Team:KULeuven/Notebook/Blue Light Receptor

From 2009.igem.org

Revision as of 09:57, 24 July 2009 by JochemDeen (Talk | contribs)

13 July

  • YCGF Gene, natural available in [http://ecoliwiki.net/colipedia/index.php/ycgF:Gene 3 E. Coli strains]. Can use the promotor of Ycgf gene for expression
  • Probable strain K12
  • Promotor voor YCGF gene:
    • AACAATCCAGGGTAATGGGTGAGGCGAGAGTAAGACGGTAACAGACATATCTTCTTG TGTCTTTCTTTTAATACCAAAACATAACCGTTTCTTTACATTGATAAAAAATGGAAAAAG TTGAACACTAGTTGGCGAAAAATCTTGTATAGATTGTCAGTTAAATGATGCAATATGTT TTATCATAACACATTGTTTTATATGCATTAGCACTAATTGCAAAAAATTAATTTATCATT CTGTACACATATTTCGTACAAGTTTGCTATTGTTACTTCACTTAACATTGATTAACATTTTTAACAGAGGCGTAGCATG (bron: [www.ncbi.nlm.nih.gov])

14 July

  • Biobricks for vanillin synthesis
    • Send mail to University of Tuscia [Done]
    • Order:
      • (sam8 (tyrosine-ammonia lyase) coding sequence) [ordered]
      • (sam5 (coumarate hydroxylase) coding sequence) [ordered]
      • (COMT gene with ribosome binding site) [Available in kit]

Extra info on Vanillin synthesis

http://www.ncbi.nlm.nih.gov/pubmed/16232583 1 B C Okeke and V Venturi ,Construction of recombinants Pseudomonas putida BO14 and Escherichia coli QEFCA8 for ferulic acid biotransformation to vanillin, J Biosci Bioeng. 1999; 88(1): 103–106.
http://www.ncbi.nlm.nih.gov/pubmed/14602615 2 Jörg Overhage, Alexander Steinbüchel, and Horst Priefert,Highly Efficient Biotransformation of Eugenol to Ferulic Acid and Further Conversion to Vanillin in Recombinant Strains of Escherichia coli, Appl Environ Microbiol. 2003 November; 69(11): 6569–6576. doi: 10.1128/AEM.69.11.6569-6576.2003.
http://www.ncbi.nlm.nih.gov/pubmed/10616715 3 J Overhage, H Priefert, J Rabenhorst, and A Steinbüchel,Biotransformation of eugenol to vanillin by a mutant of Pseudomonas sp. strain HR199 constructed by disruption of the vanillin dehydrogenase (vdh) gene, Appl Microbiol Biotechnol. 1999 November; 52(6): 820–828.
http://www.labmeeting.com/paper/2776259/yoon-enhanced-vanillin-production-from-recombinant-e-coli-using-ntg-mutagenesis-and-adsorbent-resin 4 Yoon SH, Lee EG, Das A, Lee SH, Li C, Ryu HK, Choi MS, Seo WT, and Kim SW, Enhanced vanillin production from recombinant E. coli using NTG mutagenesis and adsorbent resin, Biotechnology progress 23(5):1143.
http://www.scielo.br/scielo.php?pid=S1517-83822003000500037&script=sci_arttext 5 Attilio ConvertiI; Danilo de FaveriI; Patrizia PeregoI; Paolo BarghiniII; Maurizio RuzziII; Luciane SeneIII, Vanillin production by recombinant strains of Escherichia coli, Braz. J. Microbiol. vol.34 suppl.1 São Paulo Nov. 2003
http://www.springerlink.com/content/bj47xnqn5kr65wvp/fulltext.pdf 6 S. Achterholt, H. Priefert, and A. Steinbüchel, Identification of Amycolatopsis sp. strain HR167 genes, involved in the bioconversion of ferulic acid to vanillin, Appl Microbiol Biotechnol. 2000 December; 54(6): 799–807

Retrieved from "http://2009.igem.org/Team:KULeuven/Notebook/Blue_Light_Receptor"