User contributions
From 2009.igem.org
(Latest | Earliest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)
- 06:46, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes/LB (top)
- 06:45, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes/LB
- 06:45, 20 October 2009 (diff | hist) N Team:Brown/Notebook Recipes/LB (New page: Making LB (Broth) ---- 1. Add 20g LB into 2. 1 L ddH2O in 2L of Flask ➢ Swirl the flask until all the LB is dissolved. ➢ Aliquot them into smaller volume (usually into 100ml bottle...)
- 06:45, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes
- 06:44, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes
- 06:43, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes
- 06:43, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes
- 06:42, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes
- 06:39, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes
- 06:35, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes
- 06:12, 20 October 2009 (diff | hist) Team:Brown/Parts
- 05:52, 20 October 2009 (diff | hist) Team:Brown/Project Introduction
- 05:49, 20 October 2009 (diff | hist) Team:Brown/Project Introduction
- 05:43, 20 October 2009 (diff | hist) N File:Allergic Response.ppt (top)
- 05:43, 20 October 2009 (diff | hist) Team:Brown
- 05:42, 20 October 2009 (diff | hist) Team:Brown
- 05:41, 20 October 2009 (diff | hist) Team:Brown
- 05:33, 20 October 2009 (diff | hist) Team:Brown/Project Introduction (/* A Synthetic Approach to Treating Allergic Rhinitis: Engineering Staphyloccocus Epidermidis to Secrete High-Affinity Histamine Binding Protein in Response to Elevated Levels of Histamine due to an A)
- 05:33, 20 October 2009 (diff | hist) Team:Brown/Project Introduction (/* A Synthetic Approach to Treating Allergic Rhinitis: Engineering Staphyloccocus Epidermidis to Secrete High-Affinity Histamine Binding Protein in Response to Elevated Levels of Histamine due to an A)
- 05:31, 20 October 2009 (diff | hist) Team:Brown/Project Introduction
- 04:31, 20 October 2009 (diff | hist) Team:Brown/Project
- 04:31, 20 October 2009 (diff | hist) Team:Brown/Project
- 04:30, 20 October 2009 (diff | hist) Team:Brown/Project
- 04:29, 20 October 2009 (diff | hist) Template:Brown
- 04:24, 20 October 2009 (diff | hist) Team:Brown
- 04:23, 20 October 2009 (diff | hist) Team:Brown
- 04:22, 20 October 2009 (diff | hist) Team:Brown
- 04:22, 20 October 2009 (diff | hist) Team:Brown
- 04:21, 20 October 2009 (diff | hist) Team:Brown
- 04:17, 20 October 2009 (diff | hist) Team:Brown
- 04:17, 20 October 2009 (diff | hist) Team:Brown
- 04:17, 20 October 2009 (diff | hist) Team:Brown
- 04:17, 20 October 2009 (diff | hist) Team:Brown
- 04:15, 20 October 2009 (diff | hist) Team:Brown
- 04:05, 20 October 2009 (diff | hist) N Team:Brown/Project All Together (New page: {{Brown}})
- 04:03, 20 October 2009 (diff | hist) N Team:Brown/Project Quorum Sensor (New page: {{Brown}}) (top)
