer and 344.7 μL ddH2O. Split Mastermix into the tubes, 49 μL in each. Put 1 μL BBK LuxOD47E C1 DNA template into 2 tubes, 1 μL BBK LuxOD47E C2 DNA template into two tubes, 1 μL LuxOD47E TOPO 2 tubes (positive contorol) and 1 μL ddH2O into two tubes for a negative control.
Ran PCR with the folowing cycling conditions: 94°C for 3 minutes, 36x (94°C for 30 s, 53°C for 45 s and 72°C for 90 s), 72°C for 10 minutes. Held at 4°C.
- Results: Ran both the restriction digest and the PCR product on a 1% agarose gel at 120 V with 2 μL Orange 10X dye. Ran the restriction digest with uncut plasmid as positive control.
Lane 1- BBK LuxOD47E C1 digested
Lane 2- C1 uncut
Lane 3- BBK LuxOD47E C2 digested
Lane 4- C2 uncut
Lane 5- LuxOD47E BBK- C1
Lane 6- LuxOD47E BBK- C2
Lane 7- LuxOD47E TOPO (Positive Control)
Lane 8- Negative Control
- Analysis: Looking at the PCR Products, it looks extremely likely that the gene of interest, LuxOD47E, is in the psB1ACM vector, as the bands in the two BBK lanes match up with the band in the TOPO positive control lane. We will proceed to DNA sequencing for a fnal verification. For the restriction digest, it does not look like the DNA was cut as the bands in the cut lanes are identical to the bands in the uncut lanes for all colonies. This may have been because the reaction was not run long enough, there was a problem with the enzymes or there is a problem with the restriction sites themselves.
|
|
|
FAHD
Descriptive Title of What You're Doing
|
|
|
IMAN
Descriptive Title of What You're Doing
|
|
|
JAMIE
Descriptive Title of What You're Doing
|
|
|
JEREMY
Descriptive Title of What You're Doing
|
|
|
KATIE
Descriptive Title of What You're Doing
|
|
|
KEVIN
Verification of Pqrr4 for Reporter circuit
Restriction Digest
To verify the isolated Pqrr4, restriction digest was done with NotI (invitrogen, Lot 2803027) enzymes, React Buffer 3, and GeneRuler SM1333 ladder.
Polymerase Chain Reaction (PCR)
The Pqrr4 was then amplified using Polymerase Chain Reaction (PCR) from biobrick AC (pSB1AC3) using primers Pqrr4 F/R and platinum Thermus aquaticus (pTaq; invitrogen) according to the specifications of the manufacturer. The following cycling conditions were used:
94°C for 3 min; 36x (94°C for 30s; 53°C for 45s; 72°C for 1 min;) 72°C for 10 min; held at 4°C.
Figure 1. The Restriction digest and PCR of Pqrr4
Sequencing
Lastly, the Colony 1, being Pqrr4 BBK Green, was sent for sequencing with Pqrr4 F/R primers to the University of Calgary DNA Sequencing Facility (University Core DNA Services, Calgary, Alberta, Canada).
Legend:
Vector contamination
Biobrck restriction sites
Part of interest, in this case, Pqrr4
result
ATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTG
GAATTCGCGGCCGCTTCTAGA
GTATCAGCAAAAACACTACGGTGGATAATCAGTAAAACCATGAAACTAGAGCCCCGCACACTTGCGGGGCTTTTTAATTTTGAAT
TTCTTTCTTATTAAAACGCCATTTTTCTGATAAATGTATTAGTAGCAATGCGCATGGTGGCATATTTGCATCATTTTGCATTTTG
CAAATGCGATTTGCAAAATGCGTGCTCAATAAAGCACCAATATGCATCAGGATCGAAGAAAAAAGGCGTTTTTAAAAGTTGGCAC
GCATCGTGCTTTATACAGATACTAGTAGCGGCCGCT
GCAG
TCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGT
TATGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCA
CTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGG
CCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCCTGA
CGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGC
GTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGC
CTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGT
CGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAA
CTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGA
The above Pqrr4 sequence matches 100% with the expected Pqrr4 sequence; thus I can continue.
|
|
|
|
|
MANDY
Descriptive Title of What You're Doing
|
|
|
PATRICK
Descriptive Title of What You're Doing
|
|
|
PRIMA
Descriptive Title of What You're Doing
|
|
|
STEFAN
Descriptive Title of What You're Doing
|
|
|
VICKI
Descriptive Title of What You're Doing
|
"