- 03:55, 20 October 2009 (diff | hist) Team:Brown
- 03:44, 20 October 2009 (diff | hist) Team:Brown
- 03:42, 20 October 2009 (diff | hist) Team:Brown
- 03:41, 20 October 2009 (diff | hist) Template:Brown
- 03:38, 20 October 2009 (diff | hist) Team:Brown/Project
- 03:37, 20 October 2009 (diff | hist) Team:Brown/Project
- 03:08, 20 October 2009 (diff | hist) Team:Brown
- 03:08, 20 October 2009 (diff | hist) Team:Brown
- 03:06, 20 October 2009 (diff | hist) Team:Brown
- 03:06, 20 October 2009 (diff | hist) Team:Brown
- 03:03, 20 October 2009 (diff | hist) Team:Brown
- 02:34, 20 October 2009 (diff | hist) Team:Brown
- 02:33, 20 October 2009 (diff | hist) N File:Histaminesensorbutton.gif
- 02:29, 20 October 2009 (diff | hist) Team:Brown
- 02:29, 20 October 2009 (diff | hist) N File:Alltogetherbutton.gif
- 02:25, 20 October 2009 (diff | hist) Team:Brown
- 02:25, 20 October 2009 (diff | hist) N File:Quorumbutton.gif (top)
- 02:19, 20 October 2009 (diff | hist) Team:Brown/Project S.epidermidis
- 02:18, 20 October 2009 (diff | hist) Team:Brown/Project S.epidermidis
- 02:17, 20 October 2009 (diff | hist) Team:Brown
- 02:17, 20 October 2009 (diff | hist) N File:Hbpbutton.gif
- 02:09, 20 October 2009 (diff | hist) Team:Brown
- 02:09, 20 October 2009 (diff | hist) Team:Brown
- 02:08, 20 October 2009 (diff | hist) N File:S.epibutton.gif
- 01:59, 20 October 2009 (diff | hist) Team:Brown
- 01:59, 20 October 2009 (diff | hist) N File:Implicationsbutton.gif
- 01:47, 20 October 2009 (diff | hist) Team:Brown
- 01:44, 20 October 2009 (diff | hist) Team:Brown
- 01:43, 20 October 2009 (diff | hist) Team:Brown
- 01:42, 20 October 2009 (diff | hist) Template:Brown
- 01:42, 20 October 2009 (diff | hist) N File:Learnmoreallergiesbutton.gif
- 01:35, 20 October 2009 (diff | hist) Template:Brown
- 01:33, 20 October 2009 (diff | hist) Team:Brown
- 01:26, 20 October 2009 (diff | hist) Team:Brown
- 01:24, 20 October 2009 (diff | hist) N File:Notebookbutton.gif
- 00:32, 20 October 2009 (diff | hist) Team:Brown
- 00:30, 20 October 2009 (diff | hist) N File:Partsbutton.gif
- 00:23, 20 October 2009 (diff | hist) Team:Brown
- 00:23, 20 October 2009 (diff | hist) Team:Brown
- 00:21, 20 October 2009 (diff | hist) N File:Teambutton.gif
- 16:25, 19 October 2009 (diff | hist) Team:Brown
- 16:22, 19 October 2009 (diff | hist) Team:Brown
- 16:22, 19 October 2009 (diff | hist) Team:Brown
- 16:21, 19 October 2009 (diff | hist) Team:Brown
- 16:19, 19 October 2009 (diff | hist) Team:Brown
- 16:01, 19 October 2009 (diff | hist) Team:Brown
- 16:01, 19 October 2009 (diff | hist) Team:Brown
- 16:00, 19 October 2009 (diff | hist) Team:Brown
- 15:59, 19 October 2009 (diff | hist) Team:Brown
- 15:58, 19 October 2009 (diff | hist) Team:Brown
- 15:58, 19 October 2009 (diff | hist) Team:Brown (→Welcome to the Brown iGEM wiki!)
- 15:57, 19 October 2009 (diff | hist) Team:Brown (→Welcome to the Brown iGEM wiki!)
- 15:56, 19 October 2009 (diff | hist) Team:Brown
- 15:53, 19 October 2009 (diff | hist) N File:Taz1-plasmid.gif (top)
- 15:36, 19 October 2009 (diff | hist) File:REV131-plasmid.gif (uploaded a new version of "Image:REV131-plasmid.gif") (top)
- 15:31, 19 October 2009 (diff | hist) N File:REV131-plasmid.gif
- 02:25, 19 October 2009 (diff | hist) Team:Brown/Team
- 02:22, 19 October 2009 (diff | hist) Template:Brown
- 02:18, 19 October 2009 (diff | hist) Team:Brown/Project Introduction
- 02:17, 19 October 2009 (diff | hist) Team:Brown/Project Introduction
- 02:16, 19 October 2009 (diff | hist) Team:Brown/Project Introduction
- 02:16, 19 October 2009 (diff | hist) Team:Brown/Project Introduction
- 02:15, 19 October 2009 (diff | hist) Team:Brown/Project Introduction
- 02:15, 19 October 2009 (diff | hist) Team:Brown/Project Introduction
- 02:03, 19 October 2009 (diff | hist) Team:Brown/Project HBP
- 02:03, 19 October 2009 (diff | hist) Team:Brown/Project HBP
- 02:02, 19 October 2009 (diff | hist) Team:Brown/Project HBP
- 02:01, 19 October 2009 (diff | hist) Team:Brown/Project HBP
- 02:00, 19 October 2009 (diff | hist) Team:Brown/Project HBP
- 01:59, 19 October 2009 (diff | hist) N File:Mmdbimage.fcgi.png (top)
- 01:57, 19 October 2009 (diff | hist) Team:Brown/Project HBP
- 01:56, 19 October 2009 (diff | hist) Team:Brown/Project HBP
- 01:55, 19 October 2009 (diff | hist) Team:Brown/Project HBP
- 01:55, 19 October 2009 (diff | hist) Team:Brown/Project HBP
- 01:34, 19 October 2009 (diff | hist) Team:Brown/Project Histamine Sensor
- 01:34, 19 October 2009 (diff | hist) Team:Brown/Project Histamine Sensor
- 01:34, 19 October 2009 (diff | hist) Team:Brown/Project S.epidermidis
- 01:30, 19 October 2009 (diff | hist) Team:Brown/Project Histamine Sensor
- 01:26, 19 October 2009 (diff | hist) Template:Brown
- 01:24, 19 October 2009 (diff | hist) Team:Brown/Team
- 01:24, 19 October 2009 (diff | hist) Team:Brown/Team Members (Replacing page with '{{Brown}} == ''''' ==') (top)
- 01:22, 19 October 2009 (diff | hist) Team:Brown/Team
- 01:22, 19 October 2009 (diff | hist) Team:Brown/Team
- 01:22, 19 October 2009 (diff | hist) Team:Brown/Team
- 01:21, 19 October 2009 (diff | hist) Team:Brown/Team
- 01:03, 19 October 2009 (diff | hist) N Team:Brown/Notebook weekly Logs/Weekly Team2 Notebook (New page: <div style="background-color:black"> {{Brown}} <font><font color="white"> Team 2 Histamine Sensor Weekly Lab Log ---- ---- Week 6 ---- Jul 20, 09 Plan for the week: • Run...)
- 00:25, 19 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 00:23, 19 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 00:23, 19 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 00:19, 19 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 00:17, 19 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 00:16, 19 October 2009 (diff | hist) N Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook (New page: Team 1 Histamine Binding Protein Weekly Lab Log ---- Week 3: June 29 – July 3, 2009 Monday Lab Meeting • Team 1 is working on digesting insert out of pBluescript using ECOR1 and BA...)
- 00:06, 19 October 2009 (diff | hist) Team:Brown/Notebook Weekly Logs
- 00:06, 19 October 2009 (diff | hist) Team:Brown/Notebook Weekly Logs
- 00:04, 19 October 2009 (diff | hist) N Team1Noteboook (New page: == Week 3: June 29 – July 3, 2009 == Monday Lab Meeting • Team 1 is working on digesting insert out of pBluescript using ECOR1 and BAMH1 • pVU2 Site→ use to analyze digest of plas...) (top)
- 00:02, 19 October 2009 (diff | hist) Team:Brown/Notebook Weekly Logs
- 00:02, 19 October 2009 (diff | hist) Team:Brown/Notebook Weekly Logs
- 23:59, 18 October 2009 (diff | hist) Team:Brown/Notebook Weekly Logs
- 23:58, 18 October 2009 (diff | hist) Team:Brown/Notebook Weekly Logs
- 23:55, 18 October 2009 (diff | hist) Team:Brown/Notebook Protocols
- 23:54, 18 October 2009 (diff | hist) Team:Brown/Notebook Protocols
- 20:23, 18 October 2009 (diff | hist) Team:Brown/Parts
- 20:23, 18 October 2009 (diff | hist) Team:Brown/Parts
- 20:22, 18 October 2009 (diff | hist) N Team:Brown/Parts/OmpC (New page: tcccttgcatttacattttgaaacatctatagcgataaatgaaacatcttaaaagttttagtatcatattcgtgttggattattctgcatttttggggagaatggactaaagaggagaaaatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaa...)
- 20:22, 18 October 2009 (diff | hist) Team:Brown/Parts
- 20:20, 18 October 2009 (diff | hist) N Team:Brown/Parts/Tar-EnvZ (New page: ATGATTAACCGTATCCGCGTAGTCACGCTGTTGGTAATGGTGCTGGGGGTATTCGCACTGTTACAGCTTATTTCCGGCAGTCTGTTTTTTTCTTCCCTTCACCATAGCCAGAAGAGCTTTGTGGTTTCCAATCAATTACGGGAACAGCAGGGCGAGCTGACGTCAACCTGGGATTTAATGCTGCAAAC...)
- 20:15, 18 October 2009 (diff | hist) Team:Brown/Parts (Replacing page with '{{Brown}}')
- 20:12, 18 October 2009 (diff | hist) N Team:Brown/Notebook Recipes (New page: {{Brown}})
- 20:11, 18 October 2009 (diff | hist) N Team:Brown/Notebook Protocols (New page: {{Brown}})
- 20:11, 18 October 2009 (diff | hist) N Team:Brown/Notebook Weekly Logs (New page: {{Brown}})
- 20:10, 18 October 2009 (diff | hist) N Team:Brown/Project References (New page: {{Brown}}) (top)
- 20:10, 18 October 2009 (diff | hist) N Team:Brown/Project Histamine Sensor (New page: {{Brown}})
- 20:08, 18 October 2009 (diff | hist) N Team:Brown/Project S.epidermidis (New page: {{Brown}})
- 20:08, 18 October 2009 (diff | hist) N Team:Brown/Project HBP (New page: {{Brown}})
- 20:08, 18 October 2009 (diff | hist) N Team:Brown/Project Introduction (New page: {{Brown}})
- 20:07, 18 October 2009 (diff | hist) Team:Brown/Team Members
- 20:07, 18 October 2009 (diff | hist) Team:Brown/Team
- 20:04, 18 October 2009 (diff | hist) Template:Brown
- 20:03, 18 October 2009 (diff | hist) File:Allergenebanner09.jpg (uploaded a new version of "Image:Allergenebanner09.jpg") (top)
- 19:59, 18 October 2009 (diff | hist) Template:Brown
- 19:58, 18 October 2009 (diff | hist) Template:Brown
- 19:58, 18 October 2009 (diff | hist) Template:Brown
- 19:57, 18 October 2009 (diff | hist) Template:Brown
- 19:55, 18 October 2009 (diff | hist) Template:Brown
- 19:53, 18 October 2009 (diff | hist) Template:Brown
- 19:52, 18 October 2009 (diff | hist) Team:Brown
- 19:51, 18 October 2009 (diff | hist) Template:Brown
- 19:51, 18 October 2009 (diff | hist) N File:Allergenebanner09.jpg
- 19:50, 18 October 2009 (diff | hist) File:Allergenebanner09.gif (uploaded a new version of "Image:Allergenebanner09.gif") (top)
- 19:45, 18 October 2009 (diff | hist) Team:Brown/Team Members
- 19:43, 18 October 2009 (diff | hist) N Team:Brown/Team Members (New page: Image:Allergenebanner09.gif == '''Who we are''' == {|border = "0" |- |rowspan="0"| '''Advisors:''' *''' Faculty Advisor ''': Dr. Gary Wessel *'''Graduate Student Advisor ''': ...)
- 19:39, 18 October 2009 (diff | hist) Team:Brown/Team
- 19:37, 18 October 2009 (diff | hist) Team:Brown
- 19:15, 18 October 2009 (diff | hist) Team:Brown
- 19:14, 18 October 2009 (diff | hist) Team:Brown
- 19:13, 18 October 2009 (diff | hist) Team:Brown
- 19:12, 18 October 2009 (diff | hist) Team:Brown (→==)
- 18:36, 18 October 2009 (diff | hist) Template:Brown
- 18:32, 18 October 2009 (diff | hist) Team:Brown
- 17:43, 18 October 2009 (diff | hist) Template:Brown
- 17:42, 18 October 2009 (diff | hist) File:Allergenebanner09.gif (uploaded a new version of "Image:Allergenebanner09.gif")
- 18:25, 15 October 2009 (diff | hist) Team:Brown
- 17:50, 15 October 2009 (diff | hist) Team:Brown
- 17:42, 15 October 2009 (diff | hist) Team:Brown
- 17:41, 15 October 2009 (diff | hist) Team:Brown
- 17:40, 15 October 2009 (diff | hist) Template:Brown
- 17:38, 15 October 2009 (diff | hist) Template:Brown
- 17:29, 15 October 2009 (diff | hist) Team:Brown
- 17:28, 15 October 2009 (diff | hist) Template:Brown
- 17:08, 15 October 2009 (diff | hist) Template:Brown
- 16:53, 15 October 2009 (diff | hist) Template:Brown
- 16:48, 15 October 2009 (diff | hist) Team:Brown
- 16:48, 15 October 2009 (diff | hist) Template:Brown
- 16:47, 15 October 2009 (diff | hist) Template:Brown
- 16:45, 15 October 2009 (diff | hist) Template:Brown
- 16:31, 15 October 2009 (diff | hist) Template:Brown
- 16:29, 15 October 2009 (diff | hist) Template:Brown
- 16:28, 15 October 2009 (diff | hist) N Wiki/images/Allergenebanner09.gi (New page: Image:Allergenebanner09.gif) (top)
- 14:37, 15 October 2009 (diff | hist) N Template:Brown (New page: <center>960px</center> {| style="color:black;background-color:white;" cellpadding="3" cellspacing="1" border="0" bordercolor="#fff" width="62%" align="cent...)
- 14:36, 15 October 2009 (diff | hist) Team:Brown
- 14:36, 15 October 2009 (diff | hist) N Template:Template Brown (New page: <center>960px</center> {| style="color:black;background-color:white;" cellpadding="3" cellspacing="1" border="0" bordercolor="#fff" width="62%" align="cent...) (top)
- 14:35, 15 October 2009 (diff | hist) Team:Brown
- 14:12, 15 October 2009 (diff | hist) Team:Brown
- 14:08, 15 October 2009 (diff | hist) Team:Brown
- 14:08, 15 October 2009 (diff | hist) N File:3plasmids2.gif (top)
- 14:07, 15 October 2009 (diff | hist) Team:Brown
- 14:05, 15 October 2009 (diff | hist) Team:Brown
- 14:02, 15 October 2009 (diff | hist) N File:3plasmids.gif (top)
- 13:59, 15 October 2009 (diff | hist) Team:Brown
- 15:59, 13 October 2009 (diff | hist) Team:Brown/Notebook (top)
- 15:58, 13 October 2009 (diff | hist) Team:Brown/Project
- 15:57, 13 October 2009 (diff | hist) Team:Brown/Project (→Project Abstract)
- 15:56, 13 October 2009 (diff | hist) Team:Brown/Project
- 15:54, 13 October 2009 (diff | hist) Team:Brown/Team
- 15:54, 13 October 2009 (diff | hist) Team:Brown/Parts
- 15:53, 13 October 2009 (diff | hist) Team:Brown/Parts
- 15:51, 13 October 2009 (diff | hist) Team:Brown/Team
- 15:51, 13 October 2009 (diff | hist) Team:Brown/Team
- 21:56, 12 October 2009 (diff | hist) Team:Brown
- 21:56, 12 October 2009 (diff | hist) Team:Brown
- 21:54, 12 October 2009 (diff | hist) Team:Brown
- 21:51, 12 October 2009 (diff | hist) Team:Brown
- 21:51, 12 October 2009 (diff | hist) Team:Brown
- 21:50, 12 October 2009 (diff | hist) Team:Brown
- 21:50, 12 October 2009 (diff | hist) Team:Brown
- 21:49, 12 October 2009 (diff | hist) Team:Brown
- 21:44, 12 October 2009 (diff | hist) File:Allergenebanner09.gif (uploaded a new version of "Image:Allergenebanner09.gif")
- 21:37, 12 October 2009 (diff | hist) Team:Brown
- 21:34, 12 October 2009 (diff | hist) N File:Allergenebanner09.gif
- 20:57, 12 October 2009 (diff | hist) Team:Brown
- 20:51, 12 October 2009 (diff | hist) Team:Brown
- 20:50, 12 October 2009 (diff | hist) Team:Brown
- 20:06, 12 October 2009 (diff | hist) Team:Brown
- 20:05, 12 October 2009 (diff | hist) Team:Brown
- 20:05, 12 October 2009 (diff | hist) File:Igemallergenebanner10 12 09.gif (uploaded a new version of "Image:Igemallergenebanner10 12 09.gif") (top)
- 20:04, 12 October 2009 (diff | hist) File:Igemallergenebanner10 12 09.gif (uploaded a new version of "Image:Igemallergenebanner10 12 09.gif")
- 19:12, 12 October 2009 (diff | hist) N File:Igemallergenebanner10 12 09.gif
- 23:59, 1 October 2009 (diff | hist) N File:1.tif (top)
- 21:29, 30 September 2009 (diff | hist) Team:Brown
- 21:28, 30 September 2009 (diff | hist) N File:Allergenebanner9-30-09.gif (top)
- 21:27, 30 September 2009 (diff | hist) File:Allergenebanner9-30-09.tif (uploaded a new version of "Image:Allergenebanner9-30-09.tif") (top)
- 21:13, 30 September 2009 (diff | hist) N File:Allergenebanner9-30-09.tif (brownigembanner09)
- 21:10, 28 September 2009 (diff | hist) N File:Allergenebanner.tif (top)
- 17:20, 28 September 2009 (diff | hist) Team:Brown
- 17:18, 28 September 2009 (diff | hist) Team:Brown
- 19:29, 27 September 2009 (diff | hist) Team:Brown
- 17:49, 1 September 2009 (diff | hist) File:Brownigem09banner.gif (uploaded a new version of "Image:Brownigem09banner.gif") (top)
- 17:39, 1 September 2009 (diff | hist) N File:Brownigem09banner.gif
- 00:44, 1 September 2009 (diff | hist) Team:Brown/Project
- 00:42, 1 September 2009 (diff | hist) Team:Brown
- 00:41, 1 September 2009 (diff | hist) Team:Brown/Team
- 00:37, 1 September 2009 (diff | hist) Team:Brown/Team
- 21:31, 31 August 2009 (diff | hist) Team:Brown
- 21:22, 31 August 2009 (diff | hist) File:Team.jpg (uploaded a new version of "Image:Team.jpg")
(Latest | Earliest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)